ID: 1175907143

View in Genome Browser
Species Human (GRCh38)
Location 20:62386575-62386597
Sequence GGTGGGCGAAGGACACCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175907143_1175907156 7 Left 1175907143 20:62386575-62386597 CCTGCGGGTGTCCTTCGCCCACC No data
Right 1175907156 20:62386605-62386627 GGGAGTGAGTAGCAGGCACCAGG No data
1175907143_1175907157 15 Left 1175907143 20:62386575-62386597 CCTGCGGGTGTCCTTCGCCCACC No data
Right 1175907157 20:62386613-62386635 GTAGCAGGCACCAGGTGAGCAGG No data
1175907143_1175907153 0 Left 1175907143 20:62386575-62386597 CCTGCGGGTGTCCTTCGCCCACC No data
Right 1175907153 20:62386598-62386620 GGCCCGGGGGAGTGAGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175907143 Original CRISPR GGTGGGCGAAGGACACCCGC AGG (reversed) Intergenic
No off target data available for this crispr