ID: 1175903263

View in Genome Browser
Species Human (GRCh38)
Location 20:62368191-62368213
Sequence CCTTTGGGTGGCTGCGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175903253_1175903263 25 Left 1175903253 20:62368143-62368165 CCTGGCAAACAGCACAGGACCTA 0: 1
1: 0
2: 1
3: 11
4: 216
Right 1175903263 20:62368191-62368213 CCTTTGGGTGGCTGCGGCCCTGG 0: 1
1: 0
2: 1
3: 40
4: 293
1175903257_1175903263 -2 Left 1175903257 20:62368170-62368192 CCGAGATCAGGTCTTCGTCTGCC 0: 1
1: 0
2: 0
3: 16
4: 91
Right 1175903263 20:62368191-62368213 CCTTTGGGTGGCTGCGGCCCTGG 0: 1
1: 0
2: 1
3: 40
4: 293
1175903256_1175903263 6 Left 1175903256 20:62368162-62368184 CCTAGAGGCCGAGATCAGGTCTT 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1175903263 20:62368191-62368213 CCTTTGGGTGGCTGCGGCCCTGG 0: 1
1: 0
2: 1
3: 40
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175903263 Original CRISPR CCTTTGGGTGGCTGCGGCCC TGG Intergenic
900245295 1:1633617-1633639 TCTTTCCGTGGCTGCGGCCGAGG + Intronic
900256526 1:1700776-1700798 TCTTTCCGTGGCTGCGGCCGAGG + Intronic
900628018 1:3618337-3618359 CCTTTGGGTGAGTGGGACCCAGG - Intergenic
901829070 1:11881147-11881169 CCTGTGGGTGGCAGTGGCCCAGG + Intergenic
902140235 1:14347465-14347487 CCTTGGGGAGGCTGGGGACCCGG - Intergenic
903938618 1:26913601-26913623 CTTTGAGGTGGCTGAGGCCCCGG - Exonic
904264366 1:29309987-29310009 CTCATGGGTGGCTGTGGCCCTGG + Intronic
906099445 1:43249142-43249164 ACTTTGGGAGGCTGAGGCCGAGG - Intronic
906342723 1:44994908-44994930 TCTTTGGGAGGCTGAGGCCGGGG - Intergenic
906661613 1:47586972-47586994 ACTTTGGGTGGCTGAGGCGGGGG - Intergenic
907102676 1:51851028-51851050 CCCAAGGGTGGCTGCGGCCAGGG - Intronic
907278404 1:53329216-53329238 CCTTTGGGGGACTACGGCTCAGG - Intergenic
907581457 1:55576085-55576107 CAGTTGGGAGGCTGCTGCCCTGG + Intergenic
911909911 1:103620310-103620332 ACTTTGGGAGGCTGCGGCAGGGG + Intronic
911917333 1:103714514-103714536 ACTTTGGGAGGCTGCGGCAGGGG + Intronic
912365584 1:109131089-109131111 CTTTTGGATGACTGCAGCCCTGG - Intronic
912488579 1:110048469-110048491 CTCCTGGGTGGCTGTGGCCCCGG + Intronic
915906986 1:159886095-159886117 ACTTTGGGAGGCTGAGGCCGGGG + Intronic
916184326 1:162116115-162116137 CCTTTGTGAGGCTGAGCCCCTGG + Intronic
918334318 1:183493217-183493239 ACTTTGGGAGGCTGAGGCCAGGG - Intronic
918450462 1:184652636-184652658 CCTTTGGATGACAGCAGCCCTGG - Intergenic
918983677 1:191596153-191596175 ACTTTGGGAGGCTGAGGCCGGGG - Intergenic
921947343 1:220895039-220895061 CCTTTGTGTGGGTGTAGCCCAGG - Intergenic
922531048 1:226345562-226345584 ACTTTGGGAGGCTGAGGCCGGGG + Intergenic
922904696 1:229165079-229165101 CCCTTGGGTGGCCCCGGCCCTGG - Intergenic
923216861 1:231856605-231856627 TCTTTATGTGGCTGCGGCCCAGG + Intronic
923279582 1:232430258-232430280 CCTTTGGGAGGGTGCTGGCCAGG + Intronic
923793586 1:237132320-237132342 CCTTTAGGTGGTTGCAGTCCTGG + Intronic
924004394 1:239591913-239591935 CATTTGGTTGGCTTAGGCCCAGG + Intronic
924940409 1:248809535-248809557 CCTTTGGATGGGTGCTGTCCAGG - Intergenic
1064310461 10:14207954-14207976 ACTTTGGGAGGCTGAGGCCAGGG + Intronic
1064478826 10:15719783-15719805 CCGGTGGGTGGCTGCTACCCAGG + Exonic
1067527984 10:47049754-47049776 CCTGAAGGTGGCTGGGGCCCAGG + Intergenic
1070509874 10:77151334-77151356 ACTTGGGGAGGCTGAGGCCCGGG - Intronic
1070619980 10:78001892-78001914 ACTTTGGGAGGCTGAGGCCGAGG - Intronic
1071545809 10:86528370-86528392 TCTTTGGGTGGCTGCAGGTCAGG - Intergenic
1072653279 10:97312231-97312253 ACTTTGGGAGGCTGAGGCCGGGG - Intergenic
1073413696 10:103363986-103364008 ACTTTGGGAGGCTGAGGCCGGGG - Intergenic
1073510445 10:104039453-104039475 CCTTTGGGTCCCTGGGGGCCAGG + Exonic
1076481788 10:130789518-130789540 GCTTTGGGTGGCTAGGGACCTGG - Intergenic
1076936134 10:133568298-133568320 CCTGCGCGTGGCTGCGGCCGGGG - Intronic
1077239511 11:1503203-1503225 CCCATGTCTGGCTGCGGCCCAGG - Intergenic
1077354315 11:2108120-2108142 CCTTCAGATGGCTGGGGCCCAGG - Intergenic
1078558838 11:12353381-12353403 CCTTTGGATGGCTTCTTCCCTGG + Intronic
1079245611 11:18750116-18750138 CCCTTGGCTGGCTGTGGACCTGG - Intronic
1081617994 11:44601747-44601769 CCTTGGGGTGGGTGGGGCTCGGG - Intronic
1081720973 11:45288017-45288039 CCATGGGGTGGCTGAGGCTCAGG - Intergenic
1083396306 11:62395020-62395042 CCTTTGGGCGGCTGAAGCCATGG - Intergenic
1083755172 11:64788356-64788378 CCTTTGGGCAGCTGCAGCCCAGG - Intergenic
1083918223 11:65764087-65764109 ACTTTGGGAGGCTGAGGCCGGGG - Intergenic
1083962436 11:66021750-66021772 AATTTGGGTGGGTGCGGCCGGGG - Exonic
1084465622 11:69321326-69321348 CCTCAGGGTGGCCGCAGCCCTGG + Intronic
1084891685 11:72239918-72239940 CCCTTGAGCGGCTGTGGCCCCGG + Exonic
1087750877 11:102005635-102005657 CCTGTGGGATGCTGCAGCCCAGG - Intergenic
1088184076 11:107144136-107144158 CCTTTGGGTGGCCTCAGCACAGG - Intergenic
1088700300 11:112405592-112405614 CCTTCAGGTGACTGCAGCCCTGG - Intergenic
1089850870 11:121495338-121495360 ACTTTGGGAGGCTGAGGCCAGGG - Intronic
1092394231 12:8111114-8111136 CCTTTGGGAGGCTGAGGCAGTGG - Intergenic
1093028184 12:14263597-14263619 ACTTTGGGTGGCTGAGGCGGGGG + Intergenic
1095894112 12:47263450-47263472 CCTTTGGGAGGCTGAGGCAGGGG - Intergenic
1096047070 12:48571633-48571655 ACTTTGGGAGGCCGAGGCCCAGG - Intergenic
1096409254 12:51365348-51365370 CCTTGGGGAGGCTGTGGCCCTGG + Intronic
1096499635 12:52056879-52056901 CCTTTTGGCAGCTGCAGCCCTGG + Intronic
1096731561 12:53617248-53617270 ACTTTGGGAGGCTTGGGCCCAGG - Intronic
1097888783 12:64756908-64756930 ACTTTGGGAGGCTGAGGTCCAGG + Intronic
1098973564 12:76879248-76879270 CCTTTGGGAGGGAGCGGTCCCGG - Intergenic
1100479031 12:94960175-94960197 ACTTTGGGAGGCTGAGGCCGTGG - Intronic
1101754781 12:107613001-107613023 CCTTTTAGTTGCTGTGGCCCTGG + Intronic
1101858624 12:108464567-108464589 TCCTTGGGTGTCTGGGGCCCGGG - Intergenic
1103689461 12:122759468-122759490 ACTTTGGGAGGCTGAGGCCAAGG + Intronic
1104087620 12:125491047-125491069 CCTTTGGATGACTGCAGCCCTGG + Intronic
1104687294 12:130795503-130795525 ACTTTGGGAGGCTGAGGGCCAGG + Intronic
1104690430 12:130821620-130821642 CCTCTGGCTGTCTGCGGCACAGG - Intronic
1104869761 12:131986598-131986620 CCTGTGAGTGGCTCCGGCCCAGG + Exonic
1104931513 12:132341687-132341709 CCTGTGGGTGGCTGAGACCCCGG + Intergenic
1105011904 12:132761807-132761829 CTTCTCGGCGGCTGCGGCCCGGG - Exonic
1105013254 12:132769988-132770010 ACTTTGGGAGGCTGAGGCTCAGG + Exonic
1106736948 13:32597579-32597601 ACTTTGGGAGGCTGAGGCCGAGG + Intronic
1107800981 13:44107744-44107766 CCTGTGGGGTGCTGCTGCCCTGG + Intergenic
1108487701 13:50943774-50943796 CCTTTGCCTGGCTGTGTCCCTGG - Intronic
1108766136 13:53631654-53631676 CCTTGAGGTGACTGCAGCCCAGG - Intergenic
1110224388 13:73104670-73104692 ACTTTTGGAGGCTGAGGCCCCGG + Intergenic
1112705154 13:102060279-102060301 ACTTTGGGAGGCTGAGGCCGGGG + Intronic
1113585078 13:111459269-111459291 CCTCAGGCTGGCTGCGGCCCTGG - Intergenic
1114631666 14:24163250-24163272 CCCTTGGGGGGCTGCAACCCAGG + Intronic
1114724008 14:24914602-24914624 CCTGTGAGGGGCTGCGGCCCTGG - Intronic
1115501887 14:34057509-34057531 CCTGTGTGTGGGTGGGGCCCGGG + Intronic
1116510253 14:45736410-45736432 ACTTTGGGAGGCTGAGGCCCAGG + Intergenic
1117295475 14:54375204-54375226 ACTTTGGGAGGCTGAGGCTCAGG + Intergenic
1122051276 14:99062019-99062041 GCTTTGGGGGTCTGGGGCCCTGG + Intergenic
1122319060 14:100842478-100842500 CCTTTGTGAGGCCGGGGCCCTGG - Intergenic
1122882626 14:104696926-104696948 CCTGTGGGGGGCTGCTGCCTGGG - Intronic
1123651984 15:22483587-22483609 CGTTTGCGTGGTTGCGCCCCAGG - Intergenic
1123742404 15:23292447-23292469 CGTTTGCGTGGTTGCGCCCCAGG - Intergenic
1123760921 15:23432039-23432061 CGTTTGCGTGGTTGCGCCCCAGG + Intergenic
1123982467 15:25616424-25616446 CCTCTGGATGACTGCAGCCCTGG - Intergenic
1124190663 15:27573967-27573989 CTTTAGGCTGGCTGCGTCCCAGG - Intergenic
1124276855 15:28333428-28333450 CGTTTGCGTGGTTGCGCCCCAGG + Intergenic
1124305845 15:28578178-28578200 CGTTTGCGTGGTTGCGCCCCAGG - Intergenic
1124905331 15:33862859-33862881 ACTTTGGGAGGCTGAGGCCAAGG - Intronic
1128075674 15:64823951-64823973 CCTCAAGCTGGCTGCGGCCCCGG - Exonic
1129411747 15:75354256-75354278 CCTTTGGGTGCCAACGGTCCAGG - Exonic
1129422496 15:75440338-75440360 GCTTTGGGAGGCTGAGGCACAGG - Intronic
1129817122 15:78565275-78565297 CCTTTGGGCAGGTGCGACCCTGG - Intergenic
1130017915 15:80201715-80201737 TCTGTGGGTGGCTGTGCCCCAGG - Intergenic
1131476238 15:92742544-92742566 ACTTTGGGTGGCTGAGGCCAGGG + Intronic
1131716891 15:95121421-95121443 CCTTGAGGTGACTGCTGCCCAGG - Intergenic
1132311308 15:100859939-100859961 CCTTCGGATGCCTGCAGCCCTGG + Intergenic
1132632806 16:928078-928100 CCTGTGTGGGGCCGCGGCCCAGG - Intronic
1132666391 16:1083054-1083076 CCTGTGGGTGGCAGGGGCCGCGG + Intergenic
1132973640 16:2701017-2701039 CCTTGGTGGGGCTGGGGCCCTGG + Intronic
1133168665 16:3966440-3966462 CCTGCGGGTGGCTGCCGTCCTGG + Exonic
1133513225 16:6481284-6481306 CCTTTGGGTGGCTGCAGACATGG + Intronic
1133811595 16:9165059-9165081 ACTTTGGGAGGCTGAGGCCGAGG + Intergenic
1134099672 16:11443077-11443099 ACTTTGGGAGGCTGAGGCCGGGG + Intronic
1134478448 16:14596488-14596510 ACTTTGGGAGGCTGAGGCGCGGG + Intronic
1134485320 16:14653570-14653592 ACTTTGGGAGGCTGAGGCACAGG - Intronic
1135919348 16:26634618-26634640 CCTCTGGATGGCTGGGGCCATGG - Intergenic
1137598023 16:49737768-49737790 CCCTTGGGAGGGTGAGGCCCTGG - Intronic
1138016624 16:53434493-53434515 CGTTTGAATGGCTGCGGGCCCGG + Exonic
1138503384 16:57462952-57462974 GCTTTGGGAGCCTGCGGCGCGGG + Intronic
1141011144 16:80400869-80400891 ACTTTGGGAGGCTGCGGCCGGGG - Intergenic
1141771767 16:86093963-86093985 CCTTTGGGTGCCTGTGGCCTGGG + Intergenic
1142213174 16:88817950-88817972 CGGGTGGGTGGCTGCAGCCCCGG + Intronic
1142589720 17:997400-997422 CCCTTGGGAGGCTGAGGGCCTGG + Intronic
1143225026 17:5294151-5294173 CCTTTGGGAGGCTGAGGCGGGGG + Intronic
1143373499 17:6454600-6454622 CCCTTGGGAGGCTGCAGCCTTGG - Exonic
1143858353 17:9869538-9869560 CCTTCAGATGGCTGCGGCCCTGG - Intronic
1144645725 17:16972214-16972236 CAGGTGGGTGGCTGCGGCCCAGG + Intergenic
1145203728 17:20969367-20969389 CAGGTGGGTGGCCGCGGCCCAGG - Intergenic
1145874563 17:28307155-28307177 CCTTTGGGTGGCAGCGGGAGTGG + Intergenic
1146260104 17:31415405-31415427 CCTTGGAGTGGGTGTGGCCCTGG - Intronic
1146367876 17:32243592-32243614 CCTTCAGGTGACTGCAGCCCTGG - Intronic
1146652735 17:34616526-34616548 CCTCTGGGTGACTGCAGCCTGGG - Intronic
1147720498 17:42536704-42536726 GATTTGGGTGGCAGCGGCTCCGG - Intronic
1147931690 17:43985454-43985476 ACTTTGGGAGGCTGAGGCCGAGG - Intronic
1148102971 17:45103947-45103969 CCCATGGGAGGCTGCGTCCCGGG - Intronic
1148830001 17:50425421-50425443 CCTTAGGGTTCCTGAGGCCCAGG - Intergenic
1151302431 17:73237185-73237207 ACTTTGGGAGGCTGAGGCCAAGG + Intronic
1151313508 17:73308687-73308709 CCTTGGGTTGGCAGTGGCCCAGG - Intronic
1152151693 17:78605137-78605159 ACTTTGGGAGGCTGAGGCCGGGG - Intergenic
1152337463 17:79706799-79706821 TGTGTGGGTGGCTGTGGCCCAGG - Intergenic
1152643695 17:81459399-81459421 CCTGGGAGTGGCTGCGGCCCAGG - Intronic
1152781439 17:82228891-82228913 CCGTCGGGGAGCTGCGGCCCGGG + Intronic
1152855335 17:82662458-82662480 CTTCAGGGTGGCAGCGGCCCAGG - Intronic
1153964990 18:10171539-10171561 ACTTTGGGAGGCTGAGGCCGAGG + Intergenic
1158475839 18:57778607-57778629 CCTTTAGGTGACTGCAGCTCTGG - Intronic
1158918405 18:62160751-62160773 ACTTTGGGAGGCTGAGGCACAGG - Intronic
1160020147 18:75173953-75173975 TCTCTGGGAGGCTGCTGCCCAGG - Intergenic
1160841349 19:1148184-1148206 CCTTGGGTTGGAGGCGGCCCTGG + Intronic
1160961907 19:1725833-1725855 CCATTGGCTGGCGGCGGCCCGGG + Intergenic
1161736563 19:5995365-5995387 CCTCTGGGTAGCCGCTGCCCAGG - Intronic
1162801860 19:13115763-13115785 CCTCTGGGTGGCTGCAGTCAAGG - Exonic
1163732764 19:18959450-18959472 ACTTTGGGAGGCTGGGGCCAGGG + Intergenic
1164721945 19:30438906-30438928 ACTTTGGGAGGCTGAGCCCCAGG - Intronic
1164786449 19:30934913-30934935 ACTTTGGGGAGCTGTGGCCCGGG - Intergenic
1165190816 19:34061943-34061965 GCTTTGGGAGTCTGGGGCCCTGG + Intergenic
1165767083 19:38358352-38358374 CCTCAGGGTGGCTGTGGGCCAGG + Intronic
1166087495 19:40486750-40486772 ACTTTGGGAGGCTGAGGCCATGG + Intronic
1166323396 19:42033888-42033910 TATTTGGGTGGCTGAGGCACAGG + Intronic
1167151016 19:47709745-47709767 CCTCTGGGTGGCGGGGACCCAGG + Intergenic
1167730687 19:51252051-51252073 ACTTTGGGAGGCTGAGGCCGGGG + Intronic
1167800287 19:51736204-51736226 ACTGTGGGTGCCTGCAGCCCAGG - Intergenic
926044858 2:9703137-9703159 CCTCTGAGTGCCTGGGGCCCTGG - Intergenic
927062824 2:19440550-19440572 CCTTTGGGTGGGTGTGGGCAGGG - Intergenic
927953184 2:27188245-27188267 ACTTTGGGAGGCTGAGGCCACGG + Intergenic
929952794 2:46429078-46429100 CCTTTGAGTGGCAGCTGCCGTGG + Intergenic
931771604 2:65502434-65502456 ACTTTGGGAGGCTGAGGCCGAGG + Intergenic
932093239 2:68825157-68825179 CCTTTGGGGAGCTGTGGTCCTGG - Intronic
934076421 2:88432295-88432317 ACTTTGGGAGGCTGAGGCCGGGG + Intergenic
935864961 2:107377183-107377205 CCTTCAGATGGCTGCAGCCCTGG + Intergenic
937000891 2:118466634-118466656 CCTTTGGGTGGAGGTGGGCCCGG + Intergenic
937437035 2:121889288-121889310 CCTTTGGGAGGCTGAGACCCGGG + Intergenic
938055553 2:128212075-128212097 CCTTTGGGAGGCTGAGGCAGGGG - Intergenic
938676559 2:133641630-133641652 CCTGAGGGTGGCTCCTGCCCTGG - Intergenic
939698885 2:145363918-145363940 ACTTTGGGAGGCTGAGGCCGGGG + Intergenic
941102436 2:161311060-161311082 ACTTTGGGAGGCTGAGGCTCAGG + Intronic
942449305 2:176099180-176099202 CCTTTTTGTGTCTGCGGCCTGGG + Intergenic
942458147 2:176151814-176151836 CCTTTCGGAGGCAGCGGCCCCGG + Exonic
943679785 2:190756160-190756182 CCTTCGGATGACTGCAGCCCTGG - Intergenic
943754170 2:191540865-191540887 ACTGTGGGTGGCTGAGGGCCAGG + Intergenic
946095395 2:217270204-217270226 CCTTTGGCTGCCTCCTGCCCTGG + Intergenic
946225832 2:218263593-218263615 CCTTTGGGCGGCTGCCCTCCAGG - Exonic
1168784440 20:525726-525748 ACTTTGGGAGGCTGAGGCCAAGG + Intronic
1168872095 20:1138411-1138433 CATTTGGGAGGCTGAGGCACAGG + Intronic
1171307197 20:24116797-24116819 CCTTGGATTGGCTGCGGGCCAGG - Intergenic
1173479803 20:43390011-43390033 CCTGTGGGTGGCTGTGGCTGTGG - Intergenic
1173689327 20:44947745-44947767 ACTTTGGGAGGCTGAGGCTCCGG - Intronic
1173790223 20:45823436-45823458 CCTCTGTGTGGCTGGAGCCCTGG - Intronic
1174366351 20:50058904-50058926 CCTTTGGGAGGCCGCTGCCCAGG + Intergenic
1175838312 20:62010612-62010634 CCTATGGGAGGCTGCGGCTGTGG - Intronic
1175903263 20:62368191-62368213 CCTTTGGGTGGCTGCGGCCCTGG + Intergenic
1175997456 20:62817952-62817974 CCTTTGGGTGGTTGGGGGCCGGG + Intronic
1176098134 20:63353496-63353518 CCTAGGGGGGGCTGCGGTCCTGG + Intronic
1176098301 20:63353947-63353969 CCTCGGGGGGGCTGCGGTCCTGG + Intronic
1176143216 20:63554100-63554122 CCTTTGTGACGCTGCGGCCCGGG - Exonic
1176231882 20:64037048-64037070 CTTTTGGGTGGCTGGGAACCTGG + Intronic
1178078370 21:29034559-29034581 ACTTTGGGAGGCTGAGGCCAGGG - Intronic
1180077006 21:45468072-45468094 CCGTTGGGTGGCTGAGCCCAGGG + Intronic
1180732487 22:17992624-17992646 CCTGAGGGTGGTTGAGGCCCAGG + Intronic
1182574790 22:31265970-31265992 CCTTTGGGGAGCTGGGGCCAGGG - Exonic
1182619500 22:31611137-31611159 CCTTAGGCTGTCTGCGGACCTGG + Exonic
1183070386 22:35391978-35392000 ACTTTGGGAGGCTGAGGCACGGG + Intronic
1183423040 22:37723425-37723447 CTGTTGGGTGGATGAGGCCCTGG - Exonic
1183423048 22:37723455-37723477 CTGTTGGGTGGATGAGGCCCTGG - Exonic
1183423057 22:37723485-37723507 CTCTTGGGTGGATGAGGCCCTGG - Exonic
1183733054 22:39629050-39629072 CCTCTGCCTGGCTGCTGCCCAGG + Intronic
1184738780 22:46414926-46414948 CCTTTCGGTGGCTGCGATTCCGG - Intronic
1184790262 22:46695781-46695803 ACTTTGGGTGGCAGCGGCCCTGG - Intronic
1185268091 22:49915261-49915283 TCTTTGGGAGGCTGAGGGCCAGG + Intronic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
949561337 3:5205560-5205582 CCTTAGCATGGCTGTGGCCCTGG - Intronic
950261668 3:11546695-11546717 CCTTTGGGTGTGTGTGGTCCAGG + Intronic
952102978 3:30036297-30036319 CCTTTAAGTGACTGCAGCCCTGG - Intergenic
953061057 3:39429188-39429210 CCAGTGGGTGGCAGAGGCCCAGG - Intergenic
953693351 3:45138596-45138618 ACTTTGGGAGGCTGAGGCCGAGG + Intronic
954454226 3:50588428-50588450 CCTCTGGGGGGTTGAGGCCCTGG - Intergenic
954458381 3:50612102-50612124 CCTCTGGGTAGCTTCAGCCCCGG - Exonic
954655087 3:52189714-52189736 ACTTTGGGAGGCCGAGGCCCTGG - Intergenic
954810093 3:53242232-53242254 ACGTGGGGTGGCTGTGGCCCAGG + Exonic
955703494 3:61705105-61705127 GCTTTGGGTGGCTGAGCCCCAGG + Intronic
956717659 3:72092559-72092581 TCTGTGGCTGGCAGCGGCCCTGG + Intergenic
960726413 3:120674806-120674828 GCTCTGGGAGGCTGTGGCCCAGG + Intronic
961016392 3:123471448-123471470 CCTTAAGGTGGCTGCAGCCTTGG + Intergenic
963827286 3:149970200-149970222 GCTGTGGGAGGCGGCGGCCCCGG - Intronic
965617203 3:170606817-170606839 CCTTGGGATGACTGCAGCCCTGG - Intronic
966744794 3:183265275-183265297 CCTTTGTGTGCCTGCAGCACGGG - Intronic
968470382 4:779185-779207 ACTTTGGGAGGCTGAGGCCGAGG - Intergenic
968520255 4:1031886-1031908 CCTTTTGTCGGCTGTGGCCCTGG - Intergenic
970588432 4:17536967-17536989 ACTTTGGGAGGCTGAGGCTCAGG + Intergenic
970768145 4:19576337-19576359 CCTTTGGGAGGCTGAGGCAGGGG + Intergenic
972010783 4:34178614-34178636 CCTTTGGATGCCTGTGGCTCTGG + Intergenic
972295498 4:37734014-37734036 ACTTTGGGAGGCTGAGGCCAAGG - Intergenic
973628209 4:52793486-52793508 CCTTTGGATGACTGCAGCCCCGG + Intergenic
975329967 4:73101417-73101439 ACTTTGGGTGGCTGAGGCAGGGG + Intronic
978737626 4:112102089-112102111 GCTTTGGGTGTCTGCAGGCCAGG + Intergenic
980721207 4:136697624-136697646 CCTTTGGGAGGCTGAGGCAGGGG + Intergenic
982779870 4:159479682-159479704 ACTTTGGATGACTGCGGTCCTGG + Intergenic
983525236 4:168753800-168753822 CCTTTAGCTGACTGCGGCCTTGG + Intronic
985805105 5:2037970-2037992 ACTTTGGGAGGCCGCGGCCGCGG - Intergenic
986132367 5:4943094-4943116 CCTATGGGTGCCTGGCGCCCTGG - Intergenic
987602613 5:20091239-20091261 CCTTTGAGAGGCTGAGTCCCAGG + Intronic
987728622 5:21737307-21737329 CCTTTGGGAGGCTGAGGCAGAGG - Intergenic
990359512 5:55004347-55004369 CCTTTGTGTGGTTGTTGCCCGGG - Intronic
992883128 5:81130456-81130478 CCTCTGAGTGGCTGAGCCCCAGG - Intronic
996775766 5:127130874-127130896 ACTTTGGGAGGCTGAGGCCGAGG - Intergenic
997949711 5:138232516-138232538 CCTTTGGGAGGCTGAGGCTGGGG + Intergenic
998631613 5:143904759-143904781 ACTTTGGGAGGCTGAGGCCGAGG - Intergenic
1000045574 5:157519390-157519412 ACTTTGGGAGGCTGGGGCACGGG - Intronic
1001048782 5:168397385-168397407 CCTTTGGGAGGCTGAGGCAGGGG - Intronic
1002960901 6:1914210-1914232 ACTTTGGGAGGCTGAGGCCGGGG + Intronic
1005778106 6:29159981-29160003 CATTTGAGTGGCTGCGGGCGTGG + Intergenic
1005778755 6:29165898-29165920 CATTTGAGTGGCTGCGGGCGTGG - Intergenic
1006845044 6:37056129-37056151 CCTGTGGGTGGCTGAGGGCCGGG - Intergenic
1006913902 6:37582440-37582462 CCTTTCAGAGGCTCCGGCCCAGG - Intergenic
1010236560 6:73579675-73579697 CCTTGGGGTGGGTGTGGACCTGG + Intergenic
1010736505 6:79450027-79450049 CCTTTGGGAGGCTGAGGCTGAGG - Intergenic
1011487088 6:87853921-87853943 ACTTTGGGTGGCTGAGGCAGTGG - Intergenic
1011627404 6:89294616-89294638 ACTTTGGGTGGGTTGGGCCCAGG + Intronic
1015838621 6:137450928-137450950 ACTTTGGGAGGCTGAGGCCCAGG + Intergenic
1015838778 6:137453316-137453338 ACTTTGGGAGGCTGAGGCCCAGG + Intergenic
1020121440 7:5506186-5506208 CCTTTGGGAGGCTGGAGCCCAGG - Intronic
1020198361 7:6059648-6059670 CCTTTGGGAGGCTGAGGCGGTGG + Intergenic
1020517304 7:9139066-9139088 ACTTTGGGAGGCTGAGGCCAGGG + Intergenic
1022090321 7:27103756-27103778 TCTTTGGCTGGCCGCCGCCCTGG - Intergenic
1022422618 7:30238166-30238188 CCTTTGGATGACTGCAGCCCTGG + Intergenic
1023856165 7:44185622-44185644 CCTTTGGCTTGCTCCTGCCCTGG + Intronic
1023914688 7:44580232-44580254 ACTTTGGGAGGCTGCGGCAGTGG + Intronic
1026493906 7:70886696-70886718 ACTTTGGGAGGCTGAGGCCAGGG - Intergenic
1028111793 7:86950059-86950081 CCTCTGGCTGGCTGAGGCCCAGG + Intronic
1029516094 7:101024154-101024176 CCTTTGGGAGGCTGAGGCGGTGG + Intronic
1029607281 7:101606554-101606576 CCTTGGGTTTGCTGCTGCCCTGG + Intergenic
1030928040 7:115481748-115481770 AATTTGGTTGGCTGCAGCCCAGG - Intergenic
1031918165 7:127582459-127582481 CCTGTGGGTGGTGGCGGTCCTGG - Exonic
1032259223 7:130321508-130321530 CCTTAGGTTGACTGAGGCCCTGG - Intronic
1032528574 7:132600615-132600637 ACTTTGGGAGGCTGAGGCCAGGG - Intronic
1032669447 7:134069714-134069736 GCTTTGGGAGGCTGAGCCCCAGG - Intergenic
1033140029 7:138817714-138817736 ACTTTGGGTGGCTGAGGCGGGGG + Intronic
1033237664 7:139650878-139650900 CCCTTGGGTGACTGCAGCCTGGG + Intronic
1033306113 7:140226997-140227019 CCATGGGCTGTCTGCGGCCCAGG - Intergenic
1034446253 7:151115598-151115620 CCGTCGGGCGGCTGCGGCCCCGG + Intronic
1034533274 7:151710600-151710622 ACTTTGGGTGGCTGCGCCCTGGG - Intronic
1034630917 7:152529986-152530008 ACTTTGGGAGGCTGAGGCCAGGG - Intergenic
1035324521 7:158056295-158056317 CCTCTGTGTGGATGAGGCCCCGG - Intronic
1035769565 8:2136223-2136245 CCTTTGTGCAGCTGCAGCCCAGG + Intronic
1036415308 8:8541411-8541433 ACTTTGGGTGGCTACTGCACTGG - Intergenic
1038362721 8:26898505-26898527 CTTCTGGGTGGCTGCAGCCTGGG + Intergenic
1038482245 8:27909725-27909747 CCTTTGGGTCCCGGTGGCCCTGG + Exonic
1038496619 8:28007849-28007871 CCTGTGTGTGGCTGCAGACCTGG + Intergenic
1038513329 8:28161327-28161349 CCTTTGGGAGGCTGAGGCAGGGG + Intronic
1038563735 8:28602145-28602167 ACTTTGGGAGGCTGAGGCCGGGG + Intronic
1038592607 8:28853963-28853985 ACTTTGGGAGGCTGAGGCGCGGG - Intronic
1039697298 8:39926449-39926471 GCTCTGGGTGGCTGGGGCCACGG - Intronic
1042005275 8:64172770-64172792 CATATGGGTGGCTGCAGCCCAGG - Intergenic
1042126041 8:65538071-65538093 CTCTTGGGTTGCTGCAGCCCAGG - Intergenic
1042423427 8:68619081-68619103 ACTTTGGGAGGCTGAGGCCTGGG + Intronic
1042564067 8:70095313-70095335 ACTTTGGGAGGCTGAGGCGCAGG + Intergenic
1045107348 8:98905682-98905704 CCTCTGGGTGGCAGCGGCGGAGG + Intronic
1048766377 8:137848688-137848710 ACTTTGGGAGGCTGAGGCGCGGG + Intergenic
1049232031 8:141489432-141489454 CCTCTGTGTGGCTGGGGGCCTGG + Intergenic
1049488462 8:142878613-142878635 CCTGAGGGAGGCTGCGGCCCCGG + Intronic
1049493358 8:142916633-142916655 CCTGAGGGAGGCTGTGGCCCCGG + Intronic
1049622414 8:143604684-143604706 CCTTTGGGTGGGGAGGGCCCGGG - Exonic
1049740994 8:144240795-144240817 CCTTGTGGTGGCTGAGGGCCAGG + Intronic
1051543746 9:18250642-18250664 GCTGTGGATGGCTGGGGCCCTGG + Intergenic
1052443153 9:28524508-28524530 ACTTTGGGAGGCTGAGGCCGGGG + Intronic
1053091687 9:35284013-35284035 ACTTTGGGAGGCTGAGGCCGGGG + Intronic
1053475114 9:38377177-38377199 GCTTCGGGTGGCTGCAGCCCTGG - Intergenic
1056756631 9:89385832-89385854 CCTTTAGGGGGCTGCCTCCCTGG - Intronic
1057288096 9:93777038-93777060 CCTTTGGGTGGCAGCGGGTGTGG + Intergenic
1057700880 9:97362341-97362363 CCTTTGGGTGACGAGGGCCCAGG - Exonic
1058738949 9:107923403-107923425 CCTTTGGGTGACTGATGCTCTGG + Intergenic
1059420460 9:114187293-114187315 TCCTTGGGTGGCTGAGGCCCAGG - Intronic
1060888776 9:127175112-127175134 CCTTAGCGGGGCTGCTGCCCAGG + Intronic
1061090629 9:128424081-128424103 TCCTTGGGGGGCTGCAGCCCAGG + Intronic
1061243041 9:129385312-129385334 CCTTTCGGGGGCTGGTGCCCAGG - Intergenic
1061550033 9:131329057-131329079 CCTTTGGTTGGCCACTGCCCTGG + Intergenic
1062052795 9:134456192-134456214 CCTTCCGGCCGCTGCGGCCCTGG - Intergenic
1187230208 X:17414684-17414706 CCACTGGGTGGCTGAGACCCTGG + Intronic
1187413760 X:19074479-19074501 ACTTTGGGAGGCTGAGGCCCAGG - Intronic
1189286845 X:39857840-39857862 GCTTTGGGTGGCTGCAGTCAGGG + Intergenic
1189306839 X:39993231-39993253 ACTTTGGGTGGCTGAGGCAGGGG + Intergenic
1189349705 X:40267306-40267328 CCTTTGGCTGGCTCCGGGCTAGG + Intergenic
1189683193 X:43537442-43537464 ACTTTGGGAGGCCGAGGCCCAGG - Intergenic
1190319888 X:49173817-49173839 ACTTTGGGAGGCTGAGGCCGAGG + Intronic
1190462608 X:50693320-50693342 ACTTTGGGAGGCTGCGGCAGGGG + Intronic
1192034113 X:67545254-67545276 CCTCTGGGTGCCTGGGGCCCGGG - Exonic
1198339942 X:135703830-135703852 CCTTTGGGAGGCTGAGGCAGGGG - Intergenic
1198343420 X:135736676-135736698 CCTTTGGGAGGCTGAGGCAGGGG - Intergenic
1198833085 X:140771922-140771944 ACTTTGGGTGGCTGAGGCAGGGG - Intergenic
1199673666 X:150166702-150166724 CAGATGGGTGGCTGAGGCCCTGG + Intergenic
1200256765 X:154586439-154586461 CCCTCGGGTGGCGGCGGGCCTGG - Intronic
1200261004 X:154617964-154617986 CCCTCGGGTGGCGGCGGGCCTGG + Intronic
1200267046 X:154652332-154652354 CCCTCGGGTGGCGGCGGGCCTGG + Exonic
1200809438 Y:7467443-7467465 ACTTTGGGAGGCTGAGGCTCAGG + Intergenic