ID: 1175903345

View in Genome Browser
Species Human (GRCh38)
Location 20:62368430-62368452
Sequence TGGCCAGCCGGTTCTGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175903334_1175903345 7 Left 1175903334 20:62368400-62368422 CCCGGGGGGCTGGGTGGGTTTGT No data
Right 1175903345 20:62368430-62368452 TGGCCAGCCGGTTCTGGTGGGGG No data
1175903328_1175903345 18 Left 1175903328 20:62368389-62368411 CCCTGGACAGTCCCGGGGGGCTG No data
Right 1175903345 20:62368430-62368452 TGGCCAGCCGGTTCTGGTGGGGG No data
1175903329_1175903345 17 Left 1175903329 20:62368390-62368412 CCTGGACAGTCCCGGGGGGCTGG No data
Right 1175903345 20:62368430-62368452 TGGCCAGCCGGTTCTGGTGGGGG No data
1175903335_1175903345 6 Left 1175903335 20:62368401-62368423 CCGGGGGGCTGGGTGGGTTTGTG No data
Right 1175903345 20:62368430-62368452 TGGCCAGCCGGTTCTGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175903345 Original CRISPR TGGCCAGCCGGTTCTGGTGG GGG Intergenic
No off target data available for this crispr