ID: 1175908532

View in Genome Browser
Species Human (GRCh38)
Location 20:62393555-62393577
Sequence GTGTGTGACCAGGGCGTTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175908526_1175908532 13 Left 1175908526 20:62393519-62393541 CCGAGGTGTGGGCAGCAGGCCAT 0: 1
1: 0
2: 1
3: 32
4: 248
Right 1175908532 20:62393555-62393577 GTGTGTGACCAGGGCGTTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 157
1175908528_1175908532 -6 Left 1175908528 20:62393538-62393560 CCATGGCTGTCACTCTTGTGTGT 0: 1
1: 0
2: 1
3: 18
4: 211
Right 1175908532 20:62393555-62393577 GTGTGTGACCAGGGCGTTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 157
1175908522_1175908532 28 Left 1175908522 20:62393504-62393526 CCGGGGGACACTGGGCCGAGGTG 0: 1
1: 0
2: 2
3: 18
4: 240
Right 1175908532 20:62393555-62393577 GTGTGTGACCAGGGCGTTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175908532 Original CRISPR GTGTGTGACCAGGGCGTTGG TGG Exonic
900541095 1:3203210-3203232 GTGGGGGGCCAGGGCTTTGGCGG + Intronic
902555633 1:17245037-17245059 GTGTGTGACGACGGATTTGGGGG + Exonic
905001183 1:34671327-34671349 CTGTGGGGCCAGGGGGTTGGGGG - Intergenic
907424964 1:54373821-54373843 GGGTGTGAGTAGGGAGTTGGGGG - Intronic
908830208 1:68171071-68171093 GTGTGTGTGCAGGGGTTTGGGGG - Intronic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
918357064 1:183714871-183714893 GGGTGTGAACTGGGAGTTGGAGG + Intronic
919097864 1:193059254-193059276 GTGTGTGGCCAGGGCCATGACGG - Exonic
919920349 1:202163449-202163471 GTGTGTGGCCAGAGCTTGGGAGG - Intergenic
920696608 1:208185613-208185635 TTGTGTTGCCAGGGGGTTGGGGG - Intronic
921235114 1:213118890-213118912 GTGTGTGTCGGGGGCGGTGGTGG + Intronic
922440091 1:225647999-225648021 GTGGGGGACAAGGGGGTTGGGGG + Intronic
922503365 1:226112348-226112370 CTGTGTGACCAGGACATGGGTGG - Intergenic
924352187 1:243126604-243126626 GTGTCTGACCCGGGCTGTGGTGG + Exonic
924370867 1:243348498-243348520 GGGTGGGACCAGGGCACTGGGGG - Intronic
1063658234 10:8012771-8012793 GTGTGTGACAGGTGCATTGGGGG - Intronic
1063941639 10:11135839-11135861 GTGTATGGCCTGGGCGGTGGTGG + Intronic
1065113452 10:22461956-22461978 ATGTGTGGCCATGGAGTTGGGGG - Intergenic
1074596057 10:114868183-114868205 GTCTGTGGCCCGGGGGTTGGGGG - Intronic
1074687732 10:115975350-115975372 GGGTGTCTCCAGGGCTTTGGGGG - Intergenic
1075064462 10:119280101-119280123 CTCTGTGCCCAGGGAGTTGGAGG + Intronic
1075098534 10:119489834-119489856 ATGGGTGCCCAGGGCCTTGGAGG + Intergenic
1077891242 11:6419355-6419377 GTGCGGGACCAGGGCGCTGCGGG - Intronic
1079081357 11:17415542-17415564 GTGTGTGAGGAGGGCCCTGGAGG + Intronic
1081774062 11:45665724-45665746 GTGGGTGTCCAGGGCGCTCGCGG - Intergenic
1083152300 11:60799529-60799551 GGGTGAGACCACGGGGTTGGAGG - Intronic
1083995445 11:66269323-66269345 GGGTGTGACGGTGGCGTTGGGGG - Intronic
1084322967 11:68383840-68383862 CTGTGTGACCTGGGCCTTGAAGG + Intronic
1084605487 11:70169491-70169513 GGGTATGACCAGGGAGCTGGAGG - Intronic
1088378683 11:109169684-109169706 GAAAGTGACCAGGGCTTTGGGGG - Intergenic
1088817052 11:113428567-113428589 GTGTGTGGCTGGGGCGTTTGTGG + Intronic
1089140494 11:116280302-116280324 GTGTGTGAAGAGGGAGTAGGTGG + Intergenic
1089309811 11:117550638-117550660 GTGCGTGTCCAGGGAGCTGGCGG - Intronic
1089554990 11:119311305-119311327 GTTTTTGCCCAGGTCGTTGGAGG + Exonic
1090848970 11:130554660-130554682 GGCTGTGACCAGGGTGATGGTGG + Intergenic
1091328633 11:134712880-134712902 GTGAGTGACAAGGGCGGAGGAGG + Intergenic
1091842477 12:3630889-3630911 GTGGGAGACCAGGAAGTTGGAGG + Intronic
1092086971 12:5770610-5770632 GTGTTTGGCCAGGGTATTGGTGG - Intronic
1092214594 12:6672278-6672300 GTGTGTGTCCGGGGCGGGGGTGG + Intronic
1099883811 12:88502080-88502102 GTATGTGACCTGAGCCTTGGTGG + Intronic
1102898211 12:116615479-116615501 GTGAGTGACCAGGTCATGGGTGG + Intergenic
1106585986 13:31056491-31056513 CTTTGTGACAAGGCCGTTGGGGG - Intergenic
1107574656 13:41705282-41705304 GTGTGTGTGCAGGGGGTCGGGGG + Intronic
1108764275 13:53607531-53607553 GGGAGTGGCCTGGGCGTTGGTGG - Intergenic
1112665558 13:101568600-101568622 GTGTGTGGCCTTGACGTTGGTGG + Intronic
1113511203 13:110856076-110856098 GTGTGTGCCCAGCACGTTGTGGG + Intergenic
1113836463 13:113331304-113331326 GTGCATGACCTGGGGGTTGGGGG + Intronic
1120822698 14:88927669-88927691 GTTTGTGGCCAGGGCATGGGTGG + Intergenic
1122689054 14:103522962-103522984 GTGGGCGGCCAGGGTGTTGGGGG - Exonic
1122842406 14:104472883-104472905 GTGTGTGTTCAGGGCCTGGGAGG - Intergenic
1125750216 15:42022796-42022818 GTCTGTGGCCAGGGGGTTGGGGG + Intronic
1126377242 15:48008627-48008649 GCGTGTGAGCTGGGCCTTGGAGG + Intergenic
1127863359 15:63012530-63012552 GTCTGTGGCCTGGGGGTTGGAGG - Intergenic
1127949508 15:63790646-63790668 GTGATTGCCCAGGGGGTTGGTGG + Intronic
1129061103 15:72861027-72861049 GGGATTGACCAGGGCCTTGGAGG + Intergenic
1129456169 15:75677144-75677166 GTGTATGCCCACGGCGGTGGGGG - Exonic
1129547501 15:76412421-76412443 GTGTGTGGCCAGGGGGTTTATGG + Intronic
1131284139 15:91043634-91043656 GTGTGTGAGCAGGGCTGGGGAGG - Intergenic
1132642841 16:985446-985468 GTGTGTGACCAGGGCGGGAGGGG + Exonic
1132725371 16:1336126-1336148 GCGTGTGACAGGGGCGATGGGGG - Intronic
1136591946 16:31222972-31222994 GTGTGTGACCAGGCAGTTGATGG + Intronic
1137350812 16:47712688-47712710 GTGGGTGTCCAGGCAGTTGGCGG - Intergenic
1137485274 16:48885482-48885504 GTGGGGGACCAGGGGGTGGGTGG - Intergenic
1139385561 16:66566790-66566812 GTGTGTGCAGAGGGCGTGGGGGG - Exonic
1140884267 16:79229141-79229163 TCGTGTGACCTGGGTGTTGGGGG - Intergenic
1141743817 16:85912810-85912832 CTGCGTGTCCAGGGCGTTGAGGG + Intronic
1142193021 16:88726524-88726546 GTGAGTGGCCAGGACGGTGGCGG - Intronic
1143405017 17:6671533-6671555 TTGTGTGTCCTGGCCGTTGGGGG + Intergenic
1145924118 17:28633185-28633207 GTGAGTGACCAGGGCACTGAGGG - Intronic
1150227908 17:63533766-63533788 GTGGGTGACCACGGCTCTGGTGG - Intronic
1151415242 17:73957790-73957812 GTGTGTCCCCAGGGAGGTGGCGG - Intergenic
1151788219 17:76287015-76287037 GTGTGTGGGCAGGGGGTGGGGGG - Intronic
1157329956 18:46696466-46696488 GGGTGTGATGAGGGCATTGGAGG - Intronic
1157823048 18:50787974-50787996 GTGTGGGAACGGGGCGGTGGGGG - Intergenic
1161105903 19:2443925-2443947 GTGTGTGACCAGGGTGCTCATGG - Intronic
1164323736 19:24174193-24174215 GTCTGTGCCCTGGGTGTTGGGGG + Intergenic
1166540008 19:43598990-43599012 GTGGGTGATTAGGGCTTTGGAGG - Exonic
1167218572 19:48182420-48182442 TGATGTGACCAGGGCGGTGGTGG + Intronic
1167344189 19:48935112-48935134 GTGAGTGGCGAGGGCGATGGGGG + Intronic
925296981 2:2783759-2783781 GTGAGTGACCAGGGTTTTGAGGG + Intergenic
926294771 2:11561082-11561104 GTGTGTGTCCAGGGAGTTGCAGG + Intronic
927431178 2:23027537-23027559 GTGTGTGGCCAGGGTGTGGAAGG - Intergenic
929872660 2:45771951-45771973 GTGTGTGTTCAGAGAGTTGGGGG - Intronic
932338326 2:70943602-70943624 GTGTGTGAGCAGGGTGTTTGGGG + Intronic
935821291 2:106895502-106895524 CTGAGTGACCAGGGGGTGGGTGG - Intergenic
946305289 2:218853461-218853483 GAGTGTGAACAGGGCGTGGAGGG + Intergenic
949059037 2:241946130-241946152 GTGTGTGGCCATGGCCGTGGAGG + Intergenic
1169404907 20:5315141-5315163 GTGCATGACCAGGGCGCTGTAGG + Intergenic
1171279475 20:23883759-23883781 GGCTGGGACCAGGGAGTTGGGGG - Intergenic
1171429257 20:25070447-25070469 GTCTGTGTGCAGGGGGTTGGGGG - Intergenic
1173839765 20:46149825-46149847 GTGTGTGAGCAGAGGTTTGGGGG - Intergenic
1175908532 20:62393555-62393577 GTGTGTGACCAGGGCGTTGGTGG + Exonic
1175970554 20:62684715-62684737 GAGTGTGTCCAGGGCAGTGGGGG - Intronic
1176360971 21:5996088-5996110 GTGGGTGTCCACGGTGTTGGTGG + Intergenic
1176817857 21:13623405-13623427 GTCTGTGACCTGGGAGTTGTGGG + Intronic
1178936841 21:36870191-36870213 GTGTGTGTCCAGGTCACTGGTGG - Intronic
1179762547 21:43542462-43542484 GTGGGTGTCCACGGTGTTGGTGG - Intronic
1180104005 21:45605386-45605408 GTGGGTGTCCACGGTGTTGGTGG + Intergenic
1180170739 21:46056953-46056975 GTGTGGGACGTGGGCGTGGGGGG + Intergenic
1181550096 22:23633119-23633141 GAGTGGGACCAGGGCCCTGGGGG - Intergenic
1181798288 22:25326422-25326444 GAGTGGGACCAGGGCCCTGGGGG + Intergenic
1183969767 22:41468334-41468356 GAGCTTGCCCAGGGCGTTGGAGG - Intronic
1184292746 22:43506742-43506764 GGGTGGGGCCAGGGCGGTGGTGG + Exonic
950191037 3:10976336-10976358 GTGTCTGACCCGGGGGTGGGAGG - Intergenic
950553775 3:13682898-13682920 GTGTGTGACAAGGAGGTTGGTGG - Intergenic
953369302 3:42373557-42373579 GTGTGTGTGCAGGTCCTTGGGGG + Intergenic
953492839 3:43364754-43364776 GTGTGAGGCCAGGGTGTGGGTGG + Intronic
955114711 3:55986156-55986178 GTGTGTGCCCAGGGCTTTTGGGG - Intronic
955622206 3:60877010-60877032 GTGGGTGTCCAAGGTGTTGGTGG - Intronic
959905033 3:111701955-111701977 TTGTGTGAGCAGGCCATTGGAGG + Intronic
960998753 3:123358186-123358208 GTGTGTGTGTAGGGAGTTGGTGG + Intronic
961306366 3:125960880-125960902 GTGTGTGCCCACGGGGGTGGCGG - Intergenic
961514537 3:127424522-127424544 GTGTGTGAACAGGGAGAGGGAGG - Intergenic
961514542 3:127424549-127424571 GTGTGTGAACAGGGAGAGGGGGG - Intergenic
964740010 3:159955207-159955229 GTGTGAGGCAAGGGAGTTGGAGG + Intergenic
965714525 3:171588303-171588325 GTGTGTCTGCAGGGTGTTGGTGG + Intergenic
965887724 3:173468933-173468955 GTGTGTGACTAGGGTATTGCAGG + Intronic
967282560 3:187836328-187836350 GTGTGTGACCAGGTTGATTGGGG - Intergenic
969232787 4:5843222-5843244 CTGTCTAACCAGGGGGTTGGAGG - Intronic
972250330 4:37292965-37292987 GTTCGTGACCTGGGGGTTGGGGG + Intronic
978276814 4:106961552-106961574 GTGTGTGTGCAGGCTGTTGGCGG - Intronic
979249756 4:118553923-118553945 GTGTCTGACCCGGGCTGTGGTGG - Intergenic
981045560 4:140261858-140261880 ATGTGTGACCAGGGCTTGGAAGG + Intronic
985702705 5:1383243-1383265 GAGGGTGAGCAGGGGGTTGGGGG - Intergenic
986233242 5:5885745-5885767 GACAGTGACCAGGGCCTTGGTGG + Intergenic
993418059 5:87659996-87660018 GTGTGTGTCCAGGGCGGGGCGGG + Intergenic
994164213 5:96592058-96592080 GTGTTTGACCAGTGCTTTGAAGG + Intronic
996802367 5:127417813-127417835 GTGAGTGACTAGGGCTCTGGAGG + Intronic
998149154 5:139747253-139747275 GTGTGTGTGCGGGGGGTTGGGGG - Intergenic
1002319771 5:178368056-178368078 GTGTGTGAGCAGAGCCTTGAAGG + Intronic
1003083475 6:3041716-3041738 TTGTGTAACCATGGGGTTGGGGG - Intergenic
1003422197 6:5968632-5968654 GGGTGTGGCCTGGGCATTGGGGG - Intergenic
1004187315 6:13432052-13432074 GTGTGTGACTTGGGCCTTGCTGG - Intronic
1004221773 6:13753512-13753534 GTGTGTGAACAGGCTGTTAGGGG + Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1010798485 6:80146124-80146146 GAATGTGGCCAGGGTGTTGGAGG + Intronic
1010982536 6:82385289-82385311 GAGTGTGAACAGGGCCCTGGAGG + Intergenic
1014265072 6:119268348-119268370 ATGTGTGACCAGGGCGTTACAGG - Intronic
1015466845 6:133557696-133557718 GTCTGTTACCAGGGCTTTGGTGG - Intergenic
1016201777 6:141419030-141419052 GTGGGGGAGCAGGGAGTTGGGGG - Intergenic
1016427554 6:143950368-143950390 GTTTGTGACCAGGGCTGTTGAGG - Intronic
1018182121 6:161233057-161233079 GTGTGTGACCAGGGTGTGGTGGG - Intronic
1021655170 7:22867636-22867658 GGGTGGGACCATGGGGTTGGGGG - Intergenic
1026552099 7:71377457-71377479 GCCTGTGACCATGGTGTTGGGGG + Intronic
1027180594 7:75936656-75936678 GTGTGTGGGCAGGGGGTTGGGGG + Intronic
1029218605 7:98970221-98970243 ATGTGTGACCATGGCGAAGGCGG - Exonic
1029620450 7:101687098-101687120 CTGTGTGACTAGGGGGTTGGAGG - Intergenic
1029807105 7:103009517-103009539 GTGTGATAGCAGGGTGTTGGGGG - Intronic
1029860077 7:103561689-103561711 AGGTGTGACCGGGGCTTTGGTGG - Exonic
1035140763 7:156758216-156758238 GTCTGGGACCAGGTCCTTGGGGG + Intronic
1037690721 8:21179359-21179381 GTGTGTGCCCAGGGCTTTCTGGG - Intergenic
1038801874 8:30756753-30756775 GTGTTTGACCAGGGTGATGAAGG + Exonic
1039596147 8:38791495-38791517 ATGTGTGACAAGGCCATTGGCGG - Intronic
1041282851 8:56229019-56229041 GTGTGTGCCTAGAGCGTTAGGGG + Intergenic
1042845905 8:73169383-73169405 GTGTGTCACCAGGGTATAGGAGG + Intergenic
1047792876 8:128222724-128222746 GTCTGGGACAAGGGAGTTGGAGG - Intergenic
1047925969 8:129682982-129683004 GGGTGTGGCCTGAGCGTTGGAGG - Intergenic
1049178720 8:141209452-141209474 GTGGGTGACCGGGGCTCTGGCGG - Intronic
1049314575 8:141956557-141956579 GTGTTTGGCCAGAGCGTGGGAGG - Intergenic
1049582277 8:143418200-143418222 GTGTGTGGGTAGGGGGTTGGAGG - Intergenic
1052815945 9:33102683-33102705 GTGTGGGAGCAGGGCGATGGAGG - Intergenic
1056331160 9:85522462-85522484 GTGTGTGTCCAGAGGGCTGGTGG - Intergenic
1060472682 9:123961605-123961627 GTGGGTGACCAGGGATTTGGGGG + Intergenic
1061014726 9:127975097-127975119 GTGAGGGACCAGGGGGGTGGAGG + Intronic
1062463956 9:136673092-136673114 GCAGGTGACCAGGGCGGTGGAGG - Intergenic
1062490750 9:136803797-136803819 GCGTGTGGCCAGGGCAGTGGAGG + Intronic
1203529502 Un_GL000213v1:126096-126118 GTCTGTGACCTGGGAGTTGTGGG - Intergenic
1185747083 X:2582452-2582474 GTATGTGAGCTGGGAGTTGGGGG + Intergenic
1187503152 X:19856720-19856742 GTCTGTGATCAAGGTGTTGGTGG - Intronic
1188379439 X:29473065-29473087 GTGTGAGATCAAGGTGTTGGTGG + Intronic
1199676432 X:150193760-150193782 GTGGTTGACCTGGGCCTTGGAGG - Intergenic
1200213291 X:154356414-154356436 GTGTGTGCGCAGGGCGGGGGAGG - Intronic