ID: 1175903338

View in Genome Browser
Species Human (GRCh38)
Location 20:62368404-62368426
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175903328_1175903338 -8 Left 1175903328 20:62368389-62368411 CCCTGGACAGTCCCGGGGGGCTG No data
Right 1175903338 20:62368404-62368426 GGGGGCTGGGTGGGTTTGTGGGG No data
1175903319_1175903338 27 Left 1175903319 20:62368354-62368376 CCAGATGGGCTGTGGGGCTCATC No data
Right 1175903338 20:62368404-62368426 GGGGGCTGGGTGGGTTTGTGGGG No data
1175903318_1175903338 28 Left 1175903318 20:62368353-62368375 CCCAGATGGGCTGTGGGGCTCAT No data
Right 1175903338 20:62368404-62368426 GGGGGCTGGGTGGGTTTGTGGGG No data
1175903329_1175903338 -9 Left 1175903329 20:62368390-62368412 CCTGGACAGTCCCGGGGGGCTGG No data
Right 1175903338 20:62368404-62368426 GGGGGCTGGGTGGGTTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175903338 Original CRISPR GGGGGCTGGGTGGGTTTGTG GGG Intergenic