ID: 1175905671

View in Genome Browser
Species Human (GRCh38)
Location 20:62378219-62378241
Sequence GGCTGGGAACCCTGAGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 409}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175905664_1175905671 5 Left 1175905664 20:62378191-62378213 CCGGGCCACAGAGCTGGGAACCT 0: 1
1: 0
2: 2
3: 39
4: 393
Right 1175905671 20:62378219-62378241 GGCTGGGAACCCTGAGGAGCTGG 0: 1
1: 0
2: 3
3: 45
4: 409
1175905657_1175905671 25 Left 1175905657 20:62378171-62378193 CCAGGGCCTCGGAGCTCCAGCCG 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1175905671 20:62378219-62378241 GGCTGGGAACCCTGAGGAGCTGG 0: 1
1: 0
2: 3
3: 45
4: 409
1175905663_1175905671 9 Left 1175905663 20:62378187-62378209 CCAGCCGGGCCACAGAGCTGGGA 0: 1
1: 0
2: 1
3: 32
4: 335
Right 1175905671 20:62378219-62378241 GGCTGGGAACCCTGAGGAGCTGG 0: 1
1: 0
2: 3
3: 45
4: 409
1175905660_1175905671 19 Left 1175905660 20:62378177-62378199 CCTCGGAGCTCCAGCCGGGCCAC 0: 1
1: 0
2: 2
3: 48
4: 1025
Right 1175905671 20:62378219-62378241 GGCTGGGAACCCTGAGGAGCTGG 0: 1
1: 0
2: 3
3: 45
4: 409
1175905665_1175905671 0 Left 1175905665 20:62378196-62378218 CCACAGAGCTGGGAACCTTGAGT 0: 1
1: 0
2: 2
3: 18
4: 175
Right 1175905671 20:62378219-62378241 GGCTGGGAACCCTGAGGAGCTGG 0: 1
1: 0
2: 3
3: 45
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175905671 Original CRISPR GGCTGGGAACCCTGAGGAGC TGG Intergenic
900403651 1:2483143-2483165 GACTGGGTGCCCTGAGAAGCAGG - Intronic
900647616 1:3716060-3716082 AAGTGGGAACCCTGAGGAGCTGG - Intronic
900810054 1:4795028-4795050 GGCTGGGCATCAGGAGGAGCTGG + Intergenic
900911568 1:5600276-5600298 GGAGGGGAACCCTGAGGCCCGGG + Intergenic
901332704 1:8423554-8423576 GGCTGGGAGCCCCGAGGTGGGGG - Intronic
901433642 1:9233497-9233519 GGCTGGGAACTGAGGGGAGCTGG - Intergenic
901535796 1:9882438-9882460 GGCTGGGAGCCTGGAGGAGAAGG + Intronic
902609315 1:17588012-17588034 AGCTGGCAACCCTGGGGGGCAGG + Intronic
902630408 1:17701377-17701399 GGCGGGGAAGCCTGAGGATGCGG + Intergenic
903318013 1:22524205-22524227 GGCTGGGACCCTGGAGGAGAGGG - Exonic
903596976 1:24502691-24502713 GACCAGGAACCCGGAGGAGCGGG + Intronic
904409635 1:30317693-30317715 GGCTGGGGCCTCTGAGGAGAGGG - Intergenic
904858998 1:33520888-33520910 GGCTGGGCACCCAGAGGCTCTGG + Intronic
904965912 1:34372436-34372458 GCCTGGGAGCTCTGAGGAGGAGG + Intergenic
905024050 1:34837731-34837753 TGCTGGGAAACCAGGGGAGCAGG - Intronic
905502941 1:38453867-38453889 GGCTTCCAACCCCGAGGAGCAGG + Intergenic
905900188 1:41576255-41576277 GGCTGAGGACCCTGACCAGCAGG + Intronic
906298530 1:44664035-44664057 GCCTCAGCACCCTGAGGAGCTGG - Intronic
907108936 1:51908996-51909018 GGCTGGGGCCCAGGAGGAGCAGG - Exonic
912158602 1:106953053-106953075 GGCTGGGAAGAGTGAGGACCAGG - Intergenic
912756509 1:112329199-112329221 GGCTGGGAGCCCTGAGGAGAGGG + Intergenic
913214579 1:116609880-116609902 GGCTGGAGAGCCTGAGGAGCGGG - Intronic
915463986 1:156085249-156085271 GGGTGGGCACCTTGAGGAGCTGG + Intronic
915580953 1:156813215-156813237 GAATGGGACCCCTGAGTAGCTGG - Intronic
915627457 1:157124128-157124150 GGCTGGGAAGGCACAGGAGCTGG - Exonic
915651029 1:157310998-157311020 AGCTGTGAACCCAGAGAAGCAGG - Intergenic
916792379 1:168136256-168136278 GGCTGGAATCCGTGAGGACCAGG - Intronic
917452988 1:175162573-175162595 GGATGGGAACACTGGGGACCTGG + Intronic
917616228 1:176747473-176747495 GGCTAGGACCCCATAGGAGCTGG - Intronic
919795033 1:201316494-201316516 GGCTGGGAGCCCTGCTGAGGGGG - Intronic
920007676 1:202845239-202845261 CTCTGGGCAGCCTGAGGAGCAGG - Intergenic
920126535 1:203698161-203698183 GTCTGGGAACCCTGCAGATCTGG + Exonic
920738070 1:208553318-208553340 GGTTGGGAAACCTGCTGAGCTGG + Intergenic
921123568 1:212157557-212157579 GGCTTGGTACCCTCAGGAGAAGG - Intergenic
922242644 1:223765914-223765936 GACTGAGAAACCTGAGGAACTGG - Intronic
1065706526 10:28475976-28475998 AGCTGGAAACCCTGAGATGCTGG - Intergenic
1066538305 10:36415491-36415513 GGCTGGGAACGGTGGGGAACAGG - Intergenic
1067452461 10:46390740-46390762 GGCTAGGAACCCTGGAGGGCCGG + Intronic
1067584771 10:47469015-47469037 GGCTAGGAACCCTGGAGGGCCGG - Intronic
1069934242 10:71904491-71904513 GGCTGGGGAGCCTGGGGAGCAGG - Intergenic
1069952310 10:72027545-72027567 GGCTGGGAAGACTGAGGGGTAGG - Intergenic
1070407742 10:76112142-76112164 GGCTGGCAGCCTGGAGGAGCTGG + Intronic
1070409680 10:76128354-76128376 GGATGGGAACAATGAAGAGCAGG + Intronic
1070646631 10:78206283-78206305 GGATGGGAAACCTGAGGCTCAGG - Intergenic
1071289296 10:84177013-84177035 GCCTGTGAACCCTGTGGACCTGG + Intronic
1071470297 10:85979458-85979480 GGCTGGTTCCCCTGAGGACCAGG + Intronic
1071994203 10:91130892-91130914 GGGTGGGACCCCAGAGGGGCTGG - Intergenic
1072443419 10:95477334-95477356 GGGTGGGAGTCCTGAAGAGCTGG + Intronic
1072541358 10:96400608-96400630 GGCTAGGGAGCCTGAGTAGCCGG + Intronic
1073875798 10:107920274-107920296 GGCTGAGAACCCTGATTGGCAGG - Intergenic
1074155919 10:110799332-110799354 GTCTGGTAACCCTGGGGATCAGG + Intronic
1074440695 10:113475134-113475156 GAGTGGGGACGCTGAGGAGCTGG + Intergenic
1075077318 10:119359967-119359989 GGCTGGGGAGGCTGAGGAGGCGG + Intronic
1075119011 10:119651177-119651199 GGGTGGGAAGCCGGACGAGCTGG - Intergenic
1076732021 10:132443974-132443996 GCCAGGGAGCCCTGAGGAGAGGG - Intergenic
1076732058 10:132444077-132444099 GGCGGGGAGCCCTGAGGAAGGGG - Intergenic
1076732093 10:132444163-132444185 GGGGGGGAGCCCTGAGGAGAGGG - Intergenic
1076732108 10:132444207-132444229 GGGAGGGAGCCCTGAGGAGAGGG - Intergenic
1076872457 10:133200613-133200635 GGCTGGGCACCCCCAGGAGAGGG - Intronic
1076872469 10:133200644-133200666 GGCTGGGCACCCCCAGGAGAGGG - Intronic
1077167209 11:1149080-1149102 GGCTGGAAACCCAGAGGTGCTGG - Intergenic
1077395003 11:2316349-2316371 GGCTGGGCAGGCTGAGGGGCAGG - Intronic
1077503996 11:2921883-2921905 GTCTGAGATCCCTGAGGAGTCGG - Intronic
1078105682 11:8356703-8356725 GGCTGGGGCATCTGAGGAGCCGG + Intergenic
1079374512 11:19880020-19880042 GGCTGGCACCCCTCAGCAGCAGG + Exonic
1079566372 11:21888040-21888062 TGCTGGGAAGGGTGAGGAGCTGG + Intergenic
1080425854 11:32153718-32153740 GGCTGGGAAGCAGGAAGAGCTGG + Intergenic
1080643990 11:34174868-34174890 GGCTGGGAACAGGCAGGAGCCGG - Intronic
1080881966 11:36329874-36329896 GGCTGGGAACCCTGTAGTCCAGG + Intronic
1081495975 11:43610690-43610712 TGCAGGGAACCATGAGCAGCAGG + Intronic
1081630264 11:44684817-44684839 GTCTGGGGCCCCTGAAGAGCCGG + Intergenic
1081656780 11:44862622-44862644 GTCAGGGAACCCTGAGGACAGGG - Intronic
1082740474 11:56905322-56905344 TGATGGGAACACTGAGGACCAGG - Intergenic
1083266704 11:61550301-61550323 GGGAGGGAGCCCTCAGGAGCGGG + Intronic
1083296406 11:61717811-61717833 GGCTGGTCACCCTGAGGTGGGGG + Intronic
1083615221 11:64022776-64022798 GGCTGGGGAGCCAGGGGAGCAGG + Intronic
1083954601 11:65976535-65976557 GGCTGGCAATCGCGAGGAGCAGG + Exonic
1084085765 11:66854418-66854440 GCCTGGGAACCCTTGGGGGCAGG + Intronic
1084428822 11:69100313-69100335 GGCTGGGAGCCCTCCGGGGCTGG + Intergenic
1084565974 11:69929257-69929279 TGCTGGGAACACTGAGAAGGAGG - Intergenic
1084587453 11:70070926-70070948 GGCTGGCAGCGCTGGGGAGCAGG - Intergenic
1085454332 11:76657175-76657197 GGCTGGGGACCCCAAGGAGGAGG + Intergenic
1085859923 11:80221164-80221186 GGCTGGGAAGGGTGAGGAGAAGG + Intergenic
1089344055 11:117778803-117778825 GGCTGGGAGCCCTGAGGCCTGGG - Intronic
1089445284 11:118547320-118547342 GGCGGGGAATGCTGGGGAGCTGG + Intronic
1089739866 11:120575082-120575104 AGCTGAGAAGCCTGATGAGCAGG - Intronic
1089993587 11:122883466-122883488 TGCAGGGATCCCTGGGGAGCTGG + Intronic
1090647452 11:128777233-128777255 GGCTGGGAGCCCCGAGGCCCCGG + Intronic
1091194575 11:133720115-133720137 GACTGGGAAGCCTGTGGAGCGGG + Intergenic
1091771796 12:3156857-3156879 AGCTGGGAAGGCTGTGGAGCAGG + Intronic
1092255709 12:6925921-6925943 GGCTGGCAAGCCGGAAGAGCTGG - Intronic
1092261856 12:6957099-6957121 GGCTGGGAACCTGAAAGAGCTGG - Intronic
1092651602 12:10641124-10641146 AGCTGGGGAAACTGAGGAGCTGG - Intronic
1092875289 12:12842396-12842418 TGCAGGGATTCCTGAGGAGCAGG - Intergenic
1094531798 12:31282750-31282772 TGCTGAGAAGCCAGAGGAGCAGG - Exonic
1094540979 12:31363040-31363062 GGCTGAGAAGACTGAGGAGATGG + Intergenic
1094807704 12:34108111-34108133 GGCTTGGGACCCAGAGGAGGAGG + Intergenic
1095130896 12:38541043-38541065 GGCCACCAACCCTGAGGAGCTGG - Intergenic
1095626276 12:44318611-44318633 GGCTGGTAATCCAGAAGAGCAGG + Intronic
1096165141 12:49416343-49416365 GGCTGGGAAGCCTTAACAGCTGG + Intronic
1096230373 12:49893438-49893460 GGGTGGGAAGTCAGAGGAGCTGG - Intronic
1096263147 12:50105192-50105214 AGCTGGGGTTCCTGAGGAGCTGG + Intronic
1096862658 12:54541072-54541094 GACTGGCAACACTGAGGTGCAGG - Intronic
1097687921 12:62708447-62708469 TGCTGGGAAACCTGGAGAGCTGG + Intronic
1098344434 12:69486476-69486498 AATAGGGAACCCTGAGGAGCAGG - Intronic
1102098891 12:110262153-110262175 AGCAGGTAACCCTGAGGAGCAGG + Intergenic
1102528479 12:113528894-113528916 GGCTGGGAGCACAGAGGAGCTGG - Intergenic
1105003120 12:132703902-132703924 GGCCGGGAACACGGAGGATCTGG + Intronic
1105218306 13:18303352-18303374 GGCTGGAGAGCCTGAGGAGTGGG - Intergenic
1105407092 13:20142106-20142128 GGCAGGGACCCCCGAGGAGGAGG - Exonic
1105577522 13:21667971-21667993 AGCTGGGACCCGTGAGGAGAGGG + Intergenic
1105784306 13:23733462-23733484 GGCTGGAATCCAGGAGGAGCAGG + Intronic
1105889822 13:24674586-24674608 GGCTGGGTAAGCTGAGGAGGAGG - Intergenic
1107024493 13:35785620-35785642 TTCTGGGCACCCTGAGGAGATGG + Intronic
1111488123 13:88931334-88931356 AGCTGGAAACCCTGAGGCACTGG + Intergenic
1113777016 13:112953678-112953700 GGCTGGGAACCCAGGTCAGCTGG - Intronic
1113781361 13:112979425-112979447 GGCCGGGCACTCTGAGGAGGTGG + Intronic
1117681059 14:58203185-58203207 GCCTCGGCCCCCTGAGGAGCTGG - Intronic
1118785856 14:69044840-69044862 GGCTGGGGACCCTGAAAAGGTGG - Intergenic
1119693289 14:76693324-76693346 GCCTGGGACTCCTGAGGAGCTGG - Intergenic
1119711850 14:76828163-76828185 GGCTTGGCACCTTGAGGACCTGG + Intronic
1119770951 14:77220484-77220506 GGCTGGGAAGCCTGAGGCTGAGG - Intronic
1119914433 14:78384096-78384118 TACTGGGAACCCAGAGGAGCAGG + Intronic
1121005355 14:90487238-90487260 GGCTGGGCTCACTGAGCAGCTGG - Intergenic
1121506151 14:94479102-94479124 TGTTGGGAATCCTGAGGACCAGG + Intronic
1121639245 14:95474385-95474407 GGCTGGGAACCCTCAAGAGCAGG + Intronic
1122078841 14:99253235-99253257 GGCGGTGCACTCTGAGGAGCCGG - Intronic
1122423844 14:101594128-101594150 GGCTGGGAGCCCTGAGACACAGG - Intergenic
1123063495 14:105605026-105605048 GGCTGGGATACCTGAAGCGCCGG + Intergenic
1123087555 14:105723812-105723834 GGCTGGGATACCTGAAGCGCCGG + Intergenic
1123138923 14:106056155-106056177 GGGTGGGAACCCTGAGGAGACGG + Intergenic
1123142000 14:106088733-106088755 GGGTGGGACGCCTGAGGAGAGGG + Intergenic
1123188003 14:106538424-106538446 GGGTGGGACCCTTGAGGAGTAGG + Intergenic
1123197676 14:106631813-106631835 GGGTGGGAATCCTGAGGAGACGG + Intergenic
1123201283 14:106666694-106666716 GGGTGGGAAGCCTGACGAGAAGG + Intergenic
1123214198 14:106791313-106791335 GGGTGGGACGCCTGAGGAGAAGG + Intergenic
1123215262 14:106803314-106803336 GGCTGGGACGCCTGACGAGAAGG + Intergenic
1202943360 14_KI270726v1_random:4676-4698 GGGTGGGACGCCTGAGGAGAGGG - Intergenic
1125506292 15:40269698-40269720 GGCTGGGGAGTCTGGGGAGCTGG - Intronic
1126137204 15:45403231-45403253 GGCCGGGAACCCTGCAGCGCCGG - Exonic
1127360550 15:58241238-58241260 GGCTGGGAACCCTTAAGAGATGG + Intronic
1128115274 15:65101429-65101451 GGAAGTGAACCCTGAAGAGCAGG - Intronic
1128780300 15:70354691-70354713 AGCTGGGGTCCCTGAGGCGCTGG - Intergenic
1129220389 15:74128809-74128831 TGTTGGGAACCCTGAGGGGGCGG - Intronic
1129794181 15:78363465-78363487 GCCAGAGAACCCAGAGGAGCAGG + Intergenic
1130957778 15:88639369-88639391 GGCTGGGAGCCGTGAGGTGGTGG + Exonic
1131507997 15:93033137-93033159 GTCTGCGAAGCCTGGGGAGCAGG - Intergenic
1131671136 15:94620579-94620601 GGATTGGAAACCAGAGGAGCTGG - Intergenic
1132410755 15:101576875-101576897 GGCTGTGAAGGGTGAGGAGCAGG + Intergenic
1133041791 16:3064873-3064895 GGCTGGGGGCCGTGAGGAGGAGG + Intergenic
1133087746 16:3378268-3378290 AGCTGTGCAGCCTGAGGAGCTGG + Intronic
1133793606 16:9028699-9028721 GTCTCGGCCCCCTGAGGAGCTGG + Intergenic
1133863720 16:9621554-9621576 GGATGGGACCACTGAGGTGCAGG - Intergenic
1134219402 16:12341800-12341822 GGCTGGGAAGCTTGGGGAGCAGG + Intronic
1135523054 16:23192062-23192084 GCCTAGGGACCCTGAAGAGCTGG + Intronic
1136115447 16:28091583-28091605 GGCAGGGAACCCTAAGGGGGTGG + Intergenic
1136693143 16:32051643-32051665 GGGTGGGACTCCTGAGGAGAGGG - Intergenic
1136793636 16:32994866-32994888 GGGTGGGAATCCTGAGGAGAGGG - Intergenic
1136869973 16:33798062-33798084 GGGTGGGACCCTTGAGGAGTAGG - Intergenic
1138113131 16:54340240-54340262 GGCTGGGAGAGCTGAGGAGGGGG - Intergenic
1138313801 16:56051088-56051110 GGCTGGCAGCCATGAGAAGCTGG - Intergenic
1138520910 16:57570406-57570428 GGCTGGGGCCCCTGAGGGGTGGG - Exonic
1139430660 16:66909430-66909452 GGCTGGGGGCTCTGAGCAGCTGG - Intronic
1140481742 16:75265949-75265971 GTCCGGGAACGCTCAGGAGCCGG - Exonic
1141715649 16:85725298-85725320 GGCTGGGAACCCAGGTGTGCAGG - Intronic
1142352751 16:89587355-89587377 GGCTGGGACCCCTCGGGAGCGGG - Intronic
1203095898 16_KI270728v1_random:1256559-1256581 GGGTGGGACTCCTGAGGAGAGGG - Intergenic
1203102198 16_KI270728v1_random:1317992-1318014 GGGTGGGACCCTTGAGGAGTAGG + Intergenic
1142505449 17:360657-360679 GGCTGGAAACCGTGGGGCGCTGG + Intronic
1142648005 17:1327872-1327894 GGCTGGGAAGTCTGAGGTGAAGG - Intergenic
1142699070 17:1648798-1648820 CCCAGGGAACCCTGAGGACCCGG - Exonic
1143012223 17:3872336-3872358 GGATGGGAACCCTGAGATCCAGG - Intronic
1143658452 17:8310940-8310962 GGGTGGGATCCCTGAGGGGCAGG + Intronic
1143722002 17:8819006-8819028 GGCTGGGAGCCCAGAGGGGAGGG - Intronic
1144787484 17:17840142-17840164 GGCTGGAGACCCAGGGGAGCCGG + Intergenic
1144941974 17:18948219-18948241 GGCTGGGACCCCAGGGGAGGAGG + Intergenic
1144958743 17:19033060-19033082 GGCTGGTGATCCTGAGGGGCAGG - Intronic
1144976416 17:19141464-19141486 GGCTGGTGATCCTGAGGGGCAGG + Intronic
1145148760 17:20501835-20501857 GGCTGGGAGCTCTGAGGAGAAGG + Intergenic
1146169977 17:30625345-30625367 GCCTGAGAACCATGGGGAGCTGG + Intergenic
1146343431 17:32041375-32041397 GCCTGAGAACCATGGGGAGCTGG + Intronic
1146400199 17:32495490-32495512 TGCAGGGAACCCTGTGCAGCAGG + Intronic
1146552847 17:33796807-33796829 GGATGGGAACCCTGAGCTCCAGG + Intronic
1146570049 17:33944672-33944694 GCAGGGCAACCCTGAGGAGCAGG - Intronic
1146822755 17:35997930-35997952 GACTGGGAAATCTGAGGAGCAGG - Intronic
1146824858 17:36013381-36013403 GACTGGGAAATCTGAGGGGCAGG - Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1146917536 17:36687680-36687702 GGTTTGGAATCCTGAGGTGCTGG + Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147577287 17:41610101-41610123 GGCTGGGAGCTCTGAGGAGAAGG + Intronic
1147578333 17:41615200-41615222 GGCTAGAAACCCTGGGGTGCTGG + Intronic
1147723852 17:42554555-42554577 GGCGCAGAACCCTGAGGAGGTGG + Exonic
1147766170 17:42837739-42837761 GACTTGCAACCCTGAGAAGCAGG + Intronic
1148338680 17:46860137-46860159 AGCTGTAACCCCTGAGGAGCTGG + Intronic
1148878027 17:50704110-50704132 GGCTGAGGACTCAGAGGAGCAGG + Intronic
1149552001 17:57547278-57547300 AGATGGGAACCCTCAGGAGGAGG + Intronic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150144160 17:62753818-62753840 GGCTGGGAGCCCTGGAGGGCAGG + Intronic
1150292441 17:63989316-63989338 GGCCGGGTACCCCGAGGGGCAGG - Intergenic
1151683950 17:75636094-75636116 GGCTGGGCAGCCTGGGCAGCAGG + Intronic
1151697175 17:75723664-75723686 GGCTGGGGTCCCCGAGGTGCTGG - Intronic
1151699982 17:75737780-75737802 GGATGGGGACCCTGGGGAGGTGG - Intronic
1152315792 17:79579618-79579640 GGCTGGGAGCCATCAGGAGATGG + Intergenic
1152560015 17:81073185-81073207 GGCTTCGATCTCTGAGGAGCAGG - Intronic
1152918417 17:83053126-83053148 GGCTGGGAACCCGGAGAAGGCGG + Intergenic
1153771864 18:8423183-8423205 GCCTGGGAACAGTGAGGAGAGGG - Intergenic
1153817824 18:8806552-8806574 TGCTGTGGGCCCTGAGGAGCAGG - Intronic
1154197063 18:12274347-12274369 GCCTGGGAGCCCAGAGGAACAGG - Intronic
1155207663 18:23575114-23575136 GGCTGGTTACCCACAGGAGCAGG + Intronic
1155786592 18:29910609-29910631 TGCTGGTAAACCTGAGAAGCTGG - Intergenic
1157299295 18:46467971-46467993 GGATGGGACCCCTCGGGAGCAGG - Intergenic
1157516046 18:48312219-48312241 GGCTGGGAACCATGGGAAGTTGG - Intronic
1159909064 18:74126669-74126691 GACTGAAATCCCTGAGGAGCTGG + Intronic
1159940091 18:74400292-74400314 GGCAGGCAACCCCCAGGAGCTGG + Intergenic
1160440337 18:78884568-78884590 GGGTGGGAGCCATGAAGAGCAGG - Intergenic
1160790959 19:923531-923553 GGCTGGGAAACCTTCAGAGCTGG + Intergenic
1160906531 19:1454040-1454062 GTCTGGGCACCCTGTGCAGCTGG + Intronic
1161241055 19:3224422-3224444 GGCGGGGACCCCTGGGAAGCCGG + Intergenic
1161418896 19:4164544-4164566 GGCTGGGCACTGTCAGGAGCTGG + Exonic
1162955057 19:14092833-14092855 GGCTGGGAGGGCTGAGGGGCTGG + Exonic
1163034598 19:14563563-14563585 CCCTGGGAACCCTGAGAAGCTGG + Intronic
1163292956 19:16392582-16392604 GCCAGGGGACCCTGAGGAGAGGG + Intronic
1163514029 19:17752195-17752217 GGCTGGCACAGCTGAGGAGCTGG + Intronic
1163672153 19:18635930-18635952 GGTGGGGAACCATGAGGGGCTGG + Intergenic
1163811337 19:19434254-19434276 GGGTGGGAAGCCTCAGAAGCAGG - Intronic
1163815771 19:19463583-19463605 GGCTGGGATGCCAGAGGGGCTGG + Intronic
1165434860 19:35790165-35790187 GGTGGGGAACCCTGGGGTGCAGG + Intergenic
1165808631 19:38596993-38597015 TGCTGGGAACTCTGAGGAGTGGG - Intronic
1166067799 19:40370277-40370299 GGCTGGGTGCCCTGTGGGGCAGG - Intronic
1166109029 19:40611605-40611627 TTATGGGAACCCTGAGGAGGGGG + Intronic
1166364597 19:42272182-42272204 GGCTGGGGCCCCTGAAGAGCGGG + Intronic
1166377534 19:42336079-42336101 GCCTGGGGGCCCCGAGGAGCTGG - Exonic
1166386867 19:42387307-42387329 GGCTGGGGACCCGCGGGAGCAGG - Intronic
1167171973 19:47839507-47839529 GGTTGGGGAGCCTGAGGGGCCGG - Exonic
1167502873 19:49857350-49857372 GGCAGGGAAGCCAGCGGAGCGGG + Intronic
1167574907 19:50313227-50313249 GGCTGGGATCCCAGCCGAGCTGG + Intronic
1167973206 19:53202032-53202054 GCCTGGGCCCCCTGAGTAGCTGG + Intergenic
1168074370 19:53971563-53971585 GGCTGAAATCCCTGAGGAGGGGG - Intronic
1168414681 19:56160577-56160599 ACCTGGGACCCCTGAGGGGCAGG + Exonic
925719938 2:6817405-6817427 GTCTTGGCACCCTCAGGAGCAGG - Intergenic
926109310 2:10171947-10171969 GGCTGGGAAAACTTAGGAGACGG + Intronic
926294201 2:11556279-11556301 GTCTGGGAACTCTCAGGGGCAGG + Intronic
926728697 2:16018307-16018329 GCCTCAGCACCCTGAGGAGCTGG + Intergenic
927641382 2:24847820-24847842 TGCTGGGAGTCCTGAGGGGCAGG + Intronic
929301194 2:40305251-40305273 GGCTATGAACCCTGGGGAGCAGG - Intronic
929701777 2:44168825-44168847 GGCGGGGCACCCTGAGGGGCGGG + Intronic
931681037 2:64750409-64750431 GGGTGGGAGCGCAGAGGAGCGGG + Intronic
932457850 2:71861027-71861049 GGCTGGGACTCCTGAGAGGCTGG - Intergenic
932939365 2:76144253-76144275 AGCTGGGAAGCCTGGAGAGCTGG + Intergenic
934240535 2:90268177-90268199 TCCTGGGAGCTCTGAGGAGCAGG + Intergenic
934295992 2:91743280-91743302 GGCTGGAGAGCCTGAGGAGCAGG + Intergenic
935239012 2:101162104-101162126 GGGAGGGTACTCTGAGGAGCTGG - Intronic
935426570 2:102924944-102924966 GGCTAGCAACCCTGATGAACAGG + Intergenic
935595531 2:104874354-104874376 GGCTGGGAACCCTGGCGGGGAGG - Intergenic
935744540 2:106179084-106179106 GACTGGGCACCCTCAGGAGGAGG - Intronic
936509528 2:113133836-113133858 GGCTGGGAGCTCTGCAGAGCAGG + Exonic
938097663 2:128474115-128474137 GGCTCAAACCCCTGAGGAGCAGG - Intergenic
938114028 2:128591272-128591294 TCCAGGAAACCCTGAGGAGCAGG - Intergenic
939190076 2:138906883-138906905 GGCTGCGAAGCATGAGAAGCAGG + Intergenic
940897273 2:159092962-159092984 GGAAGGTAACCCTGAGGAACAGG - Intronic
941707845 2:168678635-168678657 GGTTGGGAGCCTTGAGGAGGTGG + Intronic
942244440 2:173994084-173994106 AGCTGGTATCCCTGAGGAACTGG + Intergenic
944412438 2:199457712-199457734 GGCTGAGAACCCGGAGGCGGCGG + Exonic
945484230 2:210375928-210375950 TGCTGAGAATCCTGAGTAGCTGG + Intergenic
945935423 2:215898632-215898654 GGATGGAGACCCTGAGGAGGTGG - Intergenic
948391394 2:237613924-237613946 GGCTGGGAAGCTTGGGGAGGTGG + Intergenic
948431313 2:237920919-237920941 GGCTGGGAACACTGAGAGACGGG - Intergenic
948618254 2:239215381-239215403 TGCTGGGAGCCCAGAGAAGCAGG + Intronic
948838344 2:240636957-240636979 GGCTCGGGCCCCTGAGGAGGGGG - Intergenic
948933044 2:241144528-241144550 GGCTGGGAACTCTGGGGTTCTGG - Intronic
1170905851 20:20514743-20514765 GGCTGGTAACCCAGATCAGCAGG - Intronic
1171347875 20:24479499-24479521 GGAAGGGAAGCCTGAGGGGCTGG - Intronic
1171394310 20:24821672-24821694 AGCAGGGAACCCTGAACAGCAGG + Intergenic
1175257899 20:57657932-57657954 GGCTGGGAACTGTGGGGAGGAGG - Intronic
1175311027 20:58011653-58011675 GGCCGGGGCCCCTGAGGAGGTGG + Intergenic
1175905667 20:62378202-62378224 AGCTGGGAACCTTGAGTGGCTGG + Intergenic
1175905671 20:62378219-62378241 GGCTGGGAACCCTGAGGAGCTGG + Intergenic
1176123374 20:63464238-63464260 GGCTGGGAGCTCTGGGCAGCTGG + Intronic
1176519449 21:7813649-7813671 CACAGGGAACCCTGAGGACCGGG - Intergenic
1177557527 21:22711833-22711855 GGCTGGGATCCCAGAAGAACAGG + Intergenic
1178653477 21:34443662-34443684 CACAGGGAACCCTGAGGACCGGG - Intergenic
1178797112 21:35755315-35755337 GGCGAGGAACTCTGAGGAGTGGG + Intronic
1180060207 21:45381194-45381216 TGCTGGGAACCCTGCTGAGATGG - Intergenic
1180157910 21:45986890-45986912 GGCTGGGACCCCTGACGGCCGGG - Intronic
1180302707 22:11050310-11050332 GGGTGGGAGCCAGGAGGAGCCGG + Intergenic
1180535611 22:16391274-16391296 GGCTGGCCACCCTCAGGAGATGG - Intergenic
1181054794 22:20255746-20255768 GGCTGGGGCCCCTCAGGAGCCGG + Intronic
1181312629 22:21953384-21953406 TGCAGGGAGCCCTTAGGAGCTGG - Intergenic
1181367945 22:22393472-22393494 GACTTGGACCCCTGAGTAGCTGG - Intergenic
1181447316 22:22987098-22987120 GGCCAGGAACCCTGAGTAACAGG - Intergenic
1181760987 22:25058771-25058793 TGCTGGGAGCCCTGAACAGCTGG + Intronic
1182396972 22:30043300-30043322 AGGAGGGAACCCTGAGGAACAGG + Intergenic
1183314588 22:37129837-37129859 TCCTGGGAACCCTCAGCAGCTGG + Intronic
1183370633 22:37429978-37430000 CACAGGGAACCCTGAGGACCTGG + Intergenic
1183585489 22:38750813-38750835 GGCAGGGAGCCCCGGGGAGCTGG - Intronic
1183724095 22:39578852-39578874 GGCTGGGAAGCCTCAGCAGCTGG - Intronic
1184402617 22:44282553-44282575 CACAGGGAGCCCTGAGGAGCTGG + Intronic
1184429677 22:44434598-44434620 GGCTGGGGACCCCGAGGATGGGG + Intergenic
1185201558 22:49509173-49509195 AGCTGGATACCCTGAGAAGCCGG + Intronic
1185227976 22:49664014-49664036 GCCTGGGCACCCTCTGGAGCTGG - Intergenic
1185243084 22:49756790-49756812 GGCAGGCAACTCTGAGGAGGGGG - Intergenic
949538587 3:5014521-5014543 GGCTGGGAGCGCTGAGGGGCTGG + Intergenic
949926064 3:9042827-9042849 GTTTGGGAACCCAGAGGAGGGGG - Intronic
949946023 3:9190848-9190870 GGCTGGGGACCCTTAGGGGAGGG + Intronic
950094706 3:10322084-10322106 GGTTGGGGACCCTGAGGATTAGG - Intergenic
950304915 3:11910130-11910152 GGCTGGGCACACTGAGATGCCGG - Intergenic
950423452 3:12912026-12912048 GGCTTGGCACCTTGAGGGGCAGG + Intronic
950891099 3:16405132-16405154 CTCTGGGAGCCCTGAGGAGTGGG + Intronic
952395084 3:32914102-32914124 GGCTGGGAACCTTGACATGCTGG - Intergenic
953011520 3:39030003-39030025 GGCTGGCAACCCTCAGCAGATGG - Intergenic
953251645 3:41249636-41249658 GGATGGGCACCCTGAGTATCAGG + Intronic
953492018 3:43360640-43360662 AGCTGGGCAGCCTGAGGAGTGGG - Intronic
954130476 3:48558243-48558265 GGCTGGGGATCCCGAGGAGGCGG - Intronic
955363438 3:58292469-58292491 AGCTGGGAACCCAGAGGAAAAGG + Intronic
956169941 3:66425130-66425152 AGCTGGGAAGCAAGAGGAGCCGG + Intronic
959232224 3:103669081-103669103 AGCTGGGACTCCTGAGTAGCTGG - Intergenic
960049252 3:113224639-113224661 GGGTTCCAACCCTGAGGAGCAGG + Intronic
960433900 3:117602252-117602274 AGCTGGCAGCCCTCAGGAGCTGG + Intergenic
960691201 3:120348679-120348701 GTCCGGGAACCCTGGGGCGCCGG - Intronic
961644656 3:128386425-128386447 GGCTGGGGGCCCTGGGGAACTGG - Intronic
962258936 3:133890963-133890985 GGCTGGTAGCCCAGGGGAGCAGG + Intronic
962806557 3:138931594-138931616 GGGTGGGAACCCTGAAGCACAGG + Intergenic
966734799 3:183179958-183179980 GGGTGAGAATCCTGAGGAGGGGG + Intronic
966870913 3:184290329-184290351 GGCTGGGAGGCTTGCGGAGCTGG - Exonic
968809061 4:2792085-2792107 TGCTGGGAACCCAAGGGAGCTGG - Intergenic
968810674 4:2798418-2798440 GCCTGGGAGCCCTGAGTGGCAGG + Intronic
968913050 4:3485473-3485495 GGCTGGGGACCCTGAAGAGGAGG - Intronic
975132962 4:70846604-70846626 AGCTGGGACTCCTGAGTAGCTGG - Intergenic
978467999 4:109030038-109030060 GGATCCGAACTCTGAGGAGCAGG - Intronic
980219151 4:129893040-129893062 TATTGGGAACTCTGAGGAGCAGG + Intergenic
981616215 4:146647619-146647641 GGCTGCGGAGCCTGAGCAGCTGG - Intergenic
982115368 4:152094515-152094537 GGCAGGGAAAACTGAGGGGCAGG + Intergenic
982117805 4:152112495-152112517 GGAAGTGCACCCTGAGGAGCTGG - Intergenic
983235903 4:165178918-165178940 AGCTGGGAAACCAGAGAAGCTGG - Intronic
985420631 4:189781771-189781793 AGCAGGGAACCCTGAGGTGCTGG + Intergenic
985710817 5:1428639-1428661 GGCTGGGACCCCTGGGGGCCAGG + Intronic
985988665 5:3537888-3537910 GGCTGGGGACTCTGAGGAAGTGG + Intergenic
986638585 5:9849590-9849612 GTCTGGGAACCCAGAGGAGGGGG - Intergenic
987370335 5:17187273-17187295 AGCTGGGAACTGTCAGGAGCAGG - Intronic
989777971 5:45232181-45232203 GGCTGGGAAGCCTCAGAATCAGG + Intergenic
992023510 5:72648738-72648760 GGCTGGGAGCCCAGAAGAGCTGG + Intergenic
993618146 5:90137365-90137387 GGGTGGGAGCCCCGAGGACCGGG - Intergenic
995106409 5:108381586-108381608 GGCGGGGCAGCCTGAGGAGAGGG + Exonic
996854301 5:127987740-127987762 AGCTGGGAAGCATGAGGAGCTGG - Intergenic
997353425 5:133247110-133247132 GGCTTGGACCCCTGCGGGGCTGG + Intronic
997951457 5:138245880-138245902 GGCTGGGAACAGTGACAAGCAGG - Intergenic
998454590 5:142261556-142261578 GGCAGAGACCCCTGAGGAGGAGG - Intergenic
998483752 5:142484416-142484438 GGGGAGGAACCCTGAGGAGTAGG - Intergenic
1000244375 5:159437087-159437109 CTCTGGGGTCCCTGAGGAGCAGG + Intergenic
1001038876 5:168317675-168317697 TCCTGGGAATACTGAGGAGCAGG - Intronic
1001049654 5:168404185-168404207 GGCTGGGGACTCTGGGGAGGGGG - Intronic
1001268130 5:170289994-170290016 GGCTGGAGACACAGAGGAGCAGG + Intronic
1001838408 5:174852410-174852432 GGCTGGGAAGACTCAGCAGCTGG + Intergenic
1001871131 5:175156949-175156971 GGCTGAGATTCCTGAGGAGCAGG + Intergenic
1002415318 5:179117420-179117442 GGCTGGGATCCCTGAAAAGCAGG + Intronic
1002441981 5:179269156-179269178 GGCTGGCAGCCCCCAGGAGCGGG + Intronic
1002617196 5:180463348-180463370 TGCTGGCAGCCCTTAGGAGCTGG + Intergenic
1002653478 5:180722864-180722886 GGAAGGGCACCCTGAGAAGCTGG + Intergenic
1002719264 5:181247790-181247812 GGCAGGGAAGCCTGAGGGGCTGG - Intronic
1003406043 6:5828174-5828196 GGCTTGGTTCCCAGAGGAGCAGG + Intergenic
1003527949 6:6913598-6913620 GGCTGGGCACCCCAGGGAGCTGG - Intergenic
1004169391 6:13284179-13284201 GTCTGGTCACCATGAGGAGCTGG + Intronic
1004538190 6:16523272-16523294 AGCTGGAAACCCTGAGGCCCAGG + Intronic
1005828605 6:29652288-29652310 GGCTGGGAGGCATGGGGAGCAGG - Intergenic
1006100617 6:31683952-31683974 GTCCAGGCACCCTGAGGAGCTGG - Intronic
1007348608 6:41251831-41251853 GGCTGGGCACACTCAGCAGCAGG - Intergenic
1007419640 6:41711902-41711924 GGCTGGGAAAGCTGAGGAGGTGG + Intronic
1007781468 6:44257191-44257213 GGCTGGGGACCCTGACGTCCCGG - Intronic
1007784565 6:44272303-44272325 GGCTGGGGTCCCTGAGCGGCAGG - Intronic
1008314488 6:50023180-50023202 GCCTTGGACCCCTGAGTAGCTGG - Intergenic
1012982704 6:105846861-105846883 GCCTGGCCACCTTGAGGAGCAGG + Intergenic
1013612188 6:111805888-111805910 AGCTGGGACCACTTAGGAGCTGG + Intronic
1013636188 6:112031753-112031775 GGCTGGGATCCCAGAGAAGCAGG - Intergenic
1015221598 6:130810403-130810425 GGTTAGGAACCCTAAGCAGCTGG + Intergenic
1017155660 6:151320554-151320576 GGCCTGGAACCCTGAGGAAGAGG - Intronic
1017415176 6:154212780-154212802 GTCTGGGAAGCGTGAGGAGGGGG + Exonic
1018060845 6:160088485-160088507 GGCTGGGACCCTCGAGCAGCTGG + Intronic
1018391840 6:163346768-163346790 GGCTGGGAACGCTGCAGCGCCGG + Intergenic
1019037830 6:169076574-169076596 GCCTCGGCACTCTGAGGAGCTGG + Intergenic
1019544215 7:1565387-1565409 GGCTGTGAACCCGCAGGGGCAGG + Intergenic
1019557447 7:1639821-1639843 GGCTGGGAGCTGAGAGGAGCCGG + Intergenic
1020290972 7:6721953-6721975 GGAGGGGTACCCTGAGGCGCTGG + Intergenic
1020856272 7:13428650-13428672 TACTGGGAACTCTGAGGAGAAGG + Intergenic
1022383930 7:29884539-29884561 GGCTGGGAGCCCGGAGGGGCAGG - Exonic
1024113124 7:46166601-46166623 AGCAGGTAAGCCTGAGGAGCTGG + Intergenic
1024919737 7:54544828-54544850 GGCCGGACACCCTGAGGACCGGG - Intronic
1025231102 7:57203780-57203802 GGCTGGGAACCCCGGGGAAGAGG + Intergenic
1027051606 7:75024793-75024815 GCCTGGGGACCCTGAGGAAGGGG + Exonic
1027252559 7:76408373-76408395 AGCTGAGAACCATGAGGAGGGGG + Intronic
1032084019 7:128874295-128874317 AGGTGGGGACCCTGAGCAGCCGG - Intronic
1032494533 7:132351121-132351143 GGCTGGGGGCCATGTGGAGCTGG + Intronic
1032516484 7:132509858-132509880 GGCAGTGAACCCAGAGGACCTGG - Intronic
1033508319 7:142028757-142028779 GCCTAGGAACACTGAGGAGATGG + Intronic
1033984926 7:147213720-147213742 GGCTGGAAACCCTGAGATGCTGG + Intronic
1034456896 7:151175546-151175568 GCCTGGGACCCCTTAGCAGCCGG + Intergenic
1035160767 7:156948930-156948952 GCCGAGGACCCCTGAGGAGCCGG - Intergenic
1035171793 7:157021323-157021345 GGCTGGGAAGCCTGTGGGGGTGG - Intergenic
1035637421 8:1156905-1156927 GACTGGGAACCCTGAGTGGACGG - Intergenic
1036161127 8:6389408-6389430 TGCTGGTAGCCATGAGGAGCTGG + Intergenic
1036407521 8:8468440-8468462 TGCTGGGAACACAGGGGAGCAGG - Intergenic
1037880939 8:22573081-22573103 GGCTTTGAAGCCTGAGGAGTTGG + Intronic
1038030451 8:23634391-23634413 TGCTGAGAAGCCAGAGGAGCAGG - Intergenic
1038138664 8:24818788-24818810 GGCTGAGAGCACTGAGGAGCAGG - Intergenic
1039355113 8:36806667-36806689 TGCTGGGATCCCACAGGAGCTGG + Intronic
1045248477 8:100463618-100463640 GGCCTGGATCCCTGAGTAGCTGG + Intergenic
1046012429 8:108565649-108565671 GGCAGGGAAAACTGAGGAGAGGG - Intergenic
1046030109 8:108773652-108773674 TGCTGGGTCCCCTGAGGAGAGGG - Intronic
1046922629 8:119748831-119748853 GTCTGGCAACCCAGAGCAGCTGG + Intronic
1049228195 8:141467685-141467707 TGCTTGGAACCCAGAGGAGTGGG - Intergenic
1049603312 8:143518051-143518073 GGCTGGGGGCCCTGTGGACCAGG - Intronic
1049792685 8:144479224-144479246 GGCTGGGTTGCCTGAGGGGCTGG + Intronic
1049807281 8:144546765-144546787 GGCCTGGGCCCCTGAGGAGCAGG - Intronic
1050094646 9:2051437-2051459 GGGTGGGAACCCCGGGGAGATGG - Intronic
1050659835 9:7872402-7872424 GCCTGAGAACCCTTAGGATCTGG - Intronic
1052195470 9:25708315-25708337 CGCTGGGAGCCCGGAGGAGGAGG - Intergenic
1052682067 9:31706234-31706256 GGCTGGAAACCCAGGGAAGCTGG - Intergenic
1053000807 9:34576483-34576505 GGCTAGGCAACCTGAGGTGCTGG - Intronic
1053056160 9:34994132-34994154 GGCAGGCAGCCCTGAGGGGCAGG - Intronic
1053184201 9:36001493-36001515 GGCTGGGAACAGTGATGAGAGGG + Intergenic
1054916242 9:70497708-70497730 GGCTGGGAACCCAGGGAGGCTGG - Intergenic
1056560337 9:87724213-87724235 GGCTGGGAAGTCTGAGGTCCAGG - Intergenic
1056654200 9:88495847-88495869 GGGTGGGAACTGTGAGGAGGTGG + Intergenic
1057225233 9:93289467-93289489 AGCTGGGACCCCTGTGGAGGTGG + Exonic
1057482380 9:95455708-95455730 GGCTGGGAGGTCTGAGGAACTGG + Intronic
1057878356 9:98774527-98774549 GGCCTGGAACCTAGAGGAGCAGG + Intronic
1059961918 9:119573982-119574004 GGCTGGGAAAGCTGGGAAGCTGG - Intergenic
1060593281 9:124832841-124832863 GGCCAGGACCCCTGAGGAGGTGG - Intergenic
1060969015 9:127727417-127727439 GGCTGAGGCCCCTGAGGAGGAGG + Exonic
1061362657 9:130153624-130153646 GGCTGAGGACCACGAGGAGCGGG + Intergenic
1061398205 9:130354815-130354837 GGCTGGGAGGCCTGTGGCGCTGG + Intronic
1061407298 9:130399529-130399551 GGCCGGGGGCCGTGAGGAGCAGG - Intronic
1061431418 9:130533650-130533672 GGAAGGGACCCCTGAGGGGCAGG - Intergenic
1061818272 9:133208775-133208797 GGCTGGGAGCCCTGAGCAGGGGG - Intronic
1061872637 9:133528887-133528909 GCATGGGGACCCCGAGGAGCAGG - Intergenic
1061999536 9:134208909-134208931 GACTGGGAACAGTGGGGAGCAGG - Intergenic
1062242180 9:135546583-135546605 GGCTGGGAGCCCTGAGCAGGGGG + Intronic
1062414190 9:136439602-136439624 GTCTGGGAGCCCCGAGGGGCTGG - Exonic
1185794108 X:2950103-2950125 GGCCTGGAGCCCTCAGGAGCTGG - Intronic
1187098474 X:16169659-16169681 GCCTGGGAAACCTCAGGAGAGGG + Intronic
1187384999 X:18840343-18840365 GGCTGGGAACCCTTGAAAGCAGG - Intergenic
1190152203 X:47957890-47957912 AGCTGGGAACCCAGCAGAGCGGG - Intronic
1191108123 X:56784790-56784812 GCCTGGAAACCCTAAAGAGCCGG - Intergenic
1191870461 X:65740920-65740942 GGCTGGGATGGCTGTGGAGCAGG - Exonic
1192639507 X:72848370-72848392 AGCTAGGAACCCAGAGGAGGAGG + Exonic
1192642204 X:72872435-72872457 AGCTAGGAACCCAGAGGAGGAGG - Exonic
1196411561 X:115425236-115425258 GGTATGGAAACCTGAGGAGCTGG + Intergenic
1197862429 X:130984897-130984919 GGCTCTGAACCCTGAGGAGGTGG + Intergenic
1199745963 X:150772124-150772146 GGCTGAAAACACTGAGAAGCTGG - Intronic