ID: 1175894301

View in Genome Browser
Species Human (GRCh38)
Location 20:62329294-62329316
Sequence TCTGGGGGCCTCCCCGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 259}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175894301_1175894312 4 Left 1175894301 20:62329294-62329316 CCTGCAGCGGGGAGGCCCCCAGA 0: 1
1: 1
2: 0
3: 23
4: 259
Right 1175894312 20:62329321-62329343 GGCTGGGACCAGGGTCCTGCAGG 0: 1
1: 0
2: 5
3: 53
4: 438
1175894301_1175894309 -6 Left 1175894301 20:62329294-62329316 CCTGCAGCGGGGAGGCCCCCAGA 0: 1
1: 1
2: 0
3: 23
4: 259
Right 1175894309 20:62329311-62329333 CCCAGAGGCTGGCTGGGACCAGG 0: 1
1: 0
2: 8
3: 74
4: 550
1175894301_1175894311 -5 Left 1175894301 20:62329294-62329316 CCTGCAGCGGGGAGGCCCCCAGA 0: 1
1: 1
2: 0
3: 23
4: 259
Right 1175894311 20:62329312-62329334 CCAGAGGCTGGCTGGGACCAGGG 0: 1
1: 1
2: 4
3: 55
4: 548
1175894301_1175894315 20 Left 1175894301 20:62329294-62329316 CCTGCAGCGGGGAGGCCCCCAGA 0: 1
1: 1
2: 0
3: 23
4: 259
Right 1175894315 20:62329337-62329359 CTGCAGGCAGCTCAGAGTCCTGG 0: 1
1: 0
2: 6
3: 42
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175894301 Original CRISPR TCTGGGGGCCTCCCCGCTGC AGG (reversed) Intronic
900148110 1:1167080-1167102 TCCGGGGGCCGCCCGGCTGAGGG - Intergenic
900524044 1:3119883-3119905 CCTGGGGGCTGCCCCTCTGCAGG - Intronic
900559206 1:3295366-3295388 TCTGGGCTCCTCACCGCGGCTGG + Intronic
900592184 1:3465073-3465095 GCTGGGGCCCTTCCAGCTGCTGG - Intronic
900636711 1:3669538-3669560 TCCGGGGGCTTCCCGGCTGGGGG + Intronic
902624195 1:17667221-17667243 TCTGGGGGTCTCCAATCTGCTGG + Intronic
902744092 1:18461657-18461679 TCCAGTGGCCTCCCAGCTGCTGG + Intergenic
903180415 1:21602366-21602388 TCCGGGGGCAGCCCTGCTGCTGG + Intronic
903588703 1:24438040-24438062 TCTGGGGGCCTCCCAGCAGTGGG + Intronic
903675695 1:25063144-25063166 TGTGGGGGCCTGGCTGCTGCAGG - Intergenic
903680439 1:25092907-25092929 TCTGGAAGCCTCCCTGCTACAGG - Intergenic
904050492 1:27635283-27635305 TGGGGGCGCCTCCTCGCTGCGGG - Intergenic
906531571 1:46526752-46526774 CCTGGGTGCCCTCCCGCTGCAGG - Intergenic
907312075 1:53544494-53544516 TTTAGGGGTCTCCCTGCTGCAGG - Intronic
915073795 1:153293058-153293080 TCTGGCGGCTTCCCCTCTGCTGG - Intergenic
916818482 1:168375555-168375577 CCTGGGGCCCTCCCTGCTGCTGG + Intergenic
917077314 1:171218756-171218778 TCTGGGGACCTCCTCCCAGCTGG + Intergenic
919777618 1:201204550-201204572 TCTGGGCACCTCCCCCGTGCTGG - Intronic
920417167 1:205806585-205806607 TATGGGAGCCTCCTCACTGCAGG - Intronic
920443065 1:205994334-205994356 CCTGGGGGCCTCCCCAAAGCTGG + Exonic
921350520 1:214229981-214230003 TCTGGGAGCTTGCCCTCTGCCGG - Intergenic
924443030 1:244102662-244102684 TGTTTCGGCCTCCCCGCTGCAGG - Intergenic
1062905755 10:1178526-1178548 TCTGGGTTCCTCGCCACTGCAGG - Exonic
1066450371 10:35522874-35522896 ACTGGGGGCCTCACCGGTGAAGG - Intronic
1067142277 10:43667700-43667722 TCCGGGGCCCTCCCCACTGCGGG + Intergenic
1067434231 10:46265892-46265914 TCTGGTGGCCTCACTGCTCCAGG - Intergenic
1067439462 10:46300438-46300460 TCTGGTGGCCTCACCGCTCAAGG + Intronic
1067478736 10:46582216-46582238 TCTGGTGCCCTCCGCGTTGCTGG + Intronic
1067616003 10:47759585-47759607 TCTGGTGCCCTCCGCGTTGCTGG - Intergenic
1069913105 10:71771792-71771814 TCTTGGGGCCTCTCTGCTACTGG + Intronic
1070592006 10:77808062-77808084 TCTGGCTACCTCCCCTCTGCAGG + Intronic
1070977251 10:80615005-80615027 TCTGGGGGTTTCCTCCCTGCAGG - Intronic
1075405830 10:122195181-122195203 TCTGGGGGCCTCCCTGCCCTTGG - Intronic
1075801013 10:125153245-125153267 TCTCGGGCCCTGCCCGCTGCTGG + Intronic
1076028432 10:127137127-127137149 TTTGGGGGACTCCTGGCTGCTGG + Exonic
1076821561 10:132942390-132942412 TCCCGGGGCCTCCCCGGGGCGGG + Intronic
1076828835 10:132983984-132984006 TCTGGGGGGCTCCCCGCTGCTGG + Intergenic
1077069276 11:660545-660567 TCCGGGGGCTTCCACGCTGCTGG + Intronic
1077144055 11:1036984-1037006 GCCCGGGCCCTCCCCGCTGCTGG + Intergenic
1077174005 11:1180608-1180630 GCTGGGGACCTCCCCGTTACTGG + Intronic
1077205425 11:1340280-1340302 TCTGCAGGTCTCCCGGCTGCTGG - Intergenic
1077231260 11:1459071-1459093 TCTGGGGCCCTACCCACTCCTGG + Intronic
1077268495 11:1664287-1664309 TCTGGGGGCCTTCCATCTGTGGG - Intergenic
1077272384 11:1687331-1687353 TCTGGGGGCCTTCCATCTGTGGG + Intergenic
1077302411 11:1853478-1853500 TCTTGGGGTCTCCTCGCTTCAGG - Intronic
1077319409 11:1934524-1934546 TCTTTGGGCCTGTCCGCTGCAGG + Exonic
1077487971 11:2847846-2847868 TCTGGGGGGGCCGCCGCTGCCGG - Exonic
1077530718 11:3093586-3093608 TCTGCGGACCTCCCCGCTCGGGG + Exonic
1080855857 11:36111078-36111100 GCTGGGGGCCCCCTCCCTGCAGG + Intronic
1080881137 11:36321868-36321890 TCACGGGGCCTTCCCTCTGCAGG + Intronic
1081541471 11:44037599-44037621 CCTGGGAGCCTCTCTGCTGCGGG - Intergenic
1084370674 11:68740553-68740575 TCTGGCCCCCTCCACGCTGCTGG - Intronic
1084890779 11:72235922-72235944 GCTGGGGGCCTCCCCGTTGGTGG - Exonic
1087117776 11:94543718-94543740 TCTGAAGGCCACGCCGCTGCGGG + Intergenic
1088388022 11:109281462-109281484 TCTAGGGCCCTGCCCACTGCTGG - Intergenic
1091303600 11:134523450-134523472 TCACGGCGCCTCCCCGCGGCCGG - Intergenic
1091303669 11:134523667-134523689 TCACGGCGCCTCCCCGCGGCCGG - Intergenic
1091303690 11:134523729-134523751 TCACGGCGCCTCCCCGCGGCCGG - Intergenic
1091303720 11:134523822-134523844 TCACGGCGCCTCCCCGCGGCCGG - Intergenic
1091303731 11:134523853-134523875 TCACGGCGCCTCCCCGCGGCCGG - Intergenic
1091303751 11:134523915-134523937 TCACGGCGCCTCCCCGCGGCCGG - Intergenic
1091303770 11:134523977-134523999 TCACGGCGCCTCCCCGCGGCCGG - Intergenic
1091303781 11:134524008-134524030 TCACGGCGCCTCCCCGCGGCCGG - Intergenic
1091303812 11:134524101-134524123 TCACGGCGCCTCCCCGCGGCCGG - Intergenic
1091303832 11:134524163-134524185 TCACGGCGCCTCCCCGCGGCCGG - Intergenic
1091303843 11:134524194-134524216 TCACGGCGCCTCCCCGCGGCCGG - Intergenic
1091303854 11:134524225-134524247 TCACGGCGCCTCCCCGCGGCCGG - Intergenic
1091345580 11:134851198-134851220 TGTCTGGGCCTCCCAGCTGCTGG + Intergenic
1091937253 12:4443785-4443807 TCTCGGGGCCTCGCCAGTGCAGG + Intronic
1093994982 12:25631250-25631272 TCTAGGGCCCTGCCCACTGCTGG + Intronic
1094447327 12:30546060-30546082 TCTAGGGCCCTGCCCACTGCTGG - Intergenic
1095625015 12:44304326-44304348 TCTGGTAGCCTCCCAACTGCAGG + Intronic
1095665211 12:44789106-44789128 TCTAGGGTCCTGCCCACTGCTGG + Intronic
1096154906 12:49336441-49336463 GCTGGTGGCCATCCCGCTGCTGG - Exonic
1096801710 12:54114824-54114846 GCTGGGGACCTACCCGGTGCTGG - Intergenic
1097572763 12:61355249-61355271 TCTGGGGGGCTCCCAGGGGCAGG - Intergenic
1097920213 12:65064012-65064034 TCTTGGGGCCTCCTCTTTGCTGG + Intronic
1101635242 12:106535338-106535360 TCTAGGGCCCTACCCTCTGCTGG - Intronic
1102773037 12:115495079-115495101 TCTGGGGCCCTCCCCGGTCTTGG - Intergenic
1103841377 12:123868001-123868023 TCTGGGAGCCTCCCTGCTTGAGG + Exonic
1103940146 12:124496936-124496958 TCTGGGGGCCACCATGCAGCAGG + Intronic
1104595211 12:130115919-130115941 CCTGGGGCCCTACCAGCTGCAGG + Intergenic
1104934652 12:132358015-132358037 TCTGGGCGGCTCCCCCCTGGTGG - Intergenic
1105396801 13:20043885-20043907 TGTGGGGGCCACCCCACTGGGGG + Intronic
1105472220 13:20704215-20704237 TCGGCGGGCCTGCCCCCTGCCGG - Exonic
1110894935 13:80737611-80737633 TCTGAGGGCCTGCCTACTGCTGG - Intergenic
1113399285 13:109976375-109976397 TCTGGGCCCCTTCCAGCTGCTGG + Intergenic
1113782277 13:112983506-112983528 TCTGAGGCCCGCCACGCTGCAGG + Intronic
1113884519 13:113651689-113651711 TCTGGGGGCCGAGCCGTTGCTGG + Exonic
1117249615 14:53923309-53923331 GCTGGGGGCCTTCCCAATGCAGG - Intergenic
1117963963 14:61188508-61188530 TCCGGGCGCCTCCCGGCTCCGGG + Intronic
1118322592 14:64762052-64762074 TCTGGACACCTGCCCGCTGCTGG - Intronic
1119225610 14:72942650-72942672 TCTGGAGGGCACTCCGCTGCTGG - Intronic
1119472681 14:74909503-74909525 TTTGGGGGCCACCCCACTGAGGG + Intronic
1119935538 14:78589310-78589332 TCTGGGGGCCTTCTCTCTGCAGG + Intronic
1121308872 14:92924012-92924034 TCTGGGGACCACCCCACTGTGGG + Intronic
1121459890 14:94066445-94066467 TCTAGGGCCCTACCCACTGCTGG + Intronic
1122630059 14:103103623-103103645 GCTGTGGGCCTCCGTGCTGCGGG + Intronic
1122725474 14:103747979-103748001 TCCCTGGGCCTCCACGCTGCCGG + Intronic
1123028923 14:105441405-105441427 CCTGGGAGCCTCCCCGGTGCTGG - Intronic
1123104201 14:105830426-105830448 TCTAGGGCCCTACCCACTGCTGG - Intergenic
1202849808 14_GL000225v1_random:9395-9417 CCCGGAGGCCTCCCCGCAGCAGG + Intergenic
1202868114 14_GL000225v1_random:136042-136064 CCCGGAGGCCTCCCCGCAGCAGG - Intergenic
1125755959 15:42065249-42065271 TGTGGGGGCCTGACAGCTGCTGG + Intergenic
1126577527 15:50211091-50211113 TCTAGGGCCCTGCCCACTGCTGG + Intronic
1127932977 15:63609639-63609661 TGTGGGGGCATCCCTGCAGCTGG - Intronic
1129069242 15:72937287-72937309 TCTGGGTGCCTCCACCCTCCTGG + Intergenic
1130253008 15:82313057-82313079 TCTGGGTGGTTCCCCCCTGCAGG + Intergenic
1132215113 15:100056793-100056815 TTTGAGGGCCTCCTCACTGCTGG + Intronic
1132285406 15:100658765-100658787 CCTGGAGGGCTCCCCGCTGGTGG + Intergenic
1132666528 16:1083513-1083535 TCTGGGGGCCCCATGGCTGCCGG - Intergenic
1132941408 16:2510224-2510246 CCTGGGGTCCTGCCCGGTGCTGG + Intronic
1133226022 16:4340760-4340782 TCAGGGGGCCTCCCTGAGGCTGG + Intronic
1134219042 16:12338925-12338947 TCTGGGGGACTCTAAGCTGCAGG - Intronic
1134250363 16:12569715-12569737 CCTGGGGGCTGCCCAGCTGCTGG - Exonic
1135407230 16:22206969-22206991 TTTGGGGGCCTCCCCCCTCGGGG + Intronic
1138232654 16:55350379-55350401 TCTGGGTGCTTCCCCACTCCTGG - Intergenic
1139546754 16:67653233-67653255 CCTGGGGGCCCCCCGGCGGCGGG - Exonic
1141489206 16:84360611-84360633 GCAGTGGGGCTCCCCGCTGCAGG + Intergenic
1141744271 16:85915136-85915158 ACTGGGGGCCTCCCCGCGGTGGG + Intronic
1142122896 16:88395948-88395970 TCTGGAGTCATCCCCACTGCAGG + Intergenic
1142125665 16:88409082-88409104 TCTGGGGGCCCCTCTGCTGCAGG + Intergenic
1144950138 17:18989483-18989505 TATGGAGCCCTCCCCTCTGCTGG - Intronic
1145272565 17:21412625-21412647 TCAGGGGTCCCCCCTGCTGCCGG + Intronic
1145399103 17:22516972-22516994 TCTGGGGTCTTGCCTGCTGCTGG + Intergenic
1145772938 17:27506583-27506605 TCCAGGGGACTCCCAGCTGCCGG - Intronic
1145819847 17:27823880-27823902 GCTGGGGGCCTCCTGGCTGGAGG + Intronic
1147123953 17:38352724-38352746 TCCGGTGCCCTTCCCGCTGCAGG + Exonic
1147155778 17:38543909-38543931 TCCGGGGGCCTCTCGGCTGAAGG - Exonic
1147925352 17:43942372-43942394 TCTGGGGGCCTCCCCCAGGCTGG - Intronic
1148000246 17:44383595-44383617 CGTGGGGGCCTCGCGGCTGCAGG + Exonic
1148261983 17:46192649-46192671 TCTCCGGGCTTCCCTGCTGCGGG - Exonic
1149614775 17:57988349-57988371 CCTCTGGGCGTCCCCGCTGCCGG + Intergenic
1150337727 17:64342593-64342615 TCTGGGGGGGTCCCTGGTGCTGG + Intronic
1151717974 17:75841032-75841054 TCTGGGGGCATCCACCCTCCAGG - Intronic
1151896116 17:76982025-76982047 GCTGGCTGCCTCCCCGCTCCTGG - Intergenic
1152190631 17:78885400-78885422 TCTGGGATCCTCACCGCTGCTGG + Intronic
1152216226 17:79034204-79034226 CCCGAGGGCGTCCCCGCTGCTGG + Intronic
1152569788 17:81116591-81116613 GGTGGGGGCTTCCCCGCTTCCGG + Exonic
1152588315 17:81198950-81198972 GGTGGTGGCCTCCCTGCTGCAGG - Exonic
1154485710 18:14870338-14870360 GCTGGGGGCCTCCCACATGCAGG + Intergenic
1155984336 18:32214017-32214039 TCTGAGGGCCTCTCCACCGCAGG - Intronic
1160502872 18:79410947-79410969 GCTGGGGGCCTGCACACTGCTGG + Exonic
1160745526 19:709333-709355 CCGGGAGGCCTCCCCGCTCCCGG + Intronic
1160902373 19:1434829-1434851 TCGGGGGGCCCCCCCGCCGGCGG + Exonic
1161741940 19:6026701-6026723 TCCCAGGGTCTCCCCGCTGCTGG + Intronic
1162068481 19:8139849-8139871 TCAGTGGCCCTCCCAGCTGCTGG - Intronic
1164736630 19:30545939-30545961 CCTGCGGGCCTCACCTCTGCAGG + Intronic
1164792881 19:31002958-31002980 TCATGACGCCTCCCCGCTGCAGG + Intergenic
1165096901 19:33414354-33414376 CCTAGAGGCCTCCCCGGTGCAGG - Intronic
1165317392 19:35065261-35065283 CCTGTGTGCCTCCCAGCTGCCGG + Exonic
1166015221 19:39974453-39974475 CATGGGGCCCTCCCAGCTGCAGG - Intronic
1166862910 19:45820004-45820026 TCTGGGGGCCTCACTCCTGGTGG + Intronic
1167019143 19:46861245-46861267 GCCGGGCGCCGCCCCGCTGCGGG + Intergenic
1168153382 19:54460685-54460707 TGGGGGGGCCTCCCCGCTCGTGG + Intronic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
925161128 2:1685197-1685219 TTTGGGGGCCCTCCGGCTGCAGG - Intronic
926061316 2:9806882-9806904 TCTGGGGTCCCCTCTGCTGCAGG - Intergenic
926221088 2:10935805-10935827 ACTGGAGGCCTCCCGCCTGCGGG - Intergenic
927035404 2:19170166-19170188 TCTGGTGGCATCCCAGCTTCTGG - Intergenic
927089630 2:19700662-19700684 TCTGGGGGCTGCCCTTCTGCTGG - Intergenic
932448714 2:71796188-71796210 TCTCAGGCCCTCTCCGCTGCAGG - Intergenic
932954609 2:76337180-76337202 TCTAGAGGCCTGCCCACTGCCGG - Intergenic
933886253 2:86720924-86720946 TCTGGGGGCCTCCGCGCCTCAGG - Intronic
933923927 2:87075782-87075804 TCTGGGGGCCTCCGCGCCTCAGG + Intergenic
934276212 2:91574521-91574543 CCCGGAGCCCTCCCCGCTGCTGG - Intergenic
934709261 2:96504273-96504295 TCTGAGGGCTTCCCCGAGGCGGG - Intronic
935602637 2:104938650-104938672 TCAGAGGGCCAGCCCGCTGCAGG + Intergenic
948066619 2:235085939-235085961 CCTGGTGGCCTCCCTACTGCAGG - Intergenic
948439650 2:237978540-237978562 TCTGGAGGCCTCCCCATGGCCGG - Intronic
948908880 2:240993087-240993109 GCTGGGCGCCTCCCCTGTGCTGG - Intronic
1168829266 20:835715-835737 TCTGGAGGCCTCCCAGACGCTGG - Intronic
1171223213 20:23420503-23420525 CCTGGGGGCGTCCCGCCTGCAGG - Intronic
1172130668 20:32652734-32652756 TTTGGGGGGCTTCCTGCTGCTGG + Intergenic
1174180029 20:48668825-48668847 CCTGCTGGCCTCCCCACTGCCGG - Intronic
1175133546 20:56806957-56806979 TCTGTGGGCCAACACGCTGCTGG - Intergenic
1175835749 20:61993296-61993318 TCTGGCTGCCTCCCTGCGGCAGG - Intronic
1175894301 20:62329294-62329316 TCTGGGGGCCTCCCCGCTGCAGG - Intronic
1176018125 20:62948054-62948076 TCTGTGTGCTTCCCCGCTGATGG + Exonic
1176795618 21:13369131-13369153 GCTGGGGGCCTCCCATATGCAGG - Intergenic
1180023889 21:45147671-45147693 TCTGGGGCCAGCCCGGCTGCAGG - Intronic
1180067343 21:45418979-45419001 TCTGGGGGCATCAGGGCTGCAGG + Intronic
1180200551 21:46221255-46221277 TCTGGGGGCAGCCTGGCTGCAGG - Intronic
1181167503 22:20991555-20991577 CCTCGGGGCCTCCCCACAGCAGG - Intronic
1181509191 22:23381452-23381474 TCTGGGGGCCACCCCCAGGCAGG - Intergenic
1181783099 22:25207202-25207224 TCTGGGTGCCTTTCAGCTGCTGG - Exonic
1182831235 22:33306220-33306242 TGTGGGGGCCTGCCCTCTCCTGG + Intronic
1183381176 22:37491300-37491322 TCTGGGGGCTGCCCTGCTCCTGG - Exonic
1183441551 22:37825665-37825687 TCTGGGGGCTGCCCTGCTGGGGG - Intergenic
1183489091 22:38107331-38107353 TCTGCTGGTGTCCCCGCTGCGGG - Intronic
1183858466 22:40652456-40652478 CCTGGGGCGCTCCCCGGTGCTGG - Intergenic
1184021796 22:41826192-41826214 TCAGGGTGCCACCCTGCTGCTGG + Exonic
1184471910 22:44701191-44701213 TATGGGGCCCTCCCAGCTCCTGG + Intronic
1184732631 22:46379077-46379099 TCTCGCGTCCGCCCCGCTGCTGG + Intronic
1184867334 22:47209048-47209070 TCTGTGGGCTTCCCCAGTGCAGG + Intergenic
1185171666 22:49297984-49298006 TCTGGGGGGCTCCCCACGGTGGG + Intergenic
1185287975 22:50010879-50010901 TCTCGGGGCTTCCCAGCGGCCGG + Intronic
950126828 3:10514769-10514791 ACTGGGGCTTTCCCCGCTGCTGG - Intronic
950496442 3:13336956-13336978 TCTGGGGGCATTCCCAGTGCTGG - Intronic
950829249 3:15859028-15859050 ACAGGTGGCTTCCCCGCTGCCGG - Intronic
950968983 3:17167688-17167710 TGGGGGGCCCTCCCCGCGGCAGG + Intronic
953009732 3:39013525-39013547 TCCTGGGGCTTCCCCGCTGTGGG - Intergenic
961404175 3:126667157-126667179 TCTGGGGGCATTCCCAGTGCTGG + Intergenic
966921301 3:184613325-184613347 TCTGGGGTCCTGCCCGCTGTGGG + Intronic
967272601 3:187743693-187743715 GCTAGGGGCCACCCCGCTGCCGG - Intronic
968008704 3:195259700-195259722 TCCGGGGGCCGCCCTGGTGCTGG - Intronic
968225555 3:196969917-196969939 CCCGGTGGCCTCGCCGCTGCGGG + Intergenic
968628226 4:1637584-1637606 CCTGGGGCCTTCCCCACTGCAGG - Intronic
968923063 4:3532527-3532549 GCCGGCGGCCTCGCCGCTGCCGG - Exonic
969662937 4:8540906-8540928 TCCCAGGGCCTCCCCACTGCGGG + Intergenic
972331012 4:38064565-38064587 TCTGGCTGCCTCCCAGCTGCAGG - Intronic
973293346 4:48490768-48490790 TCTGGGGGCTGCCCTGCTCCAGG - Exonic
973293459 4:48491144-48491166 TCTCGGGCCCTCCCCGCCGACGG - Exonic
973346241 4:49059736-49059758 TCTGGGGGCCAGCCTGGTGCTGG + Intronic
974337802 4:60573575-60573597 TCTGGTGGCCTCCTTGCTTCAGG + Intergenic
976366991 4:84243863-84243885 ACTCGGGGCCCCACCGCTGCGGG - Intergenic
979542920 4:121906732-121906754 TCTGGGTGTCTCCATGCTGCAGG + Intronic
980075238 4:128287574-128287596 GCTGGGGGCCTACCGGCTGTGGG - Exonic
980421449 4:132566064-132566086 TCTGAGAGCCTACCCCCTGCAGG - Intergenic
982288756 4:153759802-153759824 GCTGGAGGCCCCCCCGCAGCAGG - Exonic
984527527 4:180875317-180875339 TCTGGGGCCCTGCCCACTTCCGG - Intergenic
984707981 4:182861713-182861735 TCTGGGGGCCTCCCAGGCCCAGG + Intergenic
985073623 4:186191698-186191720 CCTGGCGCGCTCCCCGCTGCGGG - Exonic
985727058 5:1522159-1522181 TCCGGGGGCGTCCCCGCTGAGGG + Intronic
988503163 5:31799954-31799976 TCTGGGAGCCTCACGGTTGCTGG - Intronic
990039083 5:51357552-51357574 TCTCGGGGGGTCCACGCTGCTGG - Intergenic
995058468 5:107788486-107788508 TCAGGGGGCCTCTCCTTTGCAGG - Intergenic
997319183 5:132963694-132963716 TCTGCGCCCCTCCCCGCTGGGGG + Intergenic
997561004 5:134846158-134846180 TCTAGGGGCTTCCCAGCGGCTGG - Exonic
999621430 5:153478807-153478829 TGTGTGGGCCTCCCTGCTACAGG + Intergenic
1002276137 5:178105345-178105367 GCTGGGGGCCTCCCACATGCAGG - Intergenic
1002278192 5:178116351-178116373 GCTGGGGGCCCCCGCCCTGCTGG + Intronic
1002724497 5:181285841-181285863 GCTGGGGGCCTCCCATATGCAGG + Intergenic
1004312171 6:14555291-14555313 CCTGGGGGCCTCCTCTCTCCAGG + Intergenic
1005421535 6:25656228-25656250 TGTGGAGGCCTCCCTGCTGCTGG - Intronic
1005938644 6:30544424-30544446 TCAGGGGACTTCTCCGCTGCAGG - Exonic
1006119659 6:31796052-31796074 GCTGGGCACCTCCCCGCTACCGG - Intergenic
1009058440 6:58367793-58367815 TCTGGGGGCCTGCCTGGTGCTGG - Intergenic
1009232394 6:61079329-61079351 TCTGGGGGCCTGCCTGGTGCTGG + Intergenic
1011615256 6:89192240-89192262 ACTGGGCGCCTCCACACTGCAGG + Intronic
1014738798 6:125124562-125124584 TCTAGGGCCCTGCCCACTGCTGG + Intronic
1017775336 6:157676139-157676161 CCTGGGGCCCTCCCGGATGCAGG - Exonic
1019266310 7:119316-119338 TCTGGGGGCCTCCTGGCCTCTGG - Intergenic
1019855098 7:3597481-3597503 ACAGGTGGCCTCCCCGCCGCCGG - Intronic
1023089659 7:36605853-36605875 TCTTGTGGCCTCACTGCTGCTGG + Intronic
1024678781 7:51661831-51661853 TCTGGGTGCCTCAACCCTGCTGG - Intergenic
1025738456 7:64175158-64175180 TCTGGGGACCTGCTCCCTGCTGG - Intronic
1026151061 7:67788501-67788523 CCTGGAGGCCTCCCCGCACCTGG + Intergenic
1026157955 7:67843742-67843764 CCTAGGGGCCTCCCTGCTGTGGG + Intergenic
1028251807 7:88546236-88546258 AGTGGGGGTGTCCCCGCTGCTGG + Intergenic
1029460962 7:100693847-100693869 TCCCGGGGCCTCCCCGAGGCTGG + Intergenic
1029472868 7:100765519-100765541 TGTGGGTGCCTCCACCCTGCAGG + Exonic
1029614826 7:101649707-101649729 TCTGCCTGCCTCCCTGCTGCGGG - Intergenic
1029698799 7:102232667-102232689 TCTGAGGGCCATTCCGCTGCTGG - Intronic
1034433097 7:151050689-151050711 TCTAGGGGCCTCTCCCCAGCTGG + Intronic
1035337577 7:158139733-158139755 TCTGGCGGCCTCTGCGCTCCTGG - Intronic
1035560168 8:598318-598340 TCTGGTCACCTCCCCGTTGCCGG - Intergenic
1036463986 8:8979136-8979158 TCTGGAGACGTCCCCACTGCTGG - Intergenic
1037803821 8:22048911-22048933 CCTGGGGGCCCCAGCGCTGCGGG - Intergenic
1038022514 8:23562181-23562203 TGTGGGGGCCTCTCCCCTGAAGG + Intronic
1038692162 8:29773620-29773642 TCTGTGGGCCTCTCCACGGCGGG + Intergenic
1039389500 8:37166172-37166194 TCTGCTGGCCTCCCTGCTTCTGG + Intergenic
1043620968 8:82192203-82192225 TCTGCCTGCCTCCCCGGTGCAGG - Intergenic
1046933948 8:119868720-119868742 TCTGGGGGCCCCCCCGACCCAGG + Intergenic
1049373230 8:142277523-142277545 GGTGGGGGCATCCCAGCTGCAGG - Intronic
1049383019 8:142326653-142326675 TCTGGGGCCCTCCCCTTCGCTGG - Intronic
1049446375 8:142633360-142633382 CCAGGGGACCTCCCCACTGCTGG + Intergenic
1049449690 8:142654069-142654091 CCTGGGAGCCTCCACCCTGCAGG + Intergenic
1049694743 8:143977663-143977685 TCTGCGGGCGCCCCCTCTGCGGG - Exonic
1049729092 8:144166782-144166804 TCTGGGAGCCTGCCCTCTGAGGG - Intronic
1051206286 9:14693026-14693048 TCTCGGTGCCTCCCCGCCCCAGG - Intronic
1053424816 9:38003920-38003942 GCTGGGGGCCTCCTGGCTCCAGG + Intronic
1055454352 9:76459157-76459179 TCTGGGGGCGGCCCCGGGGCGGG + Intronic
1060186564 9:121567411-121567433 TCTGAGGGGCTGCCCGCTCCAGG - Intronic
1060479283 9:124008665-124008687 GCTGCGGGGCTCCCGGCTGCCGG - Intronic
1060490231 9:124078725-124078747 TCTGGGGGCTTCCCCCATGCTGG - Intergenic
1062362049 9:136192945-136192967 TCTCGGGGTCTCCCCGCGCCCGG + Intergenic
1062392654 9:136340128-136340150 ACTGTGGGCCTCCCGGCTCCCGG + Intronic
1062414977 9:136443875-136443897 CCTGGCGACCTCCCTGCTGCAGG - Exonic
1062552912 9:137098291-137098313 GTTGGGGGCCTCCCAGGTGCGGG + Intronic
1189160494 X:38804547-38804569 CCTGGGTGGCTCCCCGCGGCTGG - Intronic
1197772481 X:130098089-130098111 TCAGGGGGGCTCCAGGCTGCGGG - Intronic
1199437439 X:147828610-147828632 TCTGGAGCCCTCTCGGCTGCTGG - Intergenic
1201537913 Y:15071064-15071086 ACTGGGGGCCTCTCAGCTGGTGG - Intergenic