ID: 1175901886

View in Genome Browser
Species Human (GRCh38)
Location 20:62363207-62363229
Sequence TTCCGGAGGCCTGTGGGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175901878_1175901886 23 Left 1175901878 20:62363161-62363183 CCACAGCCTTCTGGATTAGGGTC 0: 1
1: 0
2: 1
3: 13
4: 174
Right 1175901886 20:62363207-62363229 TTCCGGAGGCCTGTGGGGACCGG 0: 1
1: 0
2: 2
3: 18
4: 187
1175901880_1175901886 -1 Left 1175901880 20:62363185-62363207 CCAGAGAGACAGAATTAAGCTGT 0: 1
1: 0
2: 0
3: 42
4: 437
Right 1175901886 20:62363207-62363229 TTCCGGAGGCCTGTGGGGACCGG 0: 1
1: 0
2: 2
3: 18
4: 187
1175901877_1175901886 24 Left 1175901877 20:62363160-62363182 CCCACAGCCTTCTGGATTAGGGT 0: 1
1: 0
2: 0
3: 10
4: 115
Right 1175901886 20:62363207-62363229 TTCCGGAGGCCTGTGGGGACCGG 0: 1
1: 0
2: 2
3: 18
4: 187
1175901879_1175901886 17 Left 1175901879 20:62363167-62363189 CCTTCTGGATTAGGGTCTCCAGA 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1175901886 20:62363207-62363229 TTCCGGAGGCCTGTGGGGACCGG 0: 1
1: 0
2: 2
3: 18
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175901886 Original CRISPR TTCCGGAGGCCTGTGGGGAC CGG Intronic
900156466 1:1205239-1205261 GTCCGGAGTCCTGTGAGGCCGGG - Intronic
900245761 1:1635320-1635342 GGCCGGGGGCCTGTGTGGACAGG + Intronic
900256991 1:1702477-1702499 GGCCGGGGGCCTGTGTGGACAGG + Intronic
900652424 1:3736409-3736431 TTCAGGAGGCCTGAGAGGCCCGG - Intergenic
901415526 1:9113526-9113548 CTACAGAGGCCAGTGGGGACTGG - Intronic
901876106 1:12167790-12167812 TTTCTGCGGCCTCTGGGGACAGG + Intronic
902254779 1:15181042-15181064 TTCCGGAAGGCTGTGTGCACTGG + Intronic
903967736 1:27100756-27100778 CTTCTGAGGCCTGTTGGGACCGG - Intronic
904997395 1:34641661-34641683 GTCAGGAGCCCTGTGGGAACTGG + Intergenic
905356716 1:37389901-37389923 TTCCTGGGGTCTGTGGGAACAGG + Intergenic
906614833 1:47226793-47226815 TCCCTGAGGCCAGTGGGGTCTGG + Intronic
906725176 1:48039335-48039357 TTCAGGCAGCCTCTGGGGACAGG + Intergenic
910086818 1:83412841-83412863 TGCCGAAGGCCAGTGGGGCCTGG + Intergenic
913172281 1:116243734-116243756 TTCTGCATGCCTGTGGGGGCTGG + Intergenic
913187929 1:116387092-116387114 TGCCTGAACCCTGTGGGGACTGG + Intronic
915561818 1:156692299-156692321 TGCGGGGAGCCTGTGGGGACTGG + Intergenic
915792097 1:158683625-158683647 TTCCTAAAGCCAGTGGGGACAGG - Intronic
916989267 1:170224857-170224879 TACCGGAGGCTGGTGGGGATGGG + Intergenic
919825861 1:201502648-201502670 TTCTGGAGGCCCATGGGGCCTGG - Intronic
920278035 1:204823038-204823060 TTCTGGAGGACTTTGAGGACTGG - Intergenic
921023701 1:211259220-211259242 TTCCGGCCGCCTGGGGGGAGGGG - Intronic
921969811 1:221135753-221135775 GCCCGGAGGCCTGTGGGCAGTGG + Intergenic
923769535 1:236926306-236926328 ATCTGGAGGACTGTGGGGAGTGG + Intergenic
1063372628 10:5531810-5531832 TTCCAGAGGACTCTGGGGAGGGG - Intergenic
1067730181 10:48805036-48805058 TTCCGGGGGGCGGAGGGGACAGG + Intronic
1069818640 10:71214104-71214126 CTCCGGAGCCAGGTGGGGACGGG + Intronic
1072724391 10:97802834-97802856 TGCCGGAGTCTTGTGGGCACTGG + Intergenic
1072923700 10:99597756-99597778 TTCAGGAGGCCAGTGAGGAGTGG - Intergenic
1073302829 10:102481344-102481366 TCCCTGGGACCTGTGGGGACTGG - Intronic
1073446312 10:103582522-103582544 TTCAGGAGGCTTGGGGGGAAGGG + Intronic
1076348318 10:129796101-129796123 CTCCAGAGGCCTGTGAGGCCAGG + Intergenic
1076443350 10:130495511-130495533 TTCAGGAACCCTGTGGGCACAGG + Intergenic
1076550997 10:131278090-131278112 TTCCTGAGGCCAGTGGGCCCGGG - Intronic
1076851888 10:133097311-133097333 TGACGGAGGCCTGAGTGGACAGG - Intronic
1076890156 10:133279377-133279399 TTCCTGAGGTCTGTCGGAACCGG - Exonic
1078317818 11:10306711-10306733 TTCCCGAGCGGTGTGGGGACCGG + Exonic
1078875189 11:15387378-15387400 TTCCAGGGGCCTATGGGGATAGG - Intergenic
1080309215 11:30869808-30869830 TTCCAAAGGCCTTTGGGCACAGG + Intronic
1081854253 11:46294229-46294251 TTCCCTAGGCCTATGGGGACTGG + Intronic
1082210475 11:49495565-49495587 TTTCTGAGGCCTGTGAGGAAAGG + Intergenic
1082751753 11:57026571-57026593 TTTCTGAGGCCTGTGGGGATAGG - Intergenic
1083163105 11:60867655-60867677 TGCCGGAGGCCTGGGAGGCCAGG - Exonic
1083878815 11:65538372-65538394 TGCCGGGGGCCTGTAGGGGCGGG - Intronic
1084150000 11:67283694-67283716 CTCCTGAGCCCTGTGGGGAGAGG - Exonic
1084417597 11:69042414-69042436 GTCCAGTGGCCTGAGGGGACTGG + Intergenic
1084647094 11:70464902-70464924 TTCCAGAGGCATGTGTGGGCGGG + Intergenic
1086639152 11:89129235-89129257 TTTCTGAGGCCTGTGAGGAAAGG - Intergenic
1089262865 11:117234304-117234326 TTCCGGAGGACTGGGGGCATTGG - Exonic
1090830034 11:130414775-130414797 CCCGGGAGGCCTGTGGGGAGGGG + Exonic
1091303500 11:134522986-134523008 ATTAGGAGCCCTGTGGGGACTGG - Intergenic
1091888301 12:4032169-4032191 TTCCTGGGGCCTGTGGGCGCGGG + Intergenic
1091973929 12:4810124-4810146 TCCCGGAGGCCGGCGGGGGCGGG + Exonic
1092244903 12:6858526-6858548 TTCCGGATGCCTGTGTAGCCAGG - Exonic
1096193357 12:49633974-49633996 TCCAGGAGGCCTGTGGGCACTGG - Exonic
1096243959 12:49974172-49974194 TTCGGGAGGCCTGTGCAGAGGGG - Intronic
1097250093 12:57627770-57627792 TTCCCGAGGCCTGGGGCGCCGGG + Exonic
1097258144 12:57696162-57696184 TTCCTGGGGCCTGGGGGCACAGG + Intronic
1100044010 12:90356622-90356644 TTCTGGAGGCTGGTGGCGACAGG - Intergenic
1104939567 12:132388579-132388601 TTCCGGAGGCCTGAGGGCTGAGG - Intergenic
1106224867 13:27777521-27777543 TTCCGGAGGTTTGGGGGGAAGGG - Intergenic
1107146971 13:37070038-37070060 TTCCCCGAGCCTGTGGGGACAGG - Intergenic
1111182187 13:84684467-84684489 TTATGGAGACCTGTGGGGACAGG + Intergenic
1119425405 14:74531717-74531739 TCCCAGAGGCCAGTTGGGACTGG + Intronic
1119555268 14:75547959-75547981 CTGCGGAGCCCTGCGGGGACAGG - Intergenic
1122073078 14:99217812-99217834 CACCTGAAGCCTGTGGGGACGGG - Intronic
1122930850 14:104932519-104932541 TTCTGGGGCCCTGTGGGGCCAGG - Intronic
1123075124 14:105664257-105664279 TTCAGGAGGCTGGTGTGGACGGG + Intergenic
1128367504 15:67014854-67014876 TGCGGGAGGCCAGTGGGGAAGGG + Intergenic
1131580209 15:93635626-93635648 TTCCGGAAGCATGTGAGGCCAGG - Intergenic
1132586073 16:706164-706186 GTCCGGGGTCCTATGGGGACCGG + Intronic
1132835864 16:1953079-1953101 CTCCTGAGGCCTGTGGGGGAGGG + Intronic
1137387744 16:48056840-48056862 TCCCGGTGTCCTGTGGGGTCAGG + Intergenic
1138523872 16:57590541-57590563 TTCAGGATGCCTCTGGGGAGGGG + Intronic
1140124807 16:72110375-72110397 TTCAGGAGGCATGTGAGGTCTGG + Intronic
1140214978 16:73000047-73000069 TCCCGGAGCCCCATGGGGACAGG + Intronic
1142196016 16:88739669-88739691 CCCTGGAGGCCTGTGAGGACAGG - Intronic
1142757752 17:2025657-2025679 TCCAGGAGGCCTGCGGGGCCGGG - Intergenic
1143623234 17:8093149-8093171 TTCTGGAGCCCTGTGAGGTCAGG - Intergenic
1144467523 17:15508348-15508370 TTCCAGAGGGCTTTGGGGACAGG - Intronic
1144829607 17:18123912-18123934 ATACGCAGGCCTGTGGGGCCCGG - Intronic
1145250970 17:21296949-21296971 TTCCTGAAGCCTCTGGGGCCTGG + Intronic
1145749059 17:27342171-27342193 TTCTGGAGGAGTGTGGGGTCTGG + Intergenic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148775225 17:50091490-50091512 TTCCCCAGGCCTGTGTGGAGGGG - Intergenic
1150452229 17:65278713-65278735 TCCAGCAGGCCTGTGGGCACAGG + Intergenic
1151618864 17:75232776-75232798 TTCCTGAGCCCTGTGGGGACCGG - Intronic
1152644514 17:81462685-81462707 GGCCGGGGGGCTGTGGGGACAGG - Intronic
1152860958 17:82697099-82697121 TTCAGGAGGCCTCTGGGTGCTGG + Intronic
1153230565 18:2931367-2931389 TTCCCACGGACTGTGGGGACTGG + Exonic
1159687247 18:71438003-71438025 CTCCAGAGGCCAGTGGGGCCAGG + Intergenic
1161040558 19:2108867-2108889 TTCAGGAGGCCTGTAGGAGCAGG + Intronic
1161234789 19:3192457-3192479 TTCCGTGTGCCTGTGGGCACAGG - Exonic
1162412890 19:10517250-10517272 TCCTGGAGGCCTCTGGGGAGGGG - Intronic
1162523334 19:11194408-11194430 TTCTGGAGGCCTGAGGGGGCTGG - Intronic
1163811662 19:19436393-19436415 TCCCTGAGGCCTGAAGGGACGGG - Intronic
1165451872 19:35888507-35888529 TCCCGCAGGACGGTGGGGACTGG + Exonic
1168354813 19:55694606-55694628 TTCCCGAGGCCTCTGGGCACCGG + Intronic
1168400944 19:56086065-56086087 TTCTGGAGGCCTGGGAGGATGGG - Intergenic
925352980 2:3215202-3215224 TGAGGGAGGCCTGTGGGGGCTGG + Intronic
925870703 2:8267476-8267498 TTCGGGAAGCCTGTGGGCCCAGG + Intergenic
928018445 2:27681176-27681198 TTCCTGAGGCCTGTGGGGAAGGG + Intronic
929795132 2:45053470-45053492 TTCCAAATGCCTGAGGGGACAGG + Intergenic
930032989 2:47069604-47069626 TCCAGGAGGCCTGTGGTGATGGG + Intronic
934529753 2:95077372-95077394 TTGCGGAGGCTTGTGGGGAGGGG - Intergenic
934904133 2:98184530-98184552 TTCCTGAGTCCAGTGGTGACTGG - Intronic
938087060 2:128408644-128408666 TTCCTGAGGCCTCTGGGAACGGG + Intergenic
938383226 2:130848193-130848215 TGCAGCAGGCCTGTGGGGAGAGG + Intronic
939009404 2:136828127-136828149 TTCAGGTGGCATGTGGGGTCAGG - Intronic
942454857 2:176130585-176130607 TCCCGGAGGGCGGCGGGGACGGG - Exonic
946403456 2:219480865-219480887 TTATGGAGGGGTGTGGGGACAGG - Intronic
946517677 2:220430964-220430986 TTCCCTAGGCCTTTGTGGACTGG - Intergenic
947528693 2:230894959-230894981 TTCCAGGGCACTGTGGGGACAGG + Intergenic
948482228 2:238257406-238257428 TTCTGCAGGCCTGTGGGGAGGGG + Intronic
948696813 2:239736924-239736946 TTCCGGAGGCCGGAGGGGAGAGG - Intergenic
948710957 2:239825292-239825314 TTCCTGGGGCCTGTGGGGAGGGG + Intergenic
948856090 2:240731340-240731362 TTCCTCAAGCCTGTGGGGACAGG - Intronic
1169497596 20:6130061-6130083 TTCCAGAGACCAGTGGGAACTGG - Intergenic
1171350991 20:24503162-24503184 TTCCTGAGGACTGTGGGGGAAGG + Intronic
1171936573 20:31279980-31280002 TTCCAGAGGCCTGTGGCGAGAGG - Intergenic
1174201585 20:48809894-48809916 TTCCTGTGGCCTGTGGGCAATGG - Intronic
1174590784 20:51642968-51642990 TTGCAGAGGCCTGTGGGGGCTGG - Intronic
1175101147 20:56579696-56579718 GTCTGGAGGCCAGTGGAGACAGG - Intergenic
1175345376 20:58269137-58269159 AGCCAGAGGCCTGTGGGGGCAGG + Intergenic
1175901886 20:62363207-62363229 TTCCGGAGGCCTGTGGGGACCGG + Intronic
1175912236 20:62410501-62410523 TCCCTGAGGGGTGTGGGGACTGG - Exonic
1176121084 20:63454882-63454904 TGCCAGAGGCCTCTCGGGACGGG + Intronic
1176264732 20:64203230-64203252 CTGTGGAGGCCTGTGGGGACCGG - Intronic
1178917083 21:36711030-36711052 TTCCGGAGTGGTGTGTGGACGGG + Intronic
1179355276 21:40653043-40653065 TCCCGGAGACCTATAGGGACAGG - Intronic
1179942929 21:44651204-44651226 CTCTGGAGACCTGTGGTGACTGG - Intronic
1181140882 22:20804018-20804040 TTCCCAAGGCCTGTGGGGGAAGG - Intronic
1184325079 22:43776767-43776789 TGCCTGAAGCCTGTGTGGACTGG - Intronic
1184510881 22:44932509-44932531 GTCTGGAGGTCAGTGGGGACAGG - Intronic
1185175369 22:49323247-49323269 ATCTGGAGACCTGTGGGGTCAGG + Intergenic
950665684 3:14493499-14493521 TTCCCCAGGTCTGTGGTGACTGG - Exonic
951907775 3:27721520-27721542 TTGCGGAGGACTGGGGGGCCTGG - Exonic
954808541 3:53234097-53234119 TTGGGGAGGCCTGTGGGGTGAGG + Intronic
955217311 3:56995031-56995053 TTCCTGAGGCCTCAGGAGACTGG + Intronic
961488375 3:127233371-127233393 TTGCGGAGCCCTGAGGGGCCTGG - Intergenic
963252881 3:143119165-143119187 TTCCGGAGGGGTGTGCGGGCGGG - Intergenic
964587443 3:158322388-158322410 TTGCGGTGGGCTGGGGGGACAGG - Intronic
968466164 4:752528-752550 ATCCTGAGGCCTCCGGGGACCGG + Intronic
968489568 4:882810-882832 ACTCGGAGACCTGTGGGGACAGG + Exonic
968730987 4:2269119-2269141 TACCCGAGTCCTGTGGGCACAGG + Intergenic
969212555 4:5699010-5699032 TCCTGGAGGCCTGTAAGGACTGG - Intronic
969416324 4:7062088-7062110 TTCCGGAGGGCTAAGGGGATGGG + Intronic
969641468 4:8401607-8401629 TTCCGAAGGCCTTTGGGAAACGG - Intronic
969693756 4:8723592-8723614 TTCCCGATTCCTCTGGGGACTGG + Intergenic
975885210 4:78956897-78956919 TTCCTGAGCCTTGAGGGGACAGG + Intergenic
980512463 4:133812324-133812346 TTGTGGAGGTCTGTGGGAACAGG - Intergenic
981722581 4:147816264-147816286 TTCAGGAGTGATGTGGGGACTGG - Intronic
984765100 4:183394291-183394313 TCCCGCTGGCCTGTGGGGAGTGG - Intergenic
985169656 4:187135529-187135551 CTCAGGTGGCCTGTGGGGATTGG - Intergenic
985779481 5:1862686-1862708 TCCCGGAGGACTGTGAAGACAGG - Intergenic
986026411 5:3855104-3855126 TTAGGGAGACCTGTGTGGACAGG - Intergenic
987710267 5:21495389-21495411 TTCCAGAGGGCTGGGGTGACAGG + Intergenic
997229887 5:132234618-132234640 CCCCAGAAGCCTGTGGGGACAGG + Intronic
1001159741 5:169302059-169302081 TTCCAGATGCCAGTGGGGAGGGG + Intergenic
1002373958 5:178775202-178775224 TTCCGGAGGCCTGGGGGTGGGGG - Intergenic
1002690044 5:181044292-181044314 TTCCGGTGTCCTGTGGCCACAGG - Intronic
1002771966 6:297708-297730 TTCCTGAGGCCTGTGTGATCTGG + Intronic
1003310340 6:4964771-4964793 TTCCCAATGCCTGTGAGGACAGG + Intergenic
1003964628 6:11241546-11241568 TTCCGGAGGCCAGTGTGCGCTGG - Intronic
1006796975 6:36738018-36738040 CTCAGGAGGCCTGTGGGGCCTGG + Intergenic
1008018594 6:46549797-46549819 TTTCTGAGACCTGTGAGGACAGG - Exonic
1008649438 6:53548030-53548052 TTCCGGACGGCTCTGGGGGCGGG - Intronic
1010257786 6:73779083-73779105 TTCCCAAGGGCTGTGGGGAAGGG - Intronic
1011146381 6:84222191-84222213 TTTCGGAGGCCTTTGGTGCCTGG - Intronic
1015626170 6:135182349-135182371 GTCCAGAGGCCGGTGGAGACTGG - Intronic
1017039524 6:150296454-150296476 TGGAGGGGGCCTGTGGGGACAGG + Intergenic
1018863152 6:167726896-167726918 TTCCGGTGGCCCCTGGGGTCTGG - Intergenic
1019286659 7:226594-226616 TCTCGCAGGTCTGTGGGGACGGG + Intronic
1019324560 7:431883-431905 GTCTGGAAGCCTCTGGGGACAGG - Intergenic
1020016393 7:4834427-4834449 TTCTGGTGGCCTGTGGGGCTGGG + Intronic
1021201522 7:17733096-17733118 TTCCTGGGTCCAGTGGGGACTGG + Intergenic
1022089090 7:27096295-27096317 TCCCGGAGGCCTGGCGGGGCGGG - Intergenic
1022837633 7:34132443-34132465 ATCCGGAGGCCTTTGGGGCGTGG - Intronic
1023308481 7:38856490-38856512 TTCAGGAGGCCTCTGGGAGCTGG - Intronic
1026824118 7:73570669-73570691 TTCTGGCCTCCTGTGGGGACCGG - Exonic
1027303697 7:76869322-76869344 TGCCGAAGGCCAGTGGGGCCTGG + Intergenic
1029307614 7:99631996-99632018 TTCCAAAGGCAGGTGGGGACTGG + Exonic
1030086031 7:105816569-105816591 TCCCTGAGGGCTGTGGGGAAAGG - Intronic
1032079650 7:128852522-128852544 TTCCTGAGCCCTGTGAGGGCAGG + Intronic
1033291966 7:140093198-140093220 TTCCAGAGCCCTGAGGTGACTGG - Intronic
1034180573 7:149134331-149134353 TTTGGGAGGCCGGTGGGGAGGGG - Intronic
1035328771 7:158083095-158083117 TTCTGGAAGACTGTGGAGACAGG - Intronic
1037776477 8:21838946-21838968 TCCCGGGGGTCTGTGGGGAGGGG + Intergenic
1046224613 8:111261541-111261563 TTCCTGATGCCTTTGGTGACTGG + Intergenic
1048039458 8:130711352-130711374 GACCAGAGGCCTGTGGGGGCAGG + Intergenic
1048275495 8:133062665-133062687 TTCCTGAGGCCTGTGCAGAGCGG - Intronic
1050770869 9:9197868-9197890 TTCCTGAAGCTTGTGTGGACTGG - Intronic
1054819212 9:69505206-69505228 TTCAGGAGACCTGTGCTGACAGG + Intronic
1056750995 9:89351082-89351104 TGCCAGAGGCCTGTGTGGGCTGG - Intronic
1057132604 9:92664566-92664588 ATGGGGAGGCCTGTGGGGATAGG + Intronic
1059167621 9:112094097-112094119 TTCAGTAGGCCTTTGGGGAGGGG - Intronic
1060818943 9:126650680-126650702 TTCCTGAGGCCAGTGTGGCCGGG + Intronic
1061908096 9:133708959-133708981 TTGGGGAGGCCTGATGGGACAGG - Intronic
1062419231 9:136471564-136471586 CTCCGGAGGCCTGGGAGGACTGG - Intronic
1203759527 EBV:4915-4937 TGCCGGATGCCTGTGCCGACGGG + Intergenic
1186475079 X:9850909-9850931 TTCCGGAAGGCTGTGGTGAGAGG - Intronic
1187204752 X:17171224-17171246 TTCCAGAGGCCTCTGGGAGCTGG - Intergenic
1187741080 X:22355982-22356004 TTCCGAAGGGGTGTGGGGAGAGG + Intergenic
1191919471 X:66239202-66239224 TTTCAGAGGCCCGTGGTGACAGG + Intronic
1193036686 X:76958482-76958504 TTCCAGAGATCTGTGGAGACAGG + Intergenic
1195217181 X:102713210-102713232 TTCTGGAGGTGTGTGGGGATGGG + Exonic
1195945723 X:110209079-110209101 TTCCAAAGGCTAGTGGGGACAGG + Intronic
1196456686 X:115895963-115895985 CTCTGGAGGCCTGTGGGAAATGG - Intergenic
1201177303 Y:11316626-11316648 CTCCGGAGGGCTGTCAGGACTGG - Intergenic