ID: 1175899119

View in Genome Browser
Species Human (GRCh38)
Location 20:62353114-62353136
Sequence CCTGTGAGTCTCTGCCGCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175899119_1175899127 19 Left 1175899119 20:62353114-62353136 CCACGGCGGCAGAGACTCACAGG 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1175899127 20:62353156-62353178 GTAGGTGCGGCCGAAGTCCATGG 0: 1
1: 0
2: 0
3: 1
4: 40
1175899119_1175899125 6 Left 1175899119 20:62353114-62353136 CCACGGCGGCAGAGACTCACAGG 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1175899125 20:62353143-62353165 ACTGCCAGGGCTGGTAGGTGCGG 0: 1
1: 0
2: 1
3: 29
4: 316
1175899119_1175899124 1 Left 1175899119 20:62353114-62353136 CCACGGCGGCAGAGACTCACAGG 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1175899124 20:62353138-62353160 AAAGAACTGCCAGGGCTGGTAGG 0: 1
1: 0
2: 0
3: 20
4: 228
1175899119_1175899123 -3 Left 1175899119 20:62353114-62353136 CCACGGCGGCAGAGACTCACAGG 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1175899123 20:62353134-62353156 AGGCAAAGAACTGCCAGGGCTGG 0: 1
1: 0
2: 2
3: 25
4: 282
1175899119_1175899121 -8 Left 1175899119 20:62353114-62353136 CCACGGCGGCAGAGACTCACAGG 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1175899121 20:62353129-62353151 CTCACAGGCAAAGAACTGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 182
1175899119_1175899122 -7 Left 1175899119 20:62353114-62353136 CCACGGCGGCAGAGACTCACAGG 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1175899122 20:62353130-62353152 TCACAGGCAAAGAACTGCCAGGG 0: 1
1: 0
2: 1
3: 18
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175899119 Original CRISPR CCTGTGAGTCTCTGCCGCCG TGG (reversed) Exonic