ID: 1175903329

View in Genome Browser
Species Human (GRCh38)
Location 20:62368390-62368412
Sequence CCAGCCCCCCGGGACTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175903329_1175903344 16 Left 1175903329 20:62368390-62368412 CCTGGACAGTCCCGGGGGGCTGG No data
Right 1175903344 20:62368429-62368451 CTGGCCAGCCGGTTCTGGTGGGG No data
1175903329_1175903342 14 Left 1175903329 20:62368390-62368412 CCTGGACAGTCCCGGGGGGCTGG No data
Right 1175903342 20:62368427-62368449 CACTGGCCAGCCGGTTCTGGTGG No data
1175903329_1175903340 5 Left 1175903329 20:62368390-62368412 CCTGGACAGTCCCGGGGGGCTGG No data
Right 1175903340 20:62368418-62368440 TTTGTGGGGCACTGGCCAGCCGG No data
1175903329_1175903338 -9 Left 1175903329 20:62368390-62368412 CCTGGACAGTCCCGGGGGGCTGG No data
Right 1175903338 20:62368404-62368426 GGGGGCTGGGTGGGTTTGTGGGG No data
1175903329_1175903337 -10 Left 1175903329 20:62368390-62368412 CCTGGACAGTCCCGGGGGGCTGG No data
Right 1175903337 20:62368403-62368425 GGGGGGCTGGGTGGGTTTGTGGG No data
1175903329_1175903339 -3 Left 1175903329 20:62368390-62368412 CCTGGACAGTCCCGGGGGGCTGG No data
Right 1175903339 20:62368410-62368432 TGGGTGGGTTTGTGGGGCACTGG No data
1175903329_1175903343 15 Left 1175903329 20:62368390-62368412 CCTGGACAGTCCCGGGGGGCTGG No data
Right 1175903343 20:62368428-62368450 ACTGGCCAGCCGGTTCTGGTGGG No data
1175903329_1175903345 17 Left 1175903329 20:62368390-62368412 CCTGGACAGTCCCGGGGGGCTGG No data
Right 1175903345 20:62368430-62368452 TGGCCAGCCGGTTCTGGTGGGGG No data
1175903329_1175903341 11 Left 1175903329 20:62368390-62368412 CCTGGACAGTCCCGGGGGGCTGG No data
Right 1175903341 20:62368424-62368446 GGGCACTGGCCAGCCGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175903329 Original CRISPR CCAGCCCCCCGGGACTGTCC AGG (reversed) Intergenic