ID: 1175893791

View in Genome Browser
Species Human (GRCh38)
Location 20:62327191-62327213
Sequence TGGGGGAGGCACTTTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 442}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175893791_1175893798 0 Left 1175893791 20:62327191-62327213 CCATCCTCAAAGTGCCTCCCCCA 0: 1
1: 0
2: 4
3: 41
4: 442
Right 1175893798 20:62327214-62327236 GACCTGATGCCCTGCTTACCCGG 0: 1
1: 0
2: 1
3: 26
4: 145
1175893791_1175893808 20 Left 1175893791 20:62327191-62327213 CCATCCTCAAAGTGCCTCCCCCA 0: 1
1: 0
2: 4
3: 41
4: 442
Right 1175893808 20:62327234-62327256 CGGTCCCCCAGGTAGGAGGGTGG 0: 1
1: 0
2: 1
3: 32
4: 584
1175893791_1175893805 17 Left 1175893791 20:62327191-62327213 CCATCCTCAAAGTGCCTCCCCCA 0: 1
1: 0
2: 4
3: 41
4: 442
Right 1175893805 20:62327231-62327253 ACCCGGTCCCCCAGGTAGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 220
1175893791_1175893803 13 Left 1175893791 20:62327191-62327213 CCATCCTCAAAGTGCCTCCCCCA 0: 1
1: 0
2: 4
3: 41
4: 442
Right 1175893803 20:62327227-62327249 GCTTACCCGGTCCCCCAGGTAGG 0: 1
1: 0
2: 0
3: 40
4: 947
1175893791_1175893804 16 Left 1175893791 20:62327191-62327213 CCATCCTCAAAGTGCCTCCCCCA 0: 1
1: 0
2: 4
3: 41
4: 442
Right 1175893804 20:62327230-62327252 TACCCGGTCCCCCAGGTAGGAGG 0: 1
1: 0
2: 2
3: 7
4: 88
1175893791_1175893810 22 Left 1175893791 20:62327191-62327213 CCATCCTCAAAGTGCCTCCCCCA 0: 1
1: 0
2: 4
3: 41
4: 442
Right 1175893810 20:62327236-62327258 GTCCCCCAGGTAGGAGGGTGGGG 0: 1
1: 0
2: 1
3: 28
4: 385
1175893791_1175893809 21 Left 1175893791 20:62327191-62327213 CCATCCTCAAAGTGCCTCCCCCA 0: 1
1: 0
2: 4
3: 41
4: 442
Right 1175893809 20:62327235-62327257 GGTCCCCCAGGTAGGAGGGTGGG 0: 1
1: 0
2: 2
3: 12
4: 274
1175893791_1175893801 9 Left 1175893791 20:62327191-62327213 CCATCCTCAAAGTGCCTCCCCCA 0: 1
1: 0
2: 4
3: 41
4: 442
Right 1175893801 20:62327223-62327245 CCCTGCTTACCCGGTCCCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175893791 Original CRISPR TGGGGGAGGCACTTTGAGGA TGG (reversed) Intronic
900419992 1:2552048-2552070 GGGTGGAGGCCCATTGAGGATGG - Intergenic
900424433 1:2569594-2569616 GGGTGGAGGCCCATTGAGGATGG + Intergenic
900623724 1:3598827-3598849 TGGGGGAGGGGCTCTGAGGGTGG - Intronic
901176064 1:7300227-7300249 TAGGGGAGACCCTTGGAGGAAGG - Intronic
901847489 1:11992736-11992758 GGAGGGAGGCACTTTGTGCAAGG + Intronic
902323444 1:15683923-15683945 TGGGGGAGGGTCTCCGAGGAGGG + Intergenic
902603225 1:17554213-17554235 TGGGTGAGTCACAGTGAGGATGG + Intronic
903528546 1:24011932-24011954 TGGGGAGGGCACTGTGGGGAAGG - Intergenic
903620178 1:24692450-24692472 TGGAGGATCCACTTTGAAGATGG + Intergenic
904554017 1:31345873-31345895 TGGGGGAGGGACCTTGTGGGAGG - Intronic
904753962 1:32757933-32757955 TGGAGGAAGCACTGTGGGGAGGG + Intronic
906070558 1:43013433-43013455 TGGGGTAGCCATTTGGAGGATGG + Intergenic
906141215 1:43534667-43534689 TGGGGGAGGCACATCAAGGAGGG + Intronic
907520839 1:55022360-55022382 TGGAGGACGCAGTTTCAGGAAGG - Intergenic
908384269 1:63626130-63626152 CAGGGGAGGCCATTTGAGGATGG + Intronic
908472214 1:64455452-64455474 CTGGGGAGGGACCTTGAGGAAGG + Intergenic
908472226 1:64455522-64455544 TGGGGAAGGTATTTGGAGGATGG + Intergenic
908780207 1:67684393-67684415 TGGGCAAGGCTCTTTGAGAAAGG + Intergenic
910926278 1:92401109-92401131 TGGGGGAGGGACCTCGTGGAAGG - Exonic
911610157 1:99951570-99951592 TGGGGGAGGCACCTCGTGGAAGG - Intergenic
913518107 1:119622405-119622427 AGGACCAGGCACTTTGAGGAAGG - Exonic
915293433 1:154902068-154902090 TGGGGGAGTCAGTATGGGGATGG + Intergenic
915664931 1:157435644-157435666 TGGGTGAGGCCCTTTAAGAACGG - Intergenic
916883771 1:169047444-169047466 TGGGTGAGGCACTAAGGGGATGG + Intergenic
919758995 1:201085221-201085243 CAGGGGAGGCGCTATGAGGATGG + Intronic
919773668 1:201179305-201179327 TGGGAGAGTCACATGGAGGATGG - Intergenic
919866848 1:201788870-201788892 TGGGGGAGGGAAATTGAGCATGG + Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920400340 1:205672214-205672236 TGGGGGAGGCACGTGGGTGAGGG - Intronic
920800370 1:209182193-209182215 TGGGGGAGGGACCTTGTGGGAGG + Intergenic
921755545 1:218851874-218851896 TCGGTGAGGCACTCAGAGGAGGG - Intergenic
923057441 1:230437573-230437595 TGGGTGATGCACTTTGAAGATGG - Intergenic
923230080 1:231977442-231977464 GGAGTGAGGCACTTTGAAGATGG - Intronic
923681220 1:236120231-236120253 AGGGGGAGGCATTTTAAGGAGGG + Intergenic
1062767074 10:74122-74144 TGGGGGGTCCACTGTGAGGACGG - Intergenic
1062772194 10:111123-111145 TGGGGGAGGGACTTGGTGGGAGG - Intergenic
1064035286 10:11909169-11909191 TGAGTGTGGCCCTTTGAGGAAGG - Intergenic
1064723325 10:18251883-18251905 TGGGGGAGGGACTTGGTGGGAGG - Intronic
1066187607 10:33025415-33025437 TGGGGGAGGAAGTTCAAGGAAGG - Intergenic
1067801052 10:49359979-49360001 AGGGGGAGGGGCTTTGAGGCAGG + Intergenic
1068536049 10:58242818-58242840 TGGGGGAGGGACTTGGTGGGAGG + Intronic
1069100542 10:64315038-64315060 TGTGGGAGACATTTTGTGGAGGG + Intergenic
1069875337 10:71559590-71559612 TGAAGGAGGGACTCTGAGGAGGG + Intronic
1071277235 10:84066398-84066420 TGGAGGAAGCACTTGCAGGAAGG - Intergenic
1071436151 10:85649831-85649853 TGGGGGTGGCATTTTGGGGTGGG - Intronic
1071850299 10:89561839-89561861 TGGGGGAGGCTCTTGGGAGAAGG + Intergenic
1074159564 10:110826400-110826422 TGGGGGTTGCACTGTGGGGAGGG - Intronic
1074680689 10:115904051-115904073 TGTGGGAGGCAGTGTGGGGAAGG + Intronic
1075607421 10:123822562-123822584 TGGGGGAGGCACTTCTCGGGAGG + Intronic
1075631334 10:124002445-124002467 TGGAGGAGGCATTTTGAGAATGG + Intergenic
1075717650 10:124566277-124566299 TGGGAGACTCACTTTCAGGAGGG + Intronic
1076727238 10:132419503-132419525 TGGGGGAGGGGCCTGGAGGAGGG + Intergenic
1076727252 10:132419532-132419554 TGGGGGAGGGGCCTGGAGGAGGG + Intergenic
1076727266 10:132419561-132419583 TGGGGGAGGGGCCTGGAGGAGGG + Intergenic
1076727295 10:132419618-132419640 TGGGGGAGGGGCCTGGAGGAGGG + Intergenic
1076780668 10:132722709-132722731 CGGCGGAGGCACTGGGAGGAGGG - Intronic
1077340032 11:2022120-2022142 TGGGGTAGGCACTGGGAGGAGGG + Intergenic
1077403989 11:2374620-2374642 AGCCGGAGGCACGTTGAGGAAGG - Intergenic
1077469780 11:2751799-2751821 TGGGAGAGGCACTCTGTGTAGGG - Intronic
1080272904 11:30469665-30469687 TGGGGGAGGCACTCTCTGAAGGG - Intronic
1081380263 11:42406418-42406440 TGAGGGAGGTTCTTTGTGGATGG - Intergenic
1081525968 11:43928059-43928081 TGGAGGAGGCACTTGGAGAATGG + Intronic
1081620270 11:44615186-44615208 GGGGGGAGGCAGTTTAAGTAGGG + Intronic
1081673186 11:44953128-44953150 AGGGTGAGGCACTGTCAGGATGG - Intergenic
1083334949 11:61917027-61917049 TGGGGCATGCACCTAGAGGAAGG - Intronic
1084381654 11:68816637-68816659 TGGAGGAGGCACCGTGAGAAGGG - Intronic
1085333622 11:75672857-75672879 TGGGGGAGGGACCTGGTGGAAGG - Intergenic
1085497901 11:76988605-76988627 TGGGGAAGGGACTTTGTGGGAGG - Intronic
1086006899 11:82048086-82048108 TGGGGGAGGGACGTTGTGGGAGG + Intergenic
1086192744 11:84098685-84098707 TGGGCCAGGCACTGTGAGGAGGG - Intronic
1086309875 11:85523087-85523109 TGGGGGAGGGACCTTGTGGGAGG + Intronic
1087552365 11:99667808-99667830 AGGGGAAGGAACTTAGAGGATGG + Intronic
1088544122 11:110942697-110942719 TGGGGGAGGCACCCCCAGGATGG + Intergenic
1088706538 11:112469009-112469031 TAGGGGAGGCTCTCTGAGAAAGG - Intergenic
1088791739 11:113232532-113232554 TGGGAGAGGCACATTCAGGGAGG - Intronic
1088928401 11:114325091-114325113 TGGGGAGGGAACTTAGAGGATGG + Intergenic
1089004126 11:115076650-115076672 AGGGTGAGACAGTTTGAGGAAGG - Intergenic
1090343477 11:126046840-126046862 TCTGTGAGGCACCTTGAGGATGG + Intronic
1090435241 11:126681474-126681496 TGAGGGAGGCAGTTTATGGAGGG + Intronic
1091331777 11:134736422-134736444 TGGTGGTTGCACCTTGAGGAGGG - Intergenic
1202823017 11_KI270721v1_random:77309-77331 TGGGGTAGGCACTGGGAGGAGGG + Intergenic
1091403140 12:193032-193054 AGCAGGAGGCACTGTGAGGAAGG + Intronic
1092889730 12:12957754-12957776 TGGCGGAGGCAGTTTGAGACAGG - Intergenic
1094055247 12:26262481-26262503 AGGGGAAGGAACTTAGAGGATGG + Intronic
1094358809 12:29607760-29607782 TAGTTGAGGCACCTTGAGGATGG - Intronic
1094738436 12:33260842-33260864 TGGGGGAGGGACCTTGTGGGAGG + Intergenic
1095337892 12:41050549-41050571 TGGGGGAGGGACCTGGTGGAAGG - Intronic
1095604372 12:44049430-44049452 AGGGGAAGGAACTTAGAGGATGG + Intronic
1096742237 12:53702303-53702325 TGGAGGAAGCACTGAGAGGAGGG - Intergenic
1098024491 12:66188146-66188168 TGTGTGAAGCACTTTGAGGAAGG + Intergenic
1098139707 12:67438947-67438969 TGGGGGAGGAACCTGGTGGAAGG + Intergenic
1098289334 12:68941796-68941818 TGGGGGAGCTACTTTGAAGGAGG - Intronic
1098636329 12:72788675-72788697 TGTGGGAGGGACTGTGTGGAAGG + Intergenic
1099971862 12:89508700-89508722 TGGGGGAGGGACCTTGTGGGAGG + Intronic
1100147894 12:91699632-91699654 TGTGGGAGGCACCTGGTGGAAGG - Intergenic
1101821326 12:108186276-108186298 AGGGGGAGGCTGTTGGAGGAGGG - Intronic
1102397840 12:112602477-112602499 TGGGGGAGGAAGCTAGAGGAAGG + Intronic
1102449173 12:113027797-113027819 TGGGGGAGGTACCTGGTGGAAGG + Intergenic
1103862850 12:124028063-124028085 TGGTGGAGGGACTTTGAGTCTGG - Intronic
1104087952 12:125493189-125493211 TGCTGGGAGCACTTTGAGGAGGG + Intronic
1104632314 12:130413937-130413959 TGGAGAAGGCACTTTGCAGAGGG + Intronic
1105790141 13:23790589-23790611 AGGGGGAGGCAATGTGATGAGGG + Intronic
1105909118 13:24844356-24844378 GGAGGAAGGCACTTTTAGGATGG + Intronic
1106060367 13:26284861-26284883 TGGGGGAGGGAGATTGGGGAGGG + Intronic
1106584069 13:31042236-31042258 TTGGGTAGGCACTTTGAGTTTGG - Intergenic
1107726661 13:43306119-43306141 TGGGGGAGGCTCTTTATGGAAGG + Intronic
1107972841 13:45660730-45660752 TGGGGGAGGGACCTGGTGGAAGG - Intergenic
1108561510 13:51648623-51648645 TAGGGGAGGGAACTTGAGGATGG + Intronic
1108751216 13:53450187-53450209 TGGGGGAGGGACCTTGTGGGAGG - Intergenic
1109885308 13:68534440-68534462 TGAGGAAAGCACTTTGAGAATGG + Intergenic
1110237918 13:73235663-73235685 TGGTGGAGGAACTTTGAAGTGGG - Intergenic
1110341248 13:74393131-74393153 TGGGGGAGGGACCTTGTGGGAGG - Intergenic
1110939196 13:81328347-81328369 TGGTGGGGGAACTTAGAGGATGG - Intergenic
1111286597 13:86102133-86102155 TGGGGAGGGAACTTAGAGGATGG - Intergenic
1112243543 13:97706183-97706205 TGAAGGGGGCACTTTGAGGGAGG - Intergenic
1113147928 13:107229588-107229610 TGGGTGAGGAATTTGGAGGAAGG + Intronic
1113505187 13:110811882-110811904 TGGGGAAAGCCCCTTGAGGATGG - Intergenic
1116064661 14:39968038-39968060 TGGGGTAGGTACTTTGTGGTAGG + Intergenic
1116133703 14:40892734-40892756 TGTGGGAGGAACTTGGAGGGAGG - Intergenic
1116167734 14:41354842-41354864 GGGAGGAGGCAATTTGAGGAGGG + Intergenic
1118041053 14:61917439-61917461 TGGGGGGAGCATATTGAGGAAGG + Intergenic
1118523466 14:66614843-66614865 AGGGGAAGGAACTTAGAGGATGG - Intronic
1118893726 14:69929233-69929255 TGGGGGAGGCAGATGGAGTAGGG - Intronic
1119205351 14:72789873-72789895 TGGGGGAGGCCCCCTGAGGAGGG - Intronic
1119380016 14:74222503-74222525 TGGGGGAGGTCCTATCAGGAGGG - Intergenic
1119488042 14:75004830-75004852 TCGGGCAGCCTCTTTGAGGAAGG - Exonic
1119489720 14:75020686-75020708 TGGGTGAGGCCCTGTGAGGAAGG - Intronic
1119568670 14:75650474-75650496 TGGGGGAGGCCCTCTGGGTAGGG + Exonic
1119787778 14:77325928-77325950 TGGAGGAGACACCTGGAGGAGGG - Intronic
1120208750 14:81613558-81613580 TGAGGGAGGGACTTGGTGGAAGG - Intergenic
1121619361 14:95335580-95335602 TGAGGGAGGCTGTTTCAGGAAGG - Intergenic
1122107122 14:99466664-99466686 TGAGGGAAGCACAGTGAGGAAGG + Intronic
1124807845 15:32904474-32904496 TGGGAGAGGAAATTTGAGGCTGG + Intronic
1127289657 15:57558874-57558896 TGGGGGAGGCACCTGGTGGGAGG + Intergenic
1127317149 15:57808046-57808068 TGGGGGAGGGACAGTGAGTAGGG - Intergenic
1127354210 15:58182625-58182647 TAGGGGAGGCACATGGAGGGTGG - Intronic
1127689866 15:61384886-61384908 TGTGGCAGGCACTGTGAAGAAGG - Intergenic
1128159312 15:65413109-65413131 TGGGGGAGCCACCTGGATGAAGG + Intronic
1128160717 15:65421681-65421703 TCGGGGAGGGACTTGGAGGTGGG - Intronic
1128581802 15:68815987-68816009 TGGGGGACACATTTTGAGTAAGG - Intronic
1128701926 15:69811023-69811045 TGGGGGAGGCAATTGAGGGAGGG + Intergenic
1129236599 15:74227407-74227429 ACGGGGAAGCACTTTGAGGGAGG + Intergenic
1129457404 15:75683182-75683204 TGCGGGAGGCCCTTTGTGCAGGG - Intronic
1129696032 15:77741163-77741185 TGGGGAAGGCACTCTCAGCAGGG + Intronic
1129726387 15:77903763-77903785 TGTGGGAGGCCCTTTGTGCAGGG + Intergenic
1129872395 15:78948910-78948932 TGTGTGAGGCACTTGGAGCAGGG - Intronic
1130978607 15:88796400-88796422 TGGGGGAGGGACCTGGTGGAAGG - Intergenic
1131436489 15:92426630-92426652 TGGGGGTGGGGCTGTGAGGAGGG + Intronic
1132513303 16:354324-354346 TGGGGGAGGCGCCCTTAGGAAGG - Intergenic
1132780304 16:1620724-1620746 TGAGGGAGGGACTTTGAGGTTGG + Intronic
1133200968 16:4204325-4204347 TGGAGGAGGCTCTGTGAGCAAGG - Intronic
1134378219 16:13699452-13699474 TGAGGGATCCACTTTCAGGATGG - Intergenic
1134408140 16:13980907-13980929 TGGGGAAGGAACTTGGAGGAAGG + Intergenic
1134803866 16:17108585-17108607 TGGGGGAGGCCCTCTGTGAATGG - Exonic
1135808214 16:25563788-25563810 TGAGGGAGGGACTTTGTGGGAGG + Intergenic
1135860271 16:26049951-26049973 AGGGGGAGGCTCCTGGAGGACGG - Intronic
1137725481 16:50653933-50653955 GGGGCCAGGAACTTTGAGGAGGG + Intergenic
1138126799 16:54445807-54445829 TGGGGGAGGTATTTTGATGGTGG + Intergenic
1140051706 16:71487183-71487205 TGGGGGAGGAACATGGTGGAAGG + Intronic
1141173759 16:81706325-81706347 AGGGGGAGGCACCCTGAGCAGGG + Intronic
1141466021 16:84206339-84206361 TGGAGGACACACTTTGGGGAAGG - Intergenic
1141579685 16:84988733-84988755 TGGGGTAGGCACATGGGGGAGGG - Intronic
1142127999 16:88419683-88419705 TGTTGGAGGAACGTTGAGGAGGG - Intergenic
1142957824 17:3533176-3533198 TGGGGGAGGCACTAACAGGTTGG - Intronic
1143210620 17:5184584-5184606 TGGGGGAGGAACTTGCTGGATGG + Intronic
1143726248 17:8848813-8848835 TGGACGAGGCTCTCTGAGGATGG + Intronic
1143836884 17:9699957-9699979 GAGGGGAGGCACTGTGAGGTTGG + Intronic
1145797194 17:27662579-27662601 TGAGGGAGGCTGTTTCAGGAGGG - Intergenic
1145811593 17:27767520-27767542 TGAGGGAGGCTGTTTCAGGAGGG - Intronic
1146401700 17:32504828-32504850 GGAGGGAAGCACTTTGAGGGAGG - Intronic
1146841864 17:36161908-36161930 TGAGGGAGGCTGTTTCAGGAGGG + Intergenic
1146854174 17:36249868-36249890 TGAGGGAGGCTGTTTCAGGAGGG + Intronic
1146870078 17:36373760-36373782 TGAGGGAGGCTGTTTCAGGAGGG + Intronic
1146877435 17:36424841-36424863 TGAGGGAGGCTGTTTCAGGAGGG + Intronic
1146891826 17:36511322-36511344 TGGGGCAGGCCCTGTCAGGAAGG - Intronic
1147072959 17:37974384-37974406 TGAGGGAGGCTGTTTCAGGAGGG + Intergenic
1147084481 17:38053922-38053944 TGAGGGAGGCTGTTTCAGGAGGG + Intronic
1147100428 17:38177888-38177910 TGAGGGAGGCTGTTTCAGGAGGG + Intergenic
1148523660 17:48307994-48308016 TGGGGGAGCCACCTTGTGGCTGG - Intronic
1148861951 17:50609183-50609205 TGGGAGTGGCACTCTGAGGCGGG + Intronic
1148865161 17:50624468-50624490 TGGTGGGGGCAGTTTGGGGATGG - Exonic
1149143025 17:53457058-53457080 TGGGGGAGGGACCTTGTGGGAGG + Intergenic
1149773806 17:59341734-59341756 TGGTGGAAGCACTTTTAAGAAGG + Intronic
1150083369 17:62260934-62260956 TGAGGGAGGCTGTTTCAGGAGGG + Intergenic
1151188178 17:72379039-72379061 TGGGGGAGGTCCCTTTAGGAAGG + Intergenic
1151412749 17:73942163-73942185 TGCAGGAGGCACTGTGAGGGAGG + Intergenic
1151608176 17:75153677-75153699 GAGGGGAGGCACTTCGAAGAGGG + Intronic
1152096023 17:78272016-78272038 TGAGGGAGGCAGATAGAGGAAGG - Intergenic
1152790710 17:82277577-82277599 TGGAGGGGGCACTTTGGAGAGGG + Intergenic
1152959927 18:73465-73487 TGGGGGGTCCACTGTGAGGACGG - Intronic
1154353560 18:13607581-13607603 TGGGGGAGGCAAGGGGAGGAAGG - Intronic
1154378553 18:13829049-13829071 TGGGGGAGACACTTTGTGTTGGG - Intergenic
1155021503 18:21901035-21901057 TGGGGGAGGGACCTGGTGGAAGG + Intergenic
1155677724 18:28449866-28449888 TGAGTGATGCACTTTGAAGATGG - Intergenic
1155872445 18:31044194-31044216 TGCTGGAGGCACGTGGAGGATGG - Intergenic
1156429274 18:37053785-37053807 TGGGGGAGGAACCTTGTGGGAGG - Intronic
1157208783 18:45723020-45723042 CTCGGGAGGCACTTGGAGGAAGG + Intergenic
1157223778 18:45845310-45845332 TGTGGGAAGCATGTTGAGGAGGG + Intergenic
1157531676 18:48426478-48426500 GGGGAGAGGCAATTTGAGGATGG - Intergenic
1158129601 18:54138379-54138401 TGGGGGAGGGACCTGGTGGAAGG + Intergenic
1158274143 18:55748259-55748281 GGTGGGAGGCACTGTGTGGAAGG - Intergenic
1158941534 18:62409646-62409668 TGGAGGATGCACTTTGAGGATGG + Intergenic
1159497461 18:69224540-69224562 TGTGGGAGGCACACTGAAGAAGG - Intergenic
1159809793 18:73004147-73004169 TTGGGGAGGCACCTTGTGGGAGG - Intergenic
1159950108 18:74476680-74476702 TGGGTGATGCACTTTGAAGATGG + Intergenic
1161347907 19:3777290-3777312 TGGGGGAGGCAGGAGGAGGAGGG + Intergenic
1161349001 19:3782288-3782310 TGGAGGGGGCACTTTCTGGAGGG - Intronic
1161445155 19:4314312-4314334 AGGCGGGGGCACTTGGAGGAGGG - Intronic
1161510924 19:4670478-4670500 TGGGGGCGGGACTTTGTCGAGGG + Intergenic
1161821794 19:6534358-6534380 TGGGGGCGGGACTCTGAGCAGGG - Intronic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1162188121 19:8922861-8922883 TGGGCGAGGCAGTGTGAGGTGGG + Intronic
1163001739 19:14372462-14372484 TCTGGGGGGCACTGTGAGGACGG - Intergenic
1163064586 19:14783897-14783919 TCTGGGGGGCACTGTGAGGATGG + Intergenic
1163454638 19:17399297-17399319 TGGGGGAGGGAGTGTGAGTAGGG + Intergenic
1163821178 19:19497495-19497517 TGGGGGAGGCTCTGAGGGGAAGG + Intronic
1164625993 19:29728392-29728414 ATAGGCAGGCACTTTGAGGAAGG - Intergenic
1164925109 19:32124335-32124357 TGGGGGAAGTCCTTCGAGGAGGG + Intergenic
1165800420 19:38546236-38546258 TGGGGTTGGCACTTGGGGGACGG - Intronic
1166081523 19:40446592-40446614 TGGAGGAGGAACTGTAAGGAGGG - Intergenic
1166142665 19:40813385-40813407 TGTGCCAGGCACTTGGAGGAAGG - Intronic
1166184863 19:41133383-41133405 TGTGCCAGGCACTTGGAGGAAGG + Intergenic
1167922273 19:52791778-52791800 TGGGGGAGGCTCCTCCAGGAGGG - Intronic
1168141230 19:54388667-54388689 AGGGGGAGAAACTTGGAGGAGGG - Intergenic
925079224 2:1049077-1049099 TGTGGGAGGCTGTTTGGGGAAGG - Intronic
925132887 2:1505710-1505732 GAGGGGAGGAACTTAGAGGATGG - Intronic
926153914 2:10440086-10440108 TGTGGGAGGCCCTTTGAGCCTGG - Exonic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
926477700 2:13348120-13348142 TGGAGGTGGCATTTTGGGGAAGG + Intergenic
926827569 2:16922557-16922579 TGGGGGAGGGACCTTGTGGGCGG + Intergenic
927435557 2:23063296-23063318 TGGTGCAGGCACTTAGAGGAAGG - Intergenic
927872001 2:26629607-26629629 TGGGGGTGTCTCTTTGAGGAAGG + Intronic
928372081 2:30747490-30747512 TTGGGGAGGAACTTTGAGGGAGG + Intronic
928697368 2:33862808-33862830 TGAGGCTGGCATTTTGAGGATGG + Intergenic
928784863 2:34871515-34871537 TGGGGGAGGGACTTTGTAGGAGG - Intergenic
929371267 2:41226375-41226397 TGGGGAGGGAACTTAGAGGATGG + Intergenic
930123219 2:47776646-47776668 TGGTGGAGGCTCTGGGAGGATGG - Intronic
930307332 2:49691984-49692006 AGGGGAGGGAACTTTGAGGATGG - Intergenic
931825994 2:66001760-66001782 TGGGTGGGGCAATGTGAGGAGGG - Intergenic
932132608 2:69201385-69201407 AGTGGGAGGCACTGAGAGGAGGG + Intronic
932375134 2:71228393-71228415 TGGGGGAGGGACTTGGTGGGAGG + Intergenic
932545219 2:72701682-72701704 TGGGGCAGGTATTTGGAGGAGGG - Intronic
933051671 2:77609860-77609882 TGGAGGAGGCACTGTGATTAGGG + Intergenic
933420444 2:82038719-82038741 TGGGGGAGGGACCTAGTGGAAGG - Intergenic
933445855 2:82378548-82378570 TGGGGGAGGGACCTTGTGGGAGG + Intergenic
933476234 2:82794391-82794413 TGTGTGAGGCATTATGAGGAGGG - Intergenic
934646712 2:96063257-96063279 TGTGGGAGGGACTTGGAGGGTGG + Intergenic
934840115 2:97619339-97619361 TGTGGGAGGGACTTGGAGGGTGG + Intergenic
935868707 2:107421021-107421043 TGGGGGAGGGACCTTGTGGGAGG - Intergenic
935950797 2:108326518-108326540 TGGGGGAGCCACGATGAGAATGG + Intergenic
936472240 2:112809579-112809601 TGGGGGAGGGGCTTTGTGGGAGG + Intergenic
936689741 2:114872382-114872404 TGGGGGAGGGACCTTGTGGGAGG - Intronic
938493432 2:131777776-131777798 TGGAGGAGACAGTTAGAGGAGGG + Intergenic
939128570 2:138206220-138206242 TGTGGGAGGAACTTGGTGGAAGG - Intergenic
939164155 2:138622153-138622175 TGGGGGAGGGACGTGGTGGAAGG - Intergenic
939719294 2:145627916-145627938 TTGAGAAGGCATTTTGAGGAGGG - Intergenic
941284869 2:163598231-163598253 TGGGGGAGGCAGAGTGAGGAAGG - Intronic
941904010 2:170704058-170704080 TGGGGGAGGGACTTGGTGGGAGG - Intergenic
943960940 2:194263152-194263174 TGGGGGAGGAAATGTGAAGAAGG - Intergenic
945590560 2:211724922-211724944 TGAGGGAATGACTTTGAGGAGGG + Intronic
945670283 2:212794088-212794110 TGGGGGAGAAACTTTAAGCAGGG - Intergenic
946515265 2:220404788-220404810 TGGGAGAGGGACCTTGAGGGAGG - Intergenic
946713192 2:222526876-222526898 GAGGGGAGGAACTTAGAGGATGG + Intronic
946874624 2:224115111-224115133 TGGGGGAGGGACCTTGTGGGAGG + Intergenic
946904633 2:224404813-224404835 AGGTGGAGGCAGTTTGGGGAAGG - Intergenic
946912607 2:224480075-224480097 TGGGGGATGGAATTTGAGAAAGG + Intronic
947140516 2:227015962-227015984 TGGGGGAGGCATTTGGTGAAGGG - Intronic
947823650 2:233089756-233089778 TGAAGGAGGGACTTTGAGGGTGG - Intronic
948139188 2:235660280-235660302 TGAGGGAGGCACTGTGTGGAAGG + Intronic
948606194 2:239137231-239137253 TGCGGGAGGCATTCTGAGGCTGG + Intronic
1169216428 20:3796992-3797014 TGGTGGAGGCACAATGAGGGAGG - Intronic
1169887945 20:10422477-10422499 TGGGGGAGGAATTTAGAGTAAGG + Intronic
1170728990 20:18955828-18955850 TTGGGGAGCCAATGTGAGGATGG + Intergenic
1170806586 20:19638047-19638069 GGGGGAAGGAACTTAGAGGATGG - Intronic
1171367318 20:24634108-24634130 TGGAGGAGGGGCTTTGAGAAAGG - Intronic
1171392667 20:24811553-24811575 TGGGGCAGGCAGTGTCAGGAGGG - Intergenic
1171392677 20:24811583-24811605 TGGGGTAGGCAGTGTCAGGAGGG - Intergenic
1171392738 20:24811820-24811842 TGGGGTAGGCATTGTCAGGAGGG - Intergenic
1172277370 20:33686862-33686884 TGGGTGAGGCAAGTTGAGGATGG - Intergenic
1172832679 20:37849351-37849373 TGGGCGAGGCACCATGAGGCCGG - Intronic
1172949858 20:38715943-38715965 TGGGGGAGCCAAACTGAGGACGG + Intergenic
1173356393 20:42295773-42295795 TGGGGGAGGGACCTTGTGGGAGG + Intronic
1173813042 20:45968035-45968057 TGGGTGAGGCAATTGGAGGGTGG + Intronic
1174735893 20:52965431-52965453 TGGAGGAGGAACTTTGTAGAAGG + Intergenic
1174743402 20:53038578-53038600 TTGGGGAGGCACCTAAAGGAGGG - Intronic
1175604223 20:60299155-60299177 TGGTGGAGCTGCTTTGAGGATGG + Intergenic
1175893791 20:62327191-62327213 TGGGGGAGGCACTTTGAGGATGG - Intronic
1176136185 20:63522987-63523009 TGGGGGAGGGACTCTGGGGAGGG + Intergenic
1176984236 21:15418067-15418089 GGGTGGAGGCTCTTTCAGGATGG + Intergenic
1177862452 21:26470417-26470439 TGGGGGAGGGACTTGGTGGGAGG + Intronic
1177957848 21:27623095-27623117 AGTGTGAGGCTCTTTGAGGAAGG - Intergenic
1178692787 21:34763659-34763681 TCATGCAGGCACTTTGAGGAGGG + Intergenic
1179449440 21:41458476-41458498 TGGAGGGGACACTGTGAGGAGGG - Intronic
1180081522 21:45489836-45489858 TGGGGGAGGCAGTGTGGGGGAGG - Intronic
1180611016 22:17097981-17098003 TGGGAGAGCCACTTGGAGGCAGG - Intronic
1181018160 22:20083187-20083209 AAGGGGAGGCAGTTTTAGGAAGG - Intronic
1181151343 22:20885598-20885620 GGGAGAAGGGACTTTGAGGAAGG + Intronic
1181911838 22:26244625-26244647 TGGAGGAGGCATCTTGAGGAGGG + Intronic
1184903577 22:47463701-47463723 TGGGGGAGGGACTTGGTGGGAGG + Intronic
1185095409 22:48803618-48803640 GGTGGGAGGCTGTTTGAGGAGGG + Intronic
1185131320 22:49040751-49040773 TGGGGGAGGTCCTTTGAGTGGGG + Intergenic
1185396915 22:50597102-50597124 TGGAGGAGGAACTTCAAGGAGGG + Intronic
949235251 3:1801462-1801484 TGGGGGAGGGAAGTGGAGGAAGG - Intergenic
951674025 3:25216600-25216622 AGGGGAAGGAACTTAGAGGATGG + Intronic
952882207 3:37991844-37991866 TGGAGGTGGCACTGTGGGGAGGG + Intronic
954001270 3:47559027-47559049 TGGGTAAGGCAGATTGAGGATGG - Intergenic
954467653 3:50665897-50665919 TGGGGTATGAACTGTGAGGAGGG - Intergenic
954601854 3:51876404-51876426 AGGAGGAGGTGCTTTGAGGATGG + Intergenic
954619635 3:51988257-51988279 TGGGGGAGCCATCTTGAGGAAGG + Intronic
956960412 3:74392763-74392785 TGGGAGAAGTACTTTGAGCAGGG + Intronic
957790000 3:84928572-84928594 TGGGGGAGGGACTTGGTGGGAGG - Intergenic
958927898 3:100179141-100179163 TGGGGGAGGGACCTGGTGGAAGG - Intergenic
959365423 3:105452197-105452219 GAGGGGAGGAACTTAGAGGATGG - Intronic
959515478 3:107261738-107261760 TGGGGGAGGGACCTTGTGGGAGG - Intergenic
960898672 3:122532386-122532408 TGGGAGAGGCATTGTGGGGAGGG - Intronic
961405482 3:126676804-126676826 AAGGGGATGCACCTTGAGGAAGG + Intergenic
961771860 3:129255900-129255922 TTGGGGAGGGACATTGAGGGTGG + Intronic
963133029 3:141876187-141876209 TCGGGGAGGCAGTTCGGGGAGGG + Intronic
964878230 3:161394342-161394364 TGGGGGAGGGACCTTGTGGGAGG - Intergenic
966181849 3:177196382-177196404 TGGTGGAGGCTCTTTGAAGTTGG - Exonic
967438868 3:189483167-189483189 TGGGGGGTGCTCTTTGAGGCTGG - Intergenic
968807767 4:2786721-2786743 AGAGGGTGGCACTTTGGGGAGGG + Intergenic
969066361 4:4484886-4484908 TGGGCCAGGCACATTAAGGACGG + Intronic
969705067 4:8787236-8787258 TGGGGGCAGCACTTTGGGGCTGG - Intergenic
970875938 4:20870194-20870216 TGGGGGAGGCACCTGGTGGGAGG + Intronic
971048097 4:22828848-22828870 TGGGGGAGGGACCTTGTGGGAGG + Intergenic
971224222 4:24736377-24736399 TGGGGGAGGGACCTTGTGGGAGG + Intergenic
972225490 4:37006355-37006377 TGTGGGAGGGACTTGGAGGGAGG + Intergenic
972559482 4:40214172-40214194 TACGGGTGGCACTTTGGGGAAGG + Intronic
973316618 4:48767366-48767388 TGGGGGAGGGACTTGGTGGGAGG - Intronic
974024761 4:56723681-56723703 TGGGGGAGGGACCTGGTGGAAGG - Intergenic
974195603 4:58570472-58570494 TGGGGGAGGGACCTTGTGGGTGG + Intergenic
974399116 4:61378333-61378355 TGGGGGTGGAACTTTGAGAACGG - Intronic
974790376 4:66680822-66680844 TGGGGGAGGGACCTGGTGGAAGG - Intergenic
974931678 4:68367046-68367068 AGGGGAAGGAACTTAGAGGATGG + Intergenic
979035963 4:115717995-115718017 TGGTGCAGCCACTTTGAAGACGG - Intergenic
979043387 4:115830490-115830512 AGGGGAAGGAACTTAGAGGACGG - Intergenic
979372686 4:119908117-119908139 TGGGGAAGGCAGTGTGAGGTGGG + Intergenic
981935305 4:150233309-150233331 TGGGGGAGGCACCTTATGGGAGG - Intronic
982566090 4:156988739-156988761 TGGGGGAGGGACTTCGTGGGAGG + Intergenic
983396534 4:167204568-167204590 TGGGTGAGGGACCTTGTGGAAGG - Intronic
983747833 4:171223665-171223687 AGGGGAGGGCACTTAGAGGACGG + Intergenic
985147375 4:186907028-186907050 TGTGGGATGAAGTTTGAGGAGGG - Intergenic
985856130 5:2428959-2428981 AGGGGAAGCCACTTTGAAGAGGG + Intergenic
985912974 5:2897485-2897507 TGCTGGAGGCACTGGGAGGAGGG - Intergenic
987471708 5:18338997-18339019 TGGGAGGGTCACTTCGAGGAAGG - Intergenic
988352826 5:30133903-30133925 TGGGGGAGGGACCTGGAGGGAGG - Intergenic
989471768 5:41827854-41827876 TGTTGGAGAGACTTTGAGGATGG - Intronic
989497372 5:42124843-42124865 TGGGGGAGGGACTTTGTGGGAGG - Intergenic
990819190 5:59818021-59818043 TTAGGGAGACACTCTGAGGAGGG + Intronic
991117994 5:62976382-62976404 TGGGGGAGGGACCTGGTGGATGG + Intergenic
991461172 5:66860907-66860929 TGGCGGAAGCACTTTCATGATGG + Intronic
992182669 5:74213355-74213377 TGGGGCAGGTAGATTGAGGAAGG + Intergenic
992529794 5:77643198-77643220 TCGGGGAGTCATTTTGAGGGTGG + Intergenic
993984601 5:94583041-94583063 TGGGGGAGGCGCTTCCAAGATGG + Intronic
995227542 5:109718641-109718663 TGGTGGAGGGGCTTTGAGAAAGG - Intronic
995400309 5:111733570-111733592 TGGAGGAGGCATTTTGAAGATGG + Intronic
996966248 5:129309488-129309510 AGGGGGATGGATTTTGAGGAGGG + Intergenic
998166037 5:139844624-139844646 TGGGGGTTGCCCCTTGAGGACGG + Intergenic
998376931 5:141697310-141697332 TGGTGGGGACACTTTGGGGAGGG - Intergenic
998560442 5:143166379-143166401 AGGTGGAGCCACTTGGAGGAAGG + Intronic
998873330 5:146574980-146575002 TGGGGGAGGGACTTGGTGGGAGG - Intergenic
999394922 5:151221260-151221282 TGAGGCAGGCACTTTTAGAAAGG - Intronic
999692132 5:154157526-154157548 AGGGGAAGGCGCTTAGAGGAGGG - Intronic
1000711784 5:164588837-164588859 TGGGGGAAGGACTTTGTGGGAGG - Intergenic
1001725085 5:173889829-173889851 TGGGGGTGGCATTTTGGTGATGG - Exonic
1002275123 5:178099424-178099446 TGGAGGAGGCTCTGTGGGGAAGG - Intergenic
1002819054 6:706832-706854 AGTGGGAGGCCCTTTGAGCAGGG - Intergenic
1004094782 6:12542311-12542333 AGGGGAAGGAACTTAGAGGATGG - Intergenic
1004204116 6:13575117-13575139 GGGGGGAGGCGGCTTGAGGACGG + Intronic
1004630263 6:17414382-17414404 GAGGGGAGGAACTTGGAGGACGG - Intronic
1005594557 6:27367195-27367217 TCGAGGAGGCATTTTGAGGTTGG + Intergenic
1005883854 6:30080038-30080060 TGGGGGAGGCAGTTTTAGGAGGG + Intergenic
1006055179 6:31378796-31378818 TGGGGGAGACATACTGAGGAGGG - Intergenic
1006117466 6:31782727-31782749 AGGCGGAGGCACATTGATGAGGG + Exonic
1006458045 6:34143282-34143304 TGGGCGGGGGGCTTTGAGGATGG - Intronic
1008209882 6:48708016-48708038 TGGGGGAAGCACGTGGAAGAGGG + Intergenic
1008692992 6:54001956-54001978 TGGGAGAGGGAGTTGGAGGATGG - Intronic
1009004136 6:57761008-57761030 TGCAGGAGGGAGTTTGAGGAAGG - Intergenic
1009051812 6:58284193-58284215 TGGGGGAGGGACCTTGTGGGAGG + Intergenic
1010336727 6:74693653-74693675 TGGGGAAGACATTTTGAGGGGGG - Intergenic
1012591211 6:100983643-100983665 TGGGGGAGGGACCTTCTGGAAGG - Intergenic
1012944161 6:105448314-105448336 CTGGGGAGGCTCTCTGAGGAGGG - Intergenic
1012986851 6:105884785-105884807 TGTGGCAGGCACTTTGAGGAGGG - Intergenic
1013330043 6:109091469-109091491 TGGGGCAGACAGTTTGAGGGTGG - Intronic
1013598862 6:111685469-111685491 TGGGGGAGCCACCCTGGGGATGG + Intronic
1014530709 6:122556063-122556085 TGGGGAAGGCACCTTGTGGGAGG + Intronic
1016108038 6:140187402-140187424 TGTGGGAGGCACTTGGTGGGAGG + Intergenic
1016486812 6:144549639-144549661 TGGGGGAGCCAGGATGAGGAAGG + Intronic
1017992235 6:159501076-159501098 TGGGGGAGGCAGTGTGAAGTGGG - Intergenic
1018434603 6:163749148-163749170 TGTGGGAGCCACTTTGGGCACGG - Intergenic
1018514422 6:164562817-164562839 TGGGGGAGGGACCTTGTGGGAGG + Intergenic
1018557016 6:165060521-165060543 ATGGGGAGGCACTTTGTGCAGGG + Intergenic
1019351715 7:557088-557110 TCGGGGAGGAACTGGGAGGAGGG + Intronic
1019395591 7:816360-816382 TGGGGGCTGCACCTGGAGGAGGG - Intergenic
1019755208 7:2763736-2763758 TGGGGGAGGCATTTTGTGCAGGG - Intronic
1019945944 7:4329344-4329366 TGAGGGTGGCACTTTGATGAAGG + Intergenic
1021535033 7:21694072-21694094 TGGGGGAGGGACCTGGTGGAAGG - Intronic
1021717188 7:23470744-23470766 TGGGAGAGGGACTCTGAGAAGGG + Intergenic
1022903982 7:34838118-34838140 GGGGGGAGGCATGCTGAGGAAGG - Intronic
1024261053 7:47573942-47573964 TGGGGAAGGCATTATGGGGAGGG + Intronic
1025708871 7:63890212-63890234 TCAGGGAGGCCCTGTGAGGATGG + Intergenic
1025708883 7:63890273-63890295 TCAGGGAGGCCCTGTGAGGATGG + Intergenic
1026145048 7:67739470-67739492 TGGGGGAGGCACATGGAGACTGG + Intergenic
1026255768 7:68709852-68709874 TGGGGCGGGTCCTTTGAGGAAGG - Intergenic
1026816760 7:73519425-73519447 AAGTGGAAGCACTTTGAGGATGG - Intronic
1028610062 7:92700722-92700744 TAGGGCAGGACCTTTGAGGAAGG + Intronic
1028962868 7:96769260-96769282 TGGGGGAGGGACCTGGTGGAAGG + Intergenic
1029661483 7:101965256-101965278 TGGGCGAGGCACTGTGCGGCGGG + Intronic
1030169122 7:106584093-106584115 TGGGGGAGGCACCTGGTGGGAGG - Intergenic
1030741058 7:113110421-113110443 TGGGGGAGGGACTTGGTGGGAGG + Intergenic
1031168871 7:118265677-118265699 TGGGGGAGGCTCTCTTAAGAGGG + Intergenic
1031194052 7:118590154-118590176 TGGGGGAGGGACCTTGTGGGAGG + Intergenic
1031235765 7:119174377-119174399 TTGGGGAGGGAATTTGAGGCAGG - Intergenic
1032125689 7:129190675-129190697 TGGAGGAGGAACTTGGAGGATGG + Intronic
1034058894 7:148067820-148067842 TGCTGCAGCCACTTTGAGGATGG + Intronic
1035245944 7:157562022-157562044 TGGGGGATGCACCCTGGGGAGGG + Intronic
1035546059 8:483255-483277 GGTGGGAGGCCCTGTGAGGAGGG - Intergenic
1035768379 8:2126915-2126937 TGGGGGAGGCAGATAGAGGCTGG + Intronic
1035951540 8:4027397-4027419 TTGGGGAGGCACATTGTGGGAGG + Intronic
1037093546 8:14953396-14953418 TGGGGGAGGGACCTAGTGGACGG - Intronic
1038089083 8:24233708-24233730 TGGGGGAGGGACCTGGAGGGAGG + Intergenic
1039137516 8:34342247-34342269 TGTGGGAGGCACCTTGTGGGAGG + Intergenic
1039475884 8:37839195-37839217 TGGGGGAGGGACTCCGAGGCAGG + Intronic
1041094272 8:54333440-54333462 TGGAGGAAGAACTTTGAGGCTGG + Intergenic
1042278588 8:67030396-67030418 TGGGGGAGGGAGTTTAAAGAGGG + Intronic
1042608567 8:70572717-70572739 TGCAGGAGGCATTTTGTGGAGGG + Intergenic
1042723722 8:71850119-71850141 TGGGGGTTGCACTTTGAGCAAGG - Intronic
1042851218 8:73217862-73217884 TGGGGGAGGGACTTGGTGGGAGG + Intergenic
1044000902 8:86879903-86879925 TGGGGGAGGAACTTAGAGGGTGG + Intronic
1044492413 8:92835166-92835188 TGTGGGAGGCACCTGGTGGAAGG + Intergenic
1045066083 8:98446126-98446148 GGAGAAAGGCACTTTGAGGAGGG - Intronic
1045829758 8:106444700-106444722 AGGGGCAGGAACTTAGAGGACGG + Intronic
1046391385 8:113577226-113577248 TGGAGGAGGGGCTTTGTGGAAGG + Intergenic
1046702098 8:117412997-117413019 TGAGAGAGGGACTTGGAGGAAGG - Intergenic
1046728118 8:117696086-117696108 TGGGGTAGCCAGTTTGAGAAGGG - Intergenic
1049004458 8:139845938-139845960 TGGAGGAGACACTCTGAAGAGGG + Intronic
1049440176 8:142606023-142606045 TGGGGGTGGCTCTATGGGGAGGG + Intergenic
1049761868 8:144335444-144335466 AGGGGGAGGCTCTTTGTGTAAGG - Intronic
1050029035 9:1365754-1365776 TGGTGGAGGCTATTTGAGTAAGG + Intergenic
1051001522 9:12288296-12288318 TTGGGGAGGGACTTGGTGGAAGG + Intergenic
1055155248 9:73054991-73055013 TTGGTGAAGCACTGTGAGGAGGG + Intronic
1055731970 9:79287642-79287664 TACAAGAGGCACTTTGAGGAAGG - Intergenic
1056771872 9:89483383-89483405 TGGGGTAGGCACTGTGCTGAAGG + Intronic
1057132133 9:92661520-92661542 TGGTGGAGGAAATGTGAGGAAGG - Intronic
1057724205 9:97556753-97556775 TGAGGGAGGCACTTGGGGTAGGG + Intronic
1058371848 9:104278138-104278160 TGGGGGAGGGACCTTGTGGGAGG - Intergenic
1058721935 9:107772400-107772422 TGGGGGAGGGACCTGGTGGAAGG - Intergenic
1059236497 9:112764689-112764711 TGGGGGAGGCAGTTTCAGTAGGG + Intronic
1059375730 9:113879671-113879693 TGGGGGTGGTAATTTGATGATGG + Intronic
1060234566 9:121853399-121853421 TGGGGGAGGCTCTGTGAGGGAGG + Intronic
1060819069 9:126651271-126651293 TGGGGGAGGCACCTGGAAGGAGG + Intronic
1061387910 9:130301262-130301284 TTGAGGAGGAACTTTCAGGAAGG + Intronic
1061412554 9:130429399-130429421 TGGGGGAGGTGCTGTGAGGGCGG + Intronic
1061889207 9:133608893-133608915 TCGGGGATGCGCTTTGAGGGTGG + Intergenic
1061938553 9:133871961-133871983 TGGGGCAGACACTCAGAGGAAGG - Intronic
1062037620 9:134389734-134389756 TGCGGGAGGCACTCTGTGGATGG + Intronic
1062180322 9:135187864-135187886 TGGAGGAGGGATTTTCAGGAGGG - Intergenic
1062653997 9:137592716-137592738 TCGGGGAGGGACTCTGAGGATGG - Intergenic
1062738155 9:138150133-138150155 TGGGGGGTCCACTGTGAGGACGG + Intergenic
1186010312 X:5124464-5124486 TAGAGGGGGCACTTCGAGGAAGG - Intergenic
1187480481 X:19650514-19650536 TGGGGGAGGGACCTTGTGGGAGG - Intronic
1187927131 X:24260720-24260742 TGGGGCAGCCACTTGGAGGTGGG + Intergenic
1188461650 X:30434059-30434081 TGGGGGATGTACTATGATGATGG - Intergenic
1189734537 X:44056239-44056261 TGGCGGAGGCAGCTTGAGGACGG - Intergenic
1190169921 X:48104101-48104123 TAGGAGAGGCACTGTCAGGAAGG + Intergenic
1190175333 X:48144275-48144297 TAGGAGAGGCACTGTCAGGAAGG - Intergenic
1190187846 X:48251440-48251462 TAGGAGAGGCACTGTCAGGAAGG + Intronic
1190253849 X:48747842-48747864 TGTGGGAGGCCCTTGGAGGCAGG - Intergenic
1190656728 X:52619207-52619229 TAGGAGAGGCACTGTCAGGAAGG + Intergenic
1191074914 X:56442388-56442410 AGGGGGAGGAACTTAGAGAATGG + Intergenic
1191089718 X:56607503-56607525 TGGGGGAGGAACTTGGTGGGAGG - Intergenic
1194237231 X:91399436-91399458 TGGAGGTGGCACTTTCAAGAGGG - Intergenic
1194423069 X:93700865-93700887 TGGGGGTGGCAGTTTGCAGAAGG + Intronic
1195132866 X:101871840-101871862 GAGGGGAGGGACTTAGAGGATGG - Intergenic
1195619715 X:106940927-106940949 TGGGGGAGGAAGTTCAAGGAAGG - Exonic
1196460554 X:115924826-115924848 TGGGGGAGGGACCTTGTGGGAGG + Intergenic
1196717460 X:118824746-118824768 CGTGGGGGGCACTTTGAGAAGGG + Intronic
1196740086 X:119017131-119017153 TGAGGGAGACATTTTAAGGATGG - Intronic
1197821319 X:130543734-130543756 TGGGGCAGGCAGTTTGGGGAAGG + Intergenic
1198271511 X:135060134-135060156 TGGGGGAGGGACCTTGTGGGAGG + Intergenic
1198380942 X:136082839-136082861 TGGGGAAGGCACTTTGAGGGGGG - Intergenic
1198466689 X:136909979-136910001 AAGGGGAGGAACTGTGAGGAAGG - Intergenic
1198818937 X:140624694-140624716 TGGGGGAGGGACCTTGTGGGAGG - Intergenic
1199313509 X:146349182-146349204 TGAGGCAGGCACTTTAATGATGG - Intergenic
1201669450 Y:16501026-16501048 TAGAGGGGGCACTATGAGGAAGG + Intergenic
1202085929 Y:21136785-21136807 AGGGGAGGGAACTTTGAGGATGG - Intergenic