ID: 1175903339

View in Genome Browser
Species Human (GRCh38)
Location 20:62368410-62368432
Sequence TGGGTGGGTTTGTGGGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175903329_1175903339 -3 Left 1175903329 20:62368390-62368412 CCTGGACAGTCCCGGGGGGCTGG No data
Right 1175903339 20:62368410-62368432 TGGGTGGGTTTGTGGGGCACTGG No data
1175903328_1175903339 -2 Left 1175903328 20:62368389-62368411 CCCTGGACAGTCCCGGGGGGCTG No data
Right 1175903339 20:62368410-62368432 TGGGTGGGTTTGTGGGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175903339 Original CRISPR TGGGTGGGTTTGTGGGGCAC TGG Intergenic