ID: 1175903339 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:62368410-62368432 |
Sequence | TGGGTGGGTTTGTGGGGCAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1175903329_1175903339 | -3 | Left | 1175903329 | 20:62368390-62368412 | CCTGGACAGTCCCGGGGGGCTGG | No data | ||
Right | 1175903339 | 20:62368410-62368432 | TGGGTGGGTTTGTGGGGCACTGG | No data | ||||
1175903328_1175903339 | -2 | Left | 1175903328 | 20:62368389-62368411 | CCCTGGACAGTCCCGGGGGGCTG | No data | ||
Right | 1175903339 | 20:62368410-62368432 | TGGGTGGGTTTGTGGGGCACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1175903339 | Original CRISPR | TGGGTGGGTTTGTGGGGCAC TGG | Intergenic | ||