ID: 1175899501

View in Genome Browser
Species Human (GRCh38)
Location 20:62354463-62354485
Sequence GGGCCTCCATGCCTGCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 279}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175899492_1175899501 8 Left 1175899492 20:62354432-62354454 CCTCATATCTGCACCCACCCGAC 0: 1
1: 0
2: 0
3: 15
4: 205
Right 1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG 0: 1
1: 0
2: 1
3: 18
4: 279
1175899498_1175899501 -10 Left 1175899498 20:62354450-62354472 CCGACATGACCGTGGGCCTCCAT 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG 0: 1
1: 0
2: 1
3: 18
4: 279
1175899491_1175899501 12 Left 1175899491 20:62354428-62354450 CCAGCCTCATATCTGCACCCACC 0: 1
1: 0
2: 3
3: 27
4: 288
Right 1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG 0: 1
1: 0
2: 1
3: 18
4: 279
1175899489_1175899501 29 Left 1175899489 20:62354411-62354433 CCAGCAGTCAGTGCTACCCAGCC 0: 1
1: 0
2: 2
3: 12
4: 175
Right 1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG 0: 1
1: 0
2: 1
3: 18
4: 279
1175899488_1175899501 30 Left 1175899488 20:62354410-62354432 CCCAGCAGTCAGTGCTACCCAGC 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG 0: 1
1: 0
2: 1
3: 18
4: 279
1175899490_1175899501 13 Left 1175899490 20:62354427-62354449 CCCAGCCTCATATCTGCACCCAC 0: 1
1: 1
2: 1
3: 22
4: 215
Right 1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG 0: 1
1: 0
2: 1
3: 18
4: 279
1175899497_1175899501 -9 Left 1175899497 20:62354449-62354471 CCCGACATGACCGTGGGCCTCCA 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG 0: 1
1: 0
2: 1
3: 18
4: 279
1175899496_1175899501 -6 Left 1175899496 20:62354446-62354468 CCACCCGACATGACCGTGGGCCT 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG 0: 1
1: 0
2: 1
3: 18
4: 279
1175899495_1175899501 -5 Left 1175899495 20:62354445-62354467 CCCACCCGACATGACCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 30
Right 1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG 0: 1
1: 0
2: 1
3: 18
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175899501 Original CRISPR GGGCCTCCATGCCTGCACCT GGG Intronic
900570774 1:3357217-3357239 GGGTCTGCGTGCCTCCACCTGGG + Intronic
900697867 1:4023346-4023368 GCTCCTCCATGCCAGCCCCTGGG - Intergenic
902335340 1:15751284-15751306 TGGCCTCCATGCCCTCCCCTCGG - Intergenic
903856698 1:26342133-26342155 GGGCCTGCATGCTGGCTCCTGGG + Intronic
904439101 1:30518272-30518294 GGGTCTCCATCCCTGCAGCTGGG + Intergenic
904542227 1:31240594-31240616 GGGGCTCCCTACCTCCACCTGGG - Intergenic
905921230 1:41720240-41720262 GGGCCTCCAGGGCTGCTCCCAGG + Intronic
906266551 1:44435315-44435337 GGGCTTCCATGTCTGCACAATGG + Intronic
910591865 1:88934591-88934613 GGAGCTCCATGCCTGTACCTGGG - Intergenic
916434000 1:164759815-164759837 GTGCCTCCAGGCCTGGCCCTTGG + Intronic
920570789 1:207015797-207015819 GGGCCTTCATGCCTGAAAGTAGG - Intronic
921360657 1:214328745-214328767 GGGCCAACCTGCCTGCATCTTGG - Intronic
921903439 1:220472072-220472094 GAGCCACCATGCCTGGACCTAGG + Intergenic
923552601 1:234976066-234976088 TGGCCTCCATTTCTGCCCCTCGG - Intergenic
924083083 1:240419977-240419999 AGGCCTCCTTGGCTGCCCCTTGG + Intronic
1063718417 10:8553534-8553556 CTGCCTCCAATCCTGCACCTTGG - Intergenic
1065917858 10:30367573-30367595 GGGGCTCCATGCCTCTAGCTGGG + Intronic
1066005366 10:31141748-31141770 GGGCCTCCATGCCAGCCCCTTGG - Intergenic
1068171849 10:53404332-53404354 GGGCCTCCAGGCCTGCAGTCTGG - Intergenic
1068964191 10:62895370-62895392 GGAGCTCCATGCCTGCACAATGG - Intronic
1069706279 10:70460646-70460668 AGGCCTCCCTGCCTCCACCCTGG + Intergenic
1070148249 10:73789897-73789919 AGGCCTCCATGGGTTCACCTAGG + Intronic
1070257335 10:74824480-74824502 AGGCCACCATGCCTGAAACTTGG + Intergenic
1074184389 10:111088133-111088155 CGTCCTCAATGCCTTCACCTGGG - Intergenic
1075092265 10:119450504-119450526 GGGCCTCCGTGCGTGCACCCAGG + Intronic
1076856317 10:133117056-133117078 GTGCCTCCATGAGAGCACCTGGG - Intronic
1077018014 11:405493-405515 GGGCCTCCTTGCCTGGTCCCTGG - Intergenic
1077292969 11:1808062-1808084 GGGAGTCTCTGCCTGCACCTGGG + Intergenic
1079356783 11:19736558-19736580 AGGCCTCCATGCCTTTCCCTGGG - Intronic
1080393222 11:31866954-31866976 TGGCCTCCATACCTGTGCCTTGG + Intronic
1080584725 11:33671265-33671287 GGGCCTCCCTGCCTGCCTGTTGG - Exonic
1081488075 11:43547252-43547274 GGCCCTCCATGTCAGCACCCAGG + Intergenic
1082025159 11:47566000-47566022 GGGCCCCCGAGCCTGCCCCTCGG - Intronic
1083147089 11:60767756-60767778 GTGCCTCCAGGCCCCCACCTAGG - Intronic
1084941595 11:72616074-72616096 GAGCCACCATGCCTGCCTCTTGG - Intronic
1085508205 11:77072022-77072044 TGGCCTCCCTGCCTGCATCCTGG + Intronic
1087756413 11:102059362-102059384 GAGCCACCATGCCTGGCCCTTGG - Intronic
1089505411 11:118958813-118958835 AGGCCTCCAGGCCTCCACATGGG - Intergenic
1092217618 12:6694115-6694137 GGGCCTCCCTAACTCCACCTAGG - Exonic
1092838175 12:12511784-12511806 GTGCCTCCATGGCTGTGCCTTGG - Intronic
1095517021 12:43017191-43017213 GTGCCTCCAGGGCTGCCCCTGGG + Intergenic
1096178587 12:49538840-49538862 GGGCCTCCCCGCCCGTACCTCGG - Intergenic
1096238377 12:49944976-49944998 GGCCTTCCCTGCCTCCACCTGGG + Intergenic
1101827412 12:108231258-108231280 GGGCCTCCAGGCCTGGATCTGGG + Intronic
1102541367 12:113621726-113621748 GCGCCAAAATGCCTGCACCTTGG - Intergenic
1103870576 12:124088371-124088393 GGGAGCCCAGGCCTGCACCTGGG + Exonic
1104037166 12:125105474-125105496 TGGCCTCCATCCATACACCTGGG - Intronic
1104102293 12:125624136-125624158 TGGCCTCCATGATTGGACCTTGG - Intronic
1104731021 12:131105397-131105419 GGGCCGCCATGCGGGGACCTGGG + Intronic
1104994079 12:132643191-132643213 GGCCCTCCATGGCAGCACATTGG - Intronic
1105027118 12:132856792-132856814 GGGCATCCACACCAGCACCTGGG - Intronic
1105029736 12:132874332-132874354 GGGCCTCCCTGCCTGTTCCAGGG - Intronic
1113637264 13:111928261-111928283 GGGCCTTGGTGCCTGCACCAAGG - Intergenic
1113654323 13:112058437-112058459 CGGCCTCCTCCCCTGCACCTAGG + Intergenic
1113836174 13:113330032-113330054 GGGTTTCCATGCAGGCACCTGGG - Intronic
1113836251 13:113330371-113330393 GGGCTTCCATGCACACACCTGGG - Intronic
1113836362 13:113330850-113330872 GGGCTTCCATGCACACACCTGGG - Intronic
1113910867 13:113840607-113840629 GGGCTTCCCTGCCTGCCTCTGGG - Intronic
1115649167 14:35390773-35390795 GGCCTTCCAGGCTTGCACCTGGG + Intergenic
1116764153 14:49050512-49050534 GGCCCTCCTTGCCTTGACCTAGG + Intergenic
1118962026 14:70542652-70542674 GAGCCACCATGCCTGGACATAGG - Intergenic
1119240207 14:73053143-73053165 GAGCCGCCATGCCTGGCCCTTGG + Intergenic
1119332202 14:73803168-73803190 GGGCCTCCATTTCTCCACTTTGG + Intergenic
1121156387 14:91689064-91689086 GGGCTGCCATGCCACCACCTTGG + Intronic
1121750267 14:96348396-96348418 GAGCCACCATGCCTGGCCCTTGG - Intronic
1121970901 14:98354931-98354953 AGGCCTCCATGTCTGCCCCAGGG + Intergenic
1122633098 14:103116813-103116835 GGCCTGCCATGCCAGCACCTGGG - Intergenic
1122790674 14:104182982-104183004 GGTCCTCCCTCCCTGGACCTGGG + Intergenic
1122790682 14:104183003-104183025 GGTCCTCCCTGCCTGGACCCCGG + Intergenic
1122797424 14:104212951-104212973 GGCACCCCATGCCGGCACCTAGG + Intergenic
1123666115 15:22610521-22610543 GGGGCTCCATGCCTCTAGCTAGG + Intergenic
1124319938 15:28704927-28704949 GGGGCTCCATGCCTCTAGCTAGG + Intronic
1124482572 15:30090496-30090518 GGGGCTCCATGCCTCTAGCTGGG - Intronic
1124484295 15:30101801-30101823 GTGCCTCCCTCCCTGGACCTTGG + Intergenic
1124489028 15:30142592-30142614 GGGGCTCCATGCCTCTAGCTAGG - Intronic
1124519287 15:30395423-30395445 GTGCCTCCCTCCCTGGACCTTGG - Intergenic
1124521005 15:30406713-30406735 GGGGCTCCATGCCTCTAGCTGGG + Intronic
1124537657 15:30559507-30559529 GGGGCTCCATGCCTCTAGCTGGG - Intronic
1124539368 15:30570798-30570820 GTGCCTCCCTCCCTGGACCTTGG + Intergenic
1124544113 15:30611562-30611584 GGGGCTCCATGCCTCTAGCTGGG - Intronic
1124564077 15:30798997-30799019 GGGGCTCCATGCCTCTAGCTGGG - Intergenic
1124754502 15:32395731-32395753 GGGGCTCCATGCCTCTAGCTAGG + Intronic
1124759282 15:32436774-32436796 GTGCCTCCCTCCCTGGACCTTGG - Intergenic
1124760999 15:32448080-32448102 GGGGCTCCATGCCTCTAGCTGGG + Intronic
1124777635 15:32600983-32601005 GGGGCTCCATGCCTCTAGCTGGG - Intronic
1125513243 15:40303906-40303928 CAGCATCCATGCCTCCACCTTGG + Intronic
1125786027 15:42318876-42318898 GAGCCACCATGCCTGGCCCTAGG + Intronic
1126112821 15:45185685-45185707 GGGCCTCCATGCCTCAGCTTGGG - Intronic
1126352569 15:47759770-47759792 GGGCCACCCTGACTTCACCTTGG + Exonic
1127298894 15:57633570-57633592 GGTACTCCATGCCTGTACTTAGG + Intronic
1127361279 15:58247083-58247105 GGGCCTCCATTTCTTCACCAAGG - Intronic
1128584530 15:68836577-68836599 GAGCCACCATGCCTGGCCCTGGG - Intronic
1128702429 15:69814061-69814083 GGGGCGCCATGCCTGCCCTTAGG + Intergenic
1129029920 15:72610573-72610595 GGGGCTCCATGCCTCTAGCTGGG - Intergenic
1129394781 15:75237797-75237819 GGCCCCCCATCCCTGCAGCTAGG - Intergenic
1129727386 15:77908509-77908531 GGGCCTCCATGGCTGAGCCTGGG + Intergenic
1129728874 15:77918182-77918204 GGGGCTCCATGCCTCTAGCTGGG + Intergenic
1129832829 15:78681838-78681860 GGGCCTCCCTGGGTGCACCGGGG + Intronic
1129840494 15:78740477-78740499 AGGCCTCCATGGCTGAGCCTGGG - Intergenic
1130259423 15:82344015-82344037 GGGGCTCCATGCCTCTAGCTGGG + Intronic
1130269254 15:82435150-82435172 GGGGCTCCATGCCTCTAGCTGGG - Intronic
1130281842 15:82525167-82525189 GGGGCTCCATGCCTCTAGCTGGG - Intergenic
1130473209 15:84241330-84241352 GGGGCTCCATGCCTCTAGCTGGG - Intronic
1130480624 15:84355395-84355417 GGGGCTCCATGCCTCTAGCTGGG - Intergenic
1130484818 15:84392831-84392853 GGGGCTCCATGCCTCTAGCTGGG - Intergenic
1130491088 15:84432364-84432386 GGGGCTCCATGCCTCTAGCTGGG + Intergenic
1130502672 15:84511164-84511186 GGGGCTCCATGCCTCTAGCTGGG + Intergenic
1130595494 15:85245920-85245942 GGGGCTCCATGCCTCTAGCTGGG - Intergenic
1131029974 15:89178416-89178438 GGGCCTCCCCGGCTCCACCTTGG - Intronic
1131055646 15:89372853-89372875 GGGCCTCAATGACAGGACCTTGG + Intergenic
1131282657 15:91033783-91033805 GGGGCTCCATGCCTCTAGCTGGG + Intergenic
1132613246 16:828123-828145 GGGCCTCCGTGCCTGGACCCAGG + Intergenic
1134005679 16:10817788-10817810 GGCCCTCCATGGCTGCACTAAGG + Intronic
1134085129 16:11351311-11351333 GGGCCGCCATGCCTGCCGTTAGG - Exonic
1134648260 16:15888275-15888297 AGGCCTACAGGCCTGCATCTTGG - Intronic
1135544100 16:23354318-23354340 GGGCCTCCCTGCCTCCCCTTGGG - Intronic
1136286645 16:29248133-29248155 GGGGCCCCATGGCTGCACCAAGG - Intergenic
1136420801 16:30131678-30131700 GAGCCACCATGCCTGGCCCTTGG + Intergenic
1138157626 16:54720712-54720734 TGCCATCCATGCCTGCACATGGG - Intergenic
1138730102 16:59184935-59184957 GGGCATAGATGCCTCCACCTAGG - Intergenic
1139327928 16:66166431-66166453 GGGTCTCTATGCCTGCCCTTGGG + Intergenic
1139914539 16:70419913-70419935 AGGCCTCCATACCTGCAGCCTGG - Intronic
1141642685 16:85350457-85350479 GGGGCTCCAGGCCAGCAGCTAGG + Intergenic
1141674424 16:85510126-85510148 AGGGCTCCCTGCCTGCCCCTCGG + Intergenic
1142092241 16:88220766-88220788 GGGGCCCCATGGCTGCACCAAGG - Intergenic
1142289009 16:89184188-89184210 GAGCCTCCAAGCCTGAGCCTGGG - Intronic
1142685400 17:1574687-1574709 GAGCCGCCAGGCCTGCAGCTGGG - Exonic
1142731457 17:1861261-1861283 CGGCCCCCATTTCTGCACCTCGG + Intronic
1142957813 17:3533120-3533142 TGGCCTCCCTGCCTCCACCCTGG + Intronic
1143099566 17:4498020-4498042 GGGCCTCCATTTCTGTATCTGGG - Intergenic
1143762593 17:9115966-9115988 GGGCCACCCAGCCTGCCCCTGGG - Intronic
1144472273 17:15555575-15555597 GCTCCTCCATCCCTGCCCCTAGG + Intronic
1144924201 17:18789119-18789141 GCTCCTCCATCCCTGCCCCTAGG - Intronic
1145106432 17:20121737-20121759 GGTCCTCCCTGCCTGCCCCAGGG + Intronic
1146438853 17:32876660-32876682 GCGCCTCCATCCCTGGAGCTTGG + Intronic
1146860546 17:36294150-36294172 GAGCCACCATGCCTGGCCCTGGG + Intronic
1146946121 17:36874829-36874851 GGGCCTCCCAGCCAGGACCTGGG + Intergenic
1147090875 17:38098248-38098270 GAGCCACCATGCCTGGCCCTGGG + Intergenic
1147106336 17:38222258-38222280 GAGCCACCATGCCTGGCCCTGGG - Intergenic
1147977521 17:44256290-44256312 GGCCCTCCCTGCCTAAACCTAGG - Intronic
1148423175 17:47566261-47566283 GAGCCACCATGCCTGGCCCTGGG + Intronic
1149651720 17:58280079-58280101 GGTCCTGCATGTCTGCCCCTGGG - Intronic
1150795101 17:68230409-68230431 GCCCCTCCATGCGTGCCCCTTGG + Intergenic
1151654719 17:75490507-75490529 GGGCCTCCAGGCCAGGCCCTGGG + Intronic
1151756203 17:76076559-76076581 GGGCCGCGACCCCTGCACCTCGG - Intronic
1151851893 17:76695704-76695726 GTGCCTCCATGCCTTTACATGGG - Intronic
1152252388 17:79218811-79218833 CGGCCTCCATGTCTGCACCGAGG - Intronic
1152595226 17:81234540-81234562 GGCCCCCCAAGCCTACACCTGGG + Intronic
1152742382 17:82023985-82024007 GGGCGCCCCTTCCTGCACCTGGG + Intronic
1154214845 18:12408250-12408272 GGGCCTCTGTGCCTGCAGCCAGG - Intronic
1154272479 18:12932112-12932134 GGGCCTCCAGTCTGGCACCTGGG + Intergenic
1157387519 18:47270712-47270734 GGGCCACCATGCCCGGCCCTGGG + Intergenic
1160011291 18:75108728-75108750 GGGCCTCCCTGCCTCCACCGAGG + Intergenic
1160347315 18:78144271-78144293 GTGCCACCATGCCTGACCCTTGG + Intergenic
1162477217 19:10907846-10907868 GGGCAGCCATGCCTGCACTGTGG - Intronic
1162794839 19:13081665-13081687 GGGGCTCCCTGCATGCACGTGGG - Exonic
1162932058 19:13962346-13962368 GGGCCTGCCTGCCTGCCCCCTGG + Exonic
1163107609 19:15134765-15134787 TAGCCTCTATGCCTGGACCTTGG - Intergenic
1163122477 19:15226183-15226205 GGGCCTCCCTGCCTGGCCCCTGG - Intergenic
1163148232 19:15396710-15396732 GAGACTTCAGGCCTGCACCTGGG - Intronic
1163577604 19:18119862-18119884 GGGACCCCATTTCTGCACCTCGG + Intronic
1163734724 19:18972626-18972648 GGGCTCCCCTGCCTGCACCCGGG - Intergenic
1164624044 19:29715036-29715058 GGGTCTCCAGGCCTGCTCTTGGG + Exonic
1165102490 19:33447144-33447166 TGACCTCCATGTCTGCACCTGGG - Intronic
1165335850 19:35169136-35169158 GGGCCTCCATGCCTCCTTCCTGG + Intronic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1167594285 19:50418994-50419016 GGGCCCCCAAACCTGCACCCGGG + Intronic
925346701 2:3176765-3176787 GGGCCTGAATGCCTGGCCCTGGG + Intergenic
925594164 2:5538991-5539013 TGGGCTCCAGGCCTGCACATTGG - Intergenic
926197906 2:10774694-10774716 GGGCCTGGTGGCCTGCACCTGGG - Intronic
927653524 2:24926990-24927012 GGGCCTCAATGTCTCCACCAGGG - Intergenic
930503748 2:52255959-52255981 GGGCCTCCAGGCCTGCAATGGGG + Intergenic
930732883 2:54745029-54745051 GGGCCTGCCTGCCTGCACACTGG + Intronic
931929165 2:67109728-67109750 TGGCCTCCTTGTATGCACCTTGG + Intergenic
932098391 2:68873099-68873121 GGGCCTCTCTGGCTGCACCCCGG - Intergenic
934098264 2:88627286-88627308 GCGCCTCCATGCCTGCGCGCGGG - Exonic
935747886 2:106205068-106205090 GGACCTCCAAGCCTTCATCTGGG - Intergenic
936122239 2:109757021-109757043 GGACCTCCAAGCCTTCATCTGGG + Intergenic
936222454 2:110614453-110614475 GGACCTCCAAGCCTTCATCTGGG - Intergenic
937273664 2:120670977-120670999 GGGCTGCCATGCCTGTCCCTGGG + Intergenic
937880771 2:126862936-126862958 CAGCCTCCATGCCTGCACTCTGG + Intergenic
937983011 2:127625877-127625899 GGGCCCCCCTGCCTGCCTCTGGG + Intronic
938160392 2:128980176-128980198 GGGCCTCCCACCCTGCTCCTTGG - Intergenic
938375930 2:130806704-130806726 GGGTCTCCATGCCTCCTGCTGGG + Intergenic
942653831 2:178194715-178194737 GGGCCGCGATGCGGGCACCTTGG - Intronic
943688513 2:190844416-190844438 TAGCCTCCATGCCTGCCACTGGG - Intergenic
946133903 2:217629601-217629623 GAGCCTCCATGCATCCAGCTGGG - Intronic
946228468 2:218277348-218277370 GGCCCTCCATGCCCTCACCTTGG + Exonic
948504845 2:238421872-238421894 GCGCAGCCCTGCCTGCACCTGGG - Intergenic
948708031 2:239807239-239807261 GGGCCCCCAGGCCAGCACCCAGG + Intergenic
1169191163 20:3660062-3660084 GGCCCTTCATGCCTCCACCCAGG + Intronic
1172095173 20:32456968-32456990 GGGCCACCGTGCCTGTGCCTAGG - Intronic
1172177706 20:32982628-32982650 AGGCCTCCACGCCAGCACCCAGG - Intergenic
1172177740 20:32982762-32982784 AGGCCTCCACGCCAGCACCCGGG - Intergenic
1174350596 20:49964899-49964921 CGGCCTCCATGCCTGACCCCGGG + Intergenic
1175721637 20:61291085-61291107 TGGCTTTCCTGCCTGCACCTTGG + Intronic
1175793582 20:61757534-61757556 GGGCTTCCCTGCCTGGTCCTGGG - Intronic
1175855691 20:62119769-62119791 GGGCCTGCATTCCTGGACCTGGG + Intergenic
1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG + Intronic
1176165180 20:63669130-63669152 GCGCCACCATGCCTGGCCCTTGG + Intronic
1179000034 21:37448980-37449002 GAGCCACCATGCGTGGACCTAGG + Intronic
1180707113 22:17816855-17816877 CGGCCTCCTTGGCTGCACATGGG - Intronic
1180937218 22:19633626-19633648 GGCCCACCAGGCCCGCACCTTGG + Intergenic
1182103039 22:27670909-27670931 GGGCCTCCAGGCCTGGCCCGGGG + Intergenic
1182697229 22:32205678-32205700 GGGCATCATTGCCTGCATCTGGG + Intergenic
1184257720 22:43296614-43296636 GGCCCTCCATGCCCGGTCCTGGG + Intronic
1184430546 22:44439574-44439596 GAGCCTTCAGCCCTGCACCTCGG - Intergenic
1184477417 22:44729171-44729193 TTGCCTCCATGCCTGTGCCTCGG + Intronic
1184504197 22:44891220-44891242 GGTCCTCCACGCCTGGGCCTGGG - Intronic
1184565365 22:45288667-45288689 GTGACTCCAAGCCTGCTCCTTGG - Intronic
1184792680 22:46709509-46709531 GGGTCTCCCTGTCAGCACCTGGG + Intronic
1185227980 22:49664030-49664052 GGGGCTCCATACCTGGGCCTGGG - Intergenic
1185347668 22:50317527-50317549 GGACCTCCTGGCCTCCACCTTGG - Intronic
1185368162 22:50446377-50446399 CGGCCTCCATCCCTTCAGCTCGG + Exonic
950923237 3:16716091-16716113 GGTCCTCCAGGCCTGGTCCTGGG - Intergenic
954455795 3:50599201-50599223 AGGCCTTGATGCCTGCACCCAGG - Intergenic
955045761 3:55358164-55358186 GGGCTGGCATCCCTGCACCTTGG - Intergenic
957488962 3:80898527-80898549 TGGCCTCCATTTCTGCCCCTTGG + Intergenic
960690457 3:120341773-120341795 GGGCCACCACAGCTGCACCTGGG - Intronic
962265366 3:133940641-133940663 GGGCTTCCCTTCTTGCACCTTGG - Intronic
964185648 3:153939644-153939666 GGGCCTACAGGCCTTCTCCTAGG + Intergenic
967986442 3:195098846-195098868 GGGCCTCCTGGCCTGCAGCCTGG + Intronic
969313896 4:6370169-6370191 GGGCCTCCATGCCTGGTCCAGGG - Intronic
969561223 4:7949673-7949695 GGGCATACATGCCTGCATCGGGG - Intergenic
969612993 4:8237411-8237433 GGGTCTGCATGCCTGCCCCGGGG + Intronic
969675834 4:8613891-8613913 GGGTCTCCAGGCCAGCAGCTGGG + Intronic
969689952 4:8698863-8698885 TGGCCTGCATGCCTGCCCCCTGG + Intergenic
972195554 4:36649495-36649517 GGGCCTCAAAGTCTACACCTTGG - Intergenic
974095312 4:57357326-57357348 CGGCCTCCAGGCCTTCACGTAGG - Intergenic
976384037 4:84434568-84434590 GAGCTTTCATGCCTTCACCTGGG + Intergenic
976708727 4:88046003-88046025 GAGCCACCATGCCTGGCCCTAGG - Intronic
980992984 4:139754918-139754940 GGCCGACCATGCCTGCTCCTGGG - Intronic
980995683 4:139777660-139777682 GGGACTCCAGGCATGCACCATGG + Intronic
981589086 4:146337312-146337334 TGGCCTGCATGCCTCCACCATGG + Intronic
983715555 4:170777110-170777132 TGGCATCCATGCCAGCACCTGGG + Intergenic
983937911 4:173515901-173515923 GGGCCTCAATGCCTGAACTTGGG + Intergenic
985966126 5:3339973-3339995 TGGCCTCCATGCCTGAAGCATGG - Intergenic
986111649 5:4724976-4724998 GAGCCTCCATTCATGCTCCTTGG + Intergenic
990215974 5:53532189-53532211 GAGCCACCATGCCTGACCCTTGG - Intergenic
991090379 5:62688700-62688722 GAGCCACCATGCCTGGACCCCGG + Intergenic
1001246464 5:170108664-170108686 GGTCCTCCATGCCAGCCCCACGG + Exonic
1001748189 5:174108150-174108172 GGGCCTCCATCCTAGGACCTGGG + Exonic
1002691796 5:181055079-181055101 GGCCCTCAGTGCCTGCACTTAGG + Intronic
1003859442 6:10308661-10308683 GAGCCACCATGCCTGGCCCTAGG + Intergenic
1005388983 6:25314212-25314234 CGGCCTCCATCCCAGCACTTTGG + Intronic
1006500627 6:34456797-34456819 GAGCCACCATGCCTGTCCCTAGG + Intergenic
1006942591 6:37762874-37762896 GGGCCTCCCTGGCTGCAACCTGG + Intergenic
1007599751 6:43074630-43074652 GGGCCTCAGTGCCAGCACCATGG + Exonic
1012177781 6:96110406-96110428 GGGCCTCCTTGACTGCTACTTGG + Intronic
1012881617 6:104797782-104797804 GAGCCACCATGCCTGGCCCTGGG - Intronic
1018172414 6:161153033-161153055 GGGCCTGCAGGCCTGGACCCAGG + Intronic
1018721960 6:166580093-166580115 GGGCCCCCGGGCCTGCCCCTTGG + Intronic
1019746049 7:2700886-2700908 GGACCTCCCTGCCTCCACCCTGG - Intronic
1021357804 7:19675001-19675023 GGGCCTCCTTTCCTGCTCATCGG + Intergenic
1021868134 7:24979363-24979385 GGGCCTCCAGCCCAGCACCGGGG + Intronic
1022469810 7:30675201-30675223 GGGCCCAAATGCCTGTACCTGGG + Intronic
1023664897 7:42512903-42512925 GGTCCTGCATGCATGCACCTGGG - Intergenic
1026938650 7:74273757-74273779 GAGCCACCATGCCTGGACATAGG + Intergenic
1026977679 7:74508335-74508357 GGGCCACGATGCCTGCATCAAGG + Intronic
1028401978 7:90434034-90434056 GTGCCTGCAGGCCTGCACCAAGG + Intronic
1030153043 7:106425500-106425522 AGGCCTTCATACCTGCAGCTGGG + Intergenic
1032758496 7:134915168-134915190 AGGCCCCCATGCCTCCTCCTCGG + Intronic
1034200709 7:149281615-149281637 GGGCCCCCAGGCCTGTTCCTGGG - Exonic
1034456914 7:151175602-151175624 GGGGCTCCCTGCCTGCCCCACGG - Intergenic
1035145389 7:156810675-156810697 GAGCCACCATGCCTGGCCCTGGG + Intronic
1037016519 8:13914497-13914519 GGGCCTCCCTCCCAGCAACTTGG + Intergenic
1038541061 8:28390426-28390448 GGGCCTCCAAGACTGGAACTAGG + Intronic
1039396943 8:37234476-37234498 GGGCCACCATGCCTGGCCCCCGG - Intergenic
1040906238 8:52472345-52472367 GGGCCTCAATGCCCACACTTGGG + Intergenic
1042750920 8:72156498-72156520 GAGCCACCGTGCCTGGACCTGGG + Intergenic
1049223043 8:141436570-141436592 GGGCCTCCCTGCTTGCAGCTTGG + Intergenic
1052778456 9:32756070-32756092 GGCCCGCCATGCCTCCACCCTGG - Intergenic
1055162935 9:73153835-73153857 GGGCCTCATGGCCTGCTCCTGGG + Intronic
1056165935 9:83940943-83940965 GGGCTTCTATGCTAGCACCTGGG - Intronic
1057704896 9:97389325-97389347 GGGGCTCCCTGCCTGCACCAGGG - Intergenic
1057739119 9:97696863-97696885 GGGCCTTCTTCGCTGCACCTCGG - Intronic
1057797413 9:98168958-98168980 GGGCCTTCTGGCCTCCACCTAGG - Intronic
1059308026 9:113369887-113369909 GGGCCACAATGCCTTCTCCTGGG + Exonic
1059328850 9:113522561-113522583 GAGCCTCCAGCCCAGCACCTGGG - Intronic
1060622631 9:125081851-125081873 GAGCCACCATGCCTGGTCCTAGG + Intronic
1062191192 9:135248706-135248728 GGTGCTCCATGAGTGCACCTGGG + Intergenic
1062520487 9:136955726-136955748 GCCCCTCCATCCCTGCCCCTTGG + Intronic
1062593270 9:137284613-137284635 GAGCCACCATGCCTGGCCCTAGG + Intergenic
1062609305 9:137366836-137366858 GGGCCTCCAGGCCTTCATCATGG - Intronic
1062674652 9:137733656-137733678 GGGCCTCTCTGTATGCACCTGGG - Intronic
1187275986 X:17817011-17817033 GGGCCTGCATGCCTGAATCACGG + Intronic
1187405092 X:18996697-18996719 TGCTCTCCATGCCAGCACCTGGG - Intronic
1188320073 X:28725232-28725254 GAGCCACCATGCCTGGCCCTTGG + Intronic
1192207395 X:69105542-69105564 GTTCCACCCTGCCTGCACCTGGG + Intergenic
1192809858 X:74537990-74538012 TGCCCTCCATGCCTCCATCTTGG - Intergenic
1193467496 X:81867064-81867086 TGGCACCCATGCCAGCACCTGGG - Intergenic
1198182582 X:134223969-134223991 AGGCCTCTCTGCATGCACCTAGG - Intergenic
1199693981 X:150330475-150330497 GAGCCTCCATGCTAGCTCCTGGG - Intergenic
1200161391 X:154011653-154011675 CTGCCTCCATGCCAGCATCTGGG - Exonic
1201278726 Y:12322082-12322104 GTGCCACCATCCCTGCACATGGG + Intergenic
1202367148 Y:24173217-24173239 GGGGCTCCATGCCTCTAGCTGGG - Intergenic
1202373280 Y:24212456-24212478 GGGGCTCCATGCCTCTAGCTGGG + Intergenic
1202497502 Y:25457664-25457686 GGGGCTCCATGCCTCTAGCTGGG - Intergenic
1202503633 Y:25496906-25496928 GGGGCTCCATGCCTCTAGCTGGG + Intergenic