ID: 1175894606

View in Genome Browser
Species Human (GRCh38)
Location 20:62330577-62330599
Sequence ACCACCCATGTGCCCACGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175894606_1175894611 0 Left 1175894606 20:62330577-62330599 CCCAGCGTGGGCACATGGGTGGT 0: 1
1: 0
2: 0
3: 15
4: 94
Right 1175894611 20:62330600-62330622 GAAGACCACGGTGGCCTGCAGGG 0: 1
1: 0
2: 2
3: 15
4: 260
1175894606_1175894610 -1 Left 1175894606 20:62330577-62330599 CCCAGCGTGGGCACATGGGTGGT 0: 1
1: 0
2: 0
3: 15
4: 94
Right 1175894610 20:62330599-62330621 TGAAGACCACGGTGGCCTGCAGG 0: 1
1: 0
2: 0
3: 20
4: 163
1175894606_1175894609 -9 Left 1175894606 20:62330577-62330599 CCCAGCGTGGGCACATGGGTGGT 0: 1
1: 0
2: 0
3: 15
4: 94
Right 1175894609 20:62330591-62330613 ATGGGTGGTGAAGACCACGGTGG 0: 1
1: 0
2: 0
3: 9
4: 159
1175894606_1175894615 19 Left 1175894606 20:62330577-62330599 CCCAGCGTGGGCACATGGGTGGT 0: 1
1: 0
2: 0
3: 15
4: 94
Right 1175894615 20:62330619-62330641 AGGGATAGGCCCTAGTGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 92
1175894606_1175894613 5 Left 1175894606 20:62330577-62330599 CCCAGCGTGGGCACATGGGTGGT 0: 1
1: 0
2: 0
3: 15
4: 94
Right 1175894613 20:62330605-62330627 CCACGGTGGCCTGCAGGGATAGG 0: 1
1: 0
2: 1
3: 23
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175894606 Original CRISPR ACCACCCATGTGCCCACGCT GGG (reversed) Exonic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
910758526 1:90714399-90714421 AGCACCCAAGTGCCCACTCCAGG + Intronic
912475360 1:109931259-109931281 ACCAGCCATTTTCCCAGGCTGGG - Intergenic
916703240 1:167319769-167319791 ACCACCCATATTCCCTCGTTTGG - Intronic
919315840 1:195969770-195969792 ACCACCCATGTCCACAGCCTCGG - Intergenic
920167281 1:204044882-204044904 CCCTCCCAGGTGCCCACTCTTGG + Intergenic
1066055718 10:31678375-31678397 ACCGCCCCTGTGCCCAGGCTGGG - Intergenic
1067030770 10:42877837-42877859 CCCACCCAGGTGCCCATGCTGGG - Intergenic
1071337563 10:84613414-84613436 ACCAACCATGTGCACACACTGGG - Intergenic
1073534924 10:104268242-104268264 ACCACCTATGTGCCCAACATGGG - Intergenic
1075447042 10:122520182-122520204 ACCTGCCATGTGCTCATGCTAGG + Intergenic
1077036442 11:497366-497388 CTCACCCATGTGCTCACACTCGG + Intronic
1077263194 11:1634174-1634196 ACCAGCCAGCTGCCCACCCTGGG - Intergenic
1078547322 11:12255800-12255822 ACATCCCATGTGCCCGCCCTGGG - Intronic
1083902278 11:65649472-65649494 ACCACGCAGGTGCACACTCTTGG + Exonic
1087641676 11:100761424-100761446 ACCACCCATCTTCCTACCCTGGG - Intronic
1090820296 11:130336219-130336241 AGCACCCATCAGCCCACTCTGGG + Intergenic
1091536426 12:1414271-1414293 ACCAAACATCTGACCACGCTGGG - Intronic
1091638019 12:2213043-2213065 ACTGCCCATGTGCCCAGTCTAGG + Intronic
1092852860 12:12646752-12646774 ACAACACATGTGCCTAAGCTAGG + Intergenic
1096840469 12:54376700-54376722 ACCATCCCTGTCCCCACCCTGGG + Intronic
1097855124 12:64453601-64453623 ACCACCAATATCCCCAAGCTGGG - Intronic
1098056968 12:66517480-66517502 ACCACCTATCTGTCCAGGCTGGG + Intronic
1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG + Intronic
1102752608 12:115308797-115308819 GCCAACCATGTGCCAAGGCTGGG - Intergenic
1105014842 12:132780220-132780242 ACCCCCCATGTGCACACACACGG + Intronic
1109218579 13:59617355-59617377 AACAGCCCTGTGCCTACGCTCGG + Intergenic
1109739458 13:66533042-66533064 GCCACTTATGTGCCCACACTGGG + Intronic
1111588569 13:90312869-90312891 ACCACAAATTTGCCCACGCGGGG - Intergenic
1116238285 14:42309284-42309306 ATCACACATGTTCCCTCGCTTGG - Intergenic
1120744798 14:88143623-88143645 CACACCCAGGTGCCCAAGCTGGG - Intergenic
1122412069 14:101530716-101530738 GCCACCCATGTGCCCATCCTGGG + Intergenic
1125889573 15:43255545-43255567 GCCACCCCTGGGCCCAGGCTGGG + Intronic
1129739880 15:77985080-77985102 GCCACCCATGTGCCCCCGCCAGG + Intronic
1131515144 15:93072409-93072431 TCCACCCATTTGGCCACGCGGGG - Intronic
1132668163 16:1091208-1091230 GGCCCCCATGAGCCCACGCTGGG + Intronic
1133916687 16:10115485-10115507 TCCATCCATGTGCACACCCTGGG + Intronic
1138246162 16:55468620-55468642 ACCAGCCATGTGCCCCAGGTCGG - Intronic
1138246237 16:55469023-55469045 TCCACCCATGAGTCCACGCTAGG + Intronic
1138507488 16:57485655-57485677 ATCACCCAGGTGCCCAGCCTCGG + Intronic
1146053833 17:29571613-29571635 ACCACCCCTGTGCCCATCCCTGG + Exonic
1147594242 17:41706378-41706400 ACCACCCCTGGGCCCAGGCTGGG - Intergenic
1149678476 17:58487676-58487698 GCCGCCCATGTGCCCACTGTGGG + Intronic
1151460956 17:74253657-74253679 ACCTCCCATGTGCTCACCCATGG + Intronic
1151636286 17:75350780-75350802 ACCACCCAAGTGGCCAGGCACGG - Intronic
1154232318 18:12568211-12568233 AACACCTATGTTCCCACCCTGGG - Intronic
1156668280 18:39435301-39435323 ACCACCCACATGACCACTCTTGG - Intergenic
1160918217 19:1507630-1507652 CCCACCCAGGTGCCTTCGCTGGG - Exonic
1162126011 19:8499874-8499896 ACCACCCCTGCGCCCAGGCCCGG + Intronic
1162606266 19:11710488-11710510 GCTACCCATGTGCTCACCCTGGG + Intergenic
1162677237 19:12308307-12308329 GCCACCCATGTGCTCAGTCTGGG + Intergenic
1163588280 19:18175721-18175743 ACCACCCATGTCCCCCTCCTTGG - Intronic
1164752759 19:30668841-30668863 ACCACCTGTGTGCCCAAGCCTGG + Intronic
1164907843 19:31981994-31982016 ACCACCCATGTGCCAACCCCTGG - Intergenic
1165090978 19:33388332-33388354 GCCACCCATGTGCACACACCCGG + Intronic
1166427485 19:42692349-42692371 TCCTCCCATGTGCCCAGGCTGGG - Intronic
1166994852 19:46715519-46715541 AACACCCAGCTGCCCACCCTGGG + Intronic
925740699 2:7003778-7003800 ACCTGCCATGTGGCCACTCTGGG + Intronic
927148978 2:20185006-20185028 ACCAGCCACGTGCCCCCTCTCGG - Intergenic
932219396 2:69988261-69988283 ACAACCCAAGCGCCCACGCATGG + Intergenic
932236517 2:70125078-70125100 ACCCCCCCGGTGCCCAAGCTCGG + Intergenic
932558205 2:72843962-72843984 ACAACCTATGTGCCCATCCTAGG + Intergenic
936158999 2:110070084-110070106 ACCACCCCTGGGCCTACTCTGGG + Intergenic
936185662 2:110301248-110301270 ACCACCCCTGGGCCTACTCTGGG - Intergenic
939656425 2:144831565-144831587 TTCAACCATGTGCCCACCCTTGG + Intergenic
942296751 2:174524849-174524871 ACCTCCCATGTGCCCATTTTTGG - Intergenic
942787677 2:179719164-179719186 TCCACCCATGAGCCCACCCCAGG + Intronic
949041056 2:241850156-241850178 GCCCCCCATGTGCCCACCCTGGG - Exonic
1171464035 20:25315496-25315518 CCCACCCCTGTGCCCTTGCTGGG + Intronic
1172273881 20:33669509-33669531 CCCACCCATCTACCCACCCTGGG + Intronic
1174251970 20:49226552-49226574 AACACCCTTCTGCCCACCCTGGG - Intronic
1174382971 20:50169231-50169253 GCCACCCATGTGCCCTCTCTGGG + Intergenic
1175894606 20:62330577-62330599 ACCACCCATGTGCCCACGCTGGG - Exonic
1181166630 22:20987482-20987504 ACCACCCCTGTGCCCACCCCAGG + Exonic
1183457612 22:37931131-37931153 ACTTCCCATGAGCCCAAGCTGGG - Intronic
1183725858 22:39589341-39589363 ACCAAACATATGCCCACGCTAGG - Intronic
1184188314 22:42878894-42878916 ACCTCCCAGGTGTCCAGGCTGGG + Intronic
1184636371 22:45835237-45835259 AGGACCCATGAGCCCACGCCAGG - Intronic
950550398 3:13662645-13662667 CCCACGGCTGTGCCCACGCTAGG + Intergenic
953537783 3:43789178-43789200 ACCGCCCATGTGGCCCCTCTTGG + Intergenic
954414343 3:50385676-50385698 GCCACCCATCTGCCCACCCCTGG + Intronic
961628561 3:128280417-128280439 ACCTCCCTTGTGCCCTCACTCGG + Intronic
962023168 3:131521389-131521411 ACCTCCCATGTGCCCATTGTTGG - Intergenic
962869236 3:139473773-139473795 CCCACCCATGTTCCCACGGCAGG + Intronic
968288513 3:197521952-197521974 ACCAGCCATGTTCCCTCGCCTGG + Intronic
969682999 4:8653518-8653540 ACCAGGCAGGTGCCCAGGCTGGG + Intergenic
969986769 4:11219446-11219468 AAAACCCCAGTGCCCACGCTTGG - Intergenic
971537388 4:27770940-27770962 ACCAGCCATGTGCCCCAGCCAGG - Intergenic
975675187 4:76820938-76820960 ACCACCCCTGGGCCTGCGCTGGG + Intergenic
980660705 4:135854899-135854921 ACCACCACTGTGACCGCGCTGGG + Intergenic
980961254 4:139478617-139478639 CCCACCCCAGTTCCCACGCTGGG + Intergenic
985818129 5:2141791-2141813 ACCACCCAGGTGCCCCCTCCTGG - Intergenic
998147781 5:139740091-139740113 ACCACCCCTGTGCCTACTCCAGG - Intergenic
998396791 5:141823877-141823899 ACCCCTCATGTGCCCAAACTTGG - Intergenic
1003512424 6:6792507-6792529 ACCAACCATCTGCCCACCCCCGG + Intergenic
1006607613 6:35269800-35269822 CCCACCCTTGTGACCAGGCTGGG + Intronic
1018795967 6:167185917-167185939 ACCACGCCTGTGTCCACGCTCGG - Intronic
1018820351 6:167369147-167369169 ACCACGCCTGTGTCCACGCTCGG + Intronic
1019283384 7:211475-211497 GCCCCTCATGTGGCCACGCTGGG - Intronic
1023292073 7:38678846-38678868 ACCACACATGTGCACATGGTTGG + Intergenic
1023714895 7:43033993-43034015 GAAACCCATGTGCCCACGCAGGG + Intergenic
1029424240 7:100486532-100486554 TCCACACAGGTGCCCAGGCTGGG + Intronic
1029652942 7:101906250-101906272 ACCAACCCTGTGCCCAGACTAGG + Intronic
1032412597 7:131708465-131708487 AACTCCCATGTACCCACACTTGG + Intergenic
1037525739 8:19722556-19722578 ACCACCCATGACCCTAGGCTGGG - Intronic
1045225416 8:100239585-100239607 ACCATCCATGGACCCACGTTGGG - Intronic
1051531929 9:18113478-18113500 ACCACCCAGTTGCCCAAGCCAGG - Intergenic
1059615654 9:115948232-115948254 CCAACCTATGTGCCCAGGCTTGG - Intergenic
1061869988 9:133515399-133515421 ACCAGGGCTGTGCCCACGCTGGG - Intronic
1195536895 X:106019255-106019277 TCCACACATGTGCCCAGGGTTGG - Intergenic