ID: 1175894465

View in Genome Browser
Species Human (GRCh38)
Location 20:62329960-62329982
Sequence CAACCCTCTGGGTGTCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175894465_1175894478 23 Left 1175894465 20:62329960-62329982 CCCCCAAGACACCCAGAGGGTTG 0: 1
1: 0
2: 1
3: 13
4: 126
Right 1175894478 20:62330006-62330028 AAGGAGTGCCCGCTGGCCAACGG 0: 1
1: 0
2: 1
3: 8
4: 102
1175894465_1175894472 -7 Left 1175894465 20:62329960-62329982 CCCCCAAGACACCCAGAGGGTTG 0: 1
1: 0
2: 1
3: 13
4: 126
Right 1175894472 20:62329976-62329998 AGGGTTGAAGATGGCAGCGTTGG 0: 1
1: 0
2: 0
3: 7
4: 157
1175894465_1175894479 30 Left 1175894465 20:62329960-62329982 CCCCCAAGACACCCAGAGGGTTG 0: 1
1: 0
2: 1
3: 13
4: 126
Right 1175894479 20:62330013-62330035 GCCCGCTGGCCAACGGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 70
1175894465_1175894475 4 Left 1175894465 20:62329960-62329982 CCCCCAAGACACCCAGAGGGTTG 0: 1
1: 0
2: 1
3: 13
4: 126
Right 1175894475 20:62329987-62330009 TGGCAGCGTTGGGGCAGCCAAGG 0: 1
1: 0
2: 2
3: 35
4: 256
1175894465_1175894474 -5 Left 1175894465 20:62329960-62329982 CCCCCAAGACACCCAGAGGGTTG 0: 1
1: 0
2: 1
3: 13
4: 126
Right 1175894474 20:62329978-62330000 GGTTGAAGATGGCAGCGTTGGGG 0: 1
1: 0
2: 0
3: 16
4: 165
1175894465_1175894476 16 Left 1175894465 20:62329960-62329982 CCCCCAAGACACCCAGAGGGTTG 0: 1
1: 0
2: 1
3: 13
4: 126
Right 1175894476 20:62329999-62330021 GGCAGCCAAGGAGTGCCCGCTGG 0: 1
1: 0
2: 1
3: 24
4: 138
1175894465_1175894473 -6 Left 1175894465 20:62329960-62329982 CCCCCAAGACACCCAGAGGGTTG 0: 1
1: 0
2: 1
3: 13
4: 126
Right 1175894473 20:62329977-62329999 GGGTTGAAGATGGCAGCGTTGGG 0: 1
1: 0
2: 1
3: 13
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175894465 Original CRISPR CAACCCTCTGGGTGTCTTGG GGG (reversed) Intronic
900242312 1:1623028-1623050 CAACCATGTGAGTGTCTCGGGGG + Intronic
902154542 1:14473843-14473865 GAACCCTCTGGTTATCTGGGAGG + Intergenic
902967058 1:20012927-20012949 CACCCCTCTGGATGCCATGGGGG - Intergenic
903309413 1:22442614-22442636 CAGCCCTCCGGGTGGCATGGGGG - Intergenic
904896618 1:33822742-33822764 CCACCTTCTGGGTGCCTTAGAGG - Intronic
906165638 1:43684157-43684179 CCACCCTGTGAGTGTCTTGAGGG - Intronic
913518487 1:119624236-119624258 AAACTCTCAGGGGGTCTTGGAGG - Intronic
918292465 1:183122161-183122183 CAACCCTGTCCGTGTCCTGGAGG + Exonic
921828957 1:219705598-219705620 CAACCCTCATGGTGACTTTGAGG + Intronic
923284143 1:232475320-232475342 CAACCCTCTGGGTGAAGGGGAGG - Intronic
1063224815 10:4005630-4005652 CAAGCCTGTGAATGTCTTGGGGG + Intergenic
1064065914 10:12181463-12181485 TTACCCTCTGGGTGTCATGCAGG + Intronic
1064419587 10:15179373-15179395 CAATGCCCTGGGGGTCTTGGAGG + Intergenic
1065873469 10:29976364-29976386 CAACCCTATGGTTGTCTTTGGGG - Intergenic
1069002037 10:63277284-63277306 CAAGCTTCTGGGAGTCTCGGTGG - Intronic
1072660758 10:97362150-97362172 AAACCCTCTGGGGGTCTCAGTGG + Intronic
1075469577 10:122678086-122678108 CAGCCCTGTGTGTGTCCTGGTGG + Intergenic
1075698115 10:124450266-124450288 CAACCCTCTGGGACTCTCCGAGG + Intergenic
1080635315 11:34118458-34118480 CCAGCCTGTGGGTGTGTTGGTGG + Exonic
1082003202 11:47405584-47405606 CTTACCTCTTGGTGTCTTGGTGG - Intergenic
1083321788 11:61852151-61852173 CCACCGTCTGGATGACTTGGGGG + Intronic
1084743669 11:71154894-71154916 CATCCCTCTGGGAGTGTGGGCGG - Intronic
1086402857 11:86474558-86474580 CAACCCACTGGCTGGCTTGGGGG + Intronic
1088795776 11:113265758-113265780 CCATCTTCTGGGAGTCTTGGGGG + Intronic
1089750794 11:120649744-120649766 CATCTCTCTGGGTGTTTGGGAGG - Intronic
1096469208 12:51865642-51865664 CAACCCTCTTGGAGTCCTGATGG - Intergenic
1096774773 12:53957175-53957197 CTGCCCACTGGGTGTCCTGGGGG - Exonic
1096870945 12:54591697-54591719 CAACTCTCTGGGTGACTCTGGGG + Intergenic
1103233688 12:119353755-119353777 TCACCCTCTGGGTGTGGTGGTGG - Intronic
1106482180 13:30144974-30144996 CAGCTCTCTGGCTTTCTTGGGGG - Intergenic
1106971512 13:35146705-35146727 CATCCCTCTGGGTGACTCTGAGG + Intronic
1116522749 14:45870087-45870109 CAACACTCATGGTGTGTTGGGGG + Intergenic
1117269677 14:54129785-54129807 CAACACTCTGGATGACTTTGAGG + Intergenic
1119630785 14:76230098-76230120 CAGCTCTCTGGGTTTCCTGGTGG + Intronic
1124906386 15:33872534-33872556 GAACTCTCTGGGTGGCGTGGGGG + Intronic
1125886313 15:43232283-43232305 CTACCATCTTTGTGTCTTGGGGG - Intergenic
1128614165 15:69096467-69096489 CATCCCTGGGGGTGTCTGGGAGG - Intergenic
1132147188 15:99436043-99436065 CAAACCTCTGTGTGTCTTCTAGG - Intergenic
1132179377 15:99740858-99740880 CAACCCTCTGGATGTCTGTGAGG - Intergenic
1132229078 15:100168571-100168593 CAACCCTCCAGGTGTCGAGGAGG + Intronic
1137573836 16:49585167-49585189 CTACCCTGAGGGGGTCTTGGGGG - Intronic
1140935496 16:79666007-79666029 CCACCCTCTGGTTGGCTTTGGGG - Intergenic
1141484544 16:84330123-84330145 AATCCCTCTGGGGGTCTTGGAGG + Intergenic
1144023276 17:11255738-11255760 CAACACTCTTGGTGTGGTGGGGG - Intronic
1147385004 17:40075800-40075822 CAACCCTCTGGGAGGCGTGAGGG + Intronic
1149159210 17:53670033-53670055 CAACACTCTTGGTGTGTTGGAGG - Intergenic
1149955850 17:61048824-61048846 CAACCATCTGAGTGTCTTAGAGG + Intronic
1156083906 18:33376253-33376275 CAACACTCCTGGTGTGTTGGGGG + Intronic
1156710965 18:39945098-39945120 CATCCCACTGGGGGACTTGGGGG + Intergenic
1157328810 18:46688595-46688617 CCACCCTCTGGATTTCTTTGGGG - Intronic
1158027458 18:52917728-52917750 CCACCCTCTTGCTGTCTGGGAGG + Intronic
1158244781 18:55419902-55419924 AAAACATCTGGGTGTCTTAGTGG + Intronic
1159089086 18:63826490-63826512 CTACCCTCTGGGTGGCTTTTGGG - Intergenic
1160037481 18:75315360-75315382 CCACCCTCTGTGGGTCTGGGTGG - Intergenic
1160814018 19:1027081-1027103 CAACGCTCTGGGGGTCTGGGGGG + Intronic
1161698561 19:5783413-5783435 CAAAGCTCTGGCCGTCTTGGGGG + Exonic
1163948058 19:20558754-20558776 CAATCACCTGGGTGTCTTTGAGG - Intronic
1164621149 19:29696773-29696795 CAGCTGTCTGGGTGTCTGGGTGG + Intergenic
1167497296 19:49827119-49827141 CACCCCTCTGAGGGTCTTGAGGG - Intronic
1168033445 19:53699981-53700003 CAACACTCTGGGTTTTTTGTTGG - Intergenic
1168036271 19:53722132-53722154 CAGCACTCTGGGTTTCTTGTTGG - Intergenic
1168037900 19:53734843-53734865 CAGCACTCTGGGTTTCTTGTTGG - Intergenic
1168038923 19:53742478-53742500 CAGCACTCTGGGTTTCTTGTTGG - Intergenic
1168110017 19:54187044-54187066 CCACCCCCAGGGTGTGTTGGAGG + Intronic
929037782 2:37711319-37711341 CCTCCCTCTGGGTGTCTTCAGGG - Intronic
930027568 2:47038653-47038675 GAACCCTCTGTGTGTCGGGGGGG - Intronic
932429114 2:71663392-71663414 CAACCCTCTGGGGGTCTCACAGG + Intronic
932855554 2:75230284-75230306 CACTCCTCTGGGAGTTTTGGGGG + Intergenic
934120483 2:88833041-88833063 CAACCTTCTATGTGTATTGGAGG - Intergenic
935704940 2:105848262-105848284 CAACCATCTGGGTGACTTTGGGG - Intronic
945063158 2:205925877-205925899 CAGCCCTCTGGGTGTCTCTCGGG - Intergenic
946049437 2:216849742-216849764 CTAGTCTCTGGGAGTCTTGGGGG + Intergenic
947443855 2:230148164-230148186 CAACCCACTGGGTGTGTGAGTGG - Intergenic
947617684 2:231568857-231568879 CCACCCTCTGTGTGGCTTGTAGG - Intergenic
1169260799 20:4136606-4136628 CCACCCTGTGGGGGTCCTGGTGG - Intronic
1169361634 20:4954857-4954879 CACCCCTCTGGGTGTCATTCAGG - Intronic
1170400527 20:15978343-15978365 CAGCCCTCCGGGTGGCATGGGGG + Intronic
1173833203 20:46106517-46106539 CAACACTTTGGGAGTCTGGGTGG + Intergenic
1174097719 20:48102557-48102579 CAACACTGTGGGTGTCTTCAGGG + Intergenic
1175894465 20:62329960-62329982 CAACCCTCTGGGTGTCTTGGGGG - Intronic
1176090966 20:63318483-63318505 CACCCCTCAGGGTGTCTGGCTGG + Intronic
1176113521 20:63421420-63421442 CAAAGCTTTGGGGGTCTTGGGGG - Intronic
1178453229 21:32723998-32724020 CAGCACTCTAGCTGTCTTGGAGG + Intronic
1179094188 21:38297139-38297161 AGAGCCTCTGGGTGTGTTGGGGG - Intronic
1179481570 21:41681933-41681955 CAGCCCTCGAGGTGTCTTGTGGG - Intergenic
1182260871 22:29072737-29072759 CAAACCGCTTGGTGACTTGGAGG + Intergenic
1184734247 22:46388774-46388796 CAACCCTCTGGCTGTGTGTGTGG - Intronic
1185288468 22:50012750-50012772 CCACCCTCTGTTTGTCTTTGGGG - Intergenic
1185423504 22:50748725-50748747 CACCCCTCGGGATGTCTAGGTGG - Intergenic
949124986 3:436472-436494 CAACACTCTGGGTGCCTTGGTGG - Intergenic
951754927 3:26080232-26080254 CAACCCTTTGTTTTTCTTGGGGG + Intergenic
953743508 3:45556196-45556218 CAACCCTCTAGGTGACCTGGTGG - Intronic
953744205 3:45560722-45560744 GAAGCCACTGGGTGTGTTGGTGG + Intronic
955032433 3:55233918-55233940 CTACCCTCAGGGTGTCTCCGGGG + Intergenic
960965819 3:123104073-123104095 CATGCCACTGGGTGTCTGGGTGG + Intronic
961145060 3:124586454-124586476 TAACTCTCTGGGCGTCTTGCTGG + Intronic
962320392 3:134385210-134385232 CTTCCTTTTGGGTGTCTTGGTGG - Intergenic
968451596 4:678587-678609 CAAAACTCTGGGTGCCCTGGAGG + Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
969575038 4:8031686-8031708 CTTGCCTCTGGGTGTCGTGGTGG + Intronic
973111085 4:46398774-46398796 AACCCCTCTGGGTGTTTAGGTGG - Intronic
975027888 4:69575452-69575474 CATCCCTCTGGGTGGGTTAGTGG + Intergenic
975668507 4:76756606-76756628 CAACTTGCTGGGTCTCTTGGTGG + Exonic
983885633 4:172977215-172977237 CAACACTCTGGGTCTATTGATGG + Intronic
985553998 5:547245-547267 CAGCCCACTGGGTCTCTAGGAGG - Intergenic
991650337 5:68846238-68846260 TAACCCAGTGGATGTCTTGGGGG - Intergenic
992810719 5:80385688-80385710 CAACCCTCTTGATTTATTGGGGG - Intergenic
995116677 5:108488473-108488495 CAACCCTCTGGGTGGATATGGGG - Intergenic
995403930 5:111772640-111772662 CATCCCTGTTGGTGTCTCGGGGG - Intronic
1007455776 6:41975948-41975970 CAACCCTCTGAGGATCTGGGAGG - Intronic
1007519051 6:42437553-42437575 CAACCCTCTGGGGCTATTCGTGG - Intronic
1008078855 6:47173930-47173952 CAACTCTCTGGGTCACTTGAGGG + Intergenic
1010748891 6:79596149-79596171 AAACCTTCTGGGTTTTTTGGTGG + Intergenic
1013617737 6:111860361-111860383 AAACCCCATGGGTGTTTTGGTGG + Intronic
1021795098 7:24246571-24246593 ACACCCTCTGGGTGTCTCTGAGG - Intergenic
1024527360 7:50360174-50360196 CCACCCTCTGTGTGTCCTGGGGG + Intronic
1026409355 7:70103473-70103495 CCAATCCCTGGGTGTCTTGGTGG + Intronic
1028422363 7:90648142-90648164 TTAGGCTCTGGGTGTCTTGGAGG + Intronic
1029348214 7:99993894-99993916 CAGCCCTCTGGGGGTCGAGGCGG + Intergenic
1029515407 7:101020304-101020326 CACCCCTATTGGTGTCCTGGAGG - Intronic
1032184064 7:129708278-129708300 CCACACTCTGTGTGTGTTGGGGG - Intronic
1035065158 7:156099049-156099071 CAACCTTTTGGGTGTGTTGGCGG + Intergenic
1052596504 9:30567030-30567052 CAACTCTCTTGATGTCTTTGTGG + Intergenic
1057797670 9:98170213-98170235 CAGTCCTATGGGTGTGTTGGTGG - Intronic
1061209239 9:129181263-129181285 CCATCCTCTGGGTCTGTTGGGGG + Intergenic
1061493013 9:130956738-130956760 CAACCCTCTGGATGTCCAGACGG + Intergenic
1188105926 X:26146628-26146650 CAACCCTCTTCATTTCTTGGTGG - Intergenic
1188845160 X:35063137-35063159 CAACCCTCTTTGTTTCCTGGAGG - Intergenic
1189521466 X:41773134-41773156 CAACACTCTGGGAGGCTGGGCGG + Intronic
1190256264 X:48765008-48765030 CCTCCCTCTGGGTGTCAAGGTGG + Intronic
1197162330 X:123338053-123338075 CAACTCTCTGAGTGGCTTGGTGG - Intronic
1197785091 X:130190852-130190874 CAACCCACTGGGCTTCCTGGAGG - Intergenic
1197902847 X:131392571-131392593 CAACCCACTGGGATTCTTGGAGG - Intronic
1200153266 X:153961921-153961943 CAAGCACCTGGGTGTCTTTGTGG - Intronic
1200181043 X:154150909-154150931 CCACCCTATGTGTGTCCTGGAGG + Exonic
1200186687 X:154188023-154188045 CCACCCTATGTGTGTCCTGGAGG + Intergenic
1200192339 X:154225161-154225183 CCACCCTATGTGTGTCCTGGAGG + Exonic
1200198094 X:154262965-154262987 CCACCCTATGTGTGTCCTGGAGG + Exonic
1200963836 Y:9018743-9018765 GACCCTTCTGGCTGTCTTGGTGG + Intergenic
1201147370 Y:11072605-11072627 CACCCCTCTGGGAGTGTGGGCGG - Intergenic
1201147441 Y:11072825-11072847 CACCCCTCTGGGAGCCTAGGTGG - Intergenic