ID: 1175903335

View in Genome Browser
Species Human (GRCh38)
Location 20:62368401-62368423
Sequence CACAAACCCACCCAGCCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175903335_1175903344 5 Left 1175903335 20:62368401-62368423 CCGGGGGGCTGGGTGGGTTTGTG No data
Right 1175903344 20:62368429-62368451 CTGGCCAGCCGGTTCTGGTGGGG No data
1175903335_1175903340 -6 Left 1175903335 20:62368401-62368423 CCGGGGGGCTGGGTGGGTTTGTG No data
Right 1175903340 20:62368418-62368440 TTTGTGGGGCACTGGCCAGCCGG No data
1175903335_1175903342 3 Left 1175903335 20:62368401-62368423 CCGGGGGGCTGGGTGGGTTTGTG No data
Right 1175903342 20:62368427-62368449 CACTGGCCAGCCGGTTCTGGTGG No data
1175903335_1175903348 30 Left 1175903335 20:62368401-62368423 CCGGGGGGCTGGGTGGGTTTGTG No data
Right 1175903348 20:62368454-62368476 TCTGAGCTAGCAGCTGTCCCTGG No data
1175903335_1175903341 0 Left 1175903335 20:62368401-62368423 CCGGGGGGCTGGGTGGGTTTGTG No data
Right 1175903341 20:62368424-62368446 GGGCACTGGCCAGCCGGTTCTGG No data
1175903335_1175903343 4 Left 1175903335 20:62368401-62368423 CCGGGGGGCTGGGTGGGTTTGTG No data
Right 1175903343 20:62368428-62368450 ACTGGCCAGCCGGTTCTGGTGGG No data
1175903335_1175903345 6 Left 1175903335 20:62368401-62368423 CCGGGGGGCTGGGTGGGTTTGTG No data
Right 1175903345 20:62368430-62368452 TGGCCAGCCGGTTCTGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175903335 Original CRISPR CACAAACCCACCCAGCCCCC CGG (reversed) Intergenic