ID: 1175908638

View in Genome Browser
Species Human (GRCh38)
Location 20:62394116-62394138
Sequence GTGGACACCCAGCGCCGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175908638 Original CRISPR GTGGACACCCAGCGCCGTCA GGG (reversed) Intronic
905170747 1:36108311-36108333 GTGGCCAAGCAGGGCCGTCAAGG + Intronic
905369510 1:37475563-37475585 GAGGACAGCCACAGCCGTCAGGG + Exonic
914704496 1:150159819-150159841 GTGGACTCCCTGTGCCGTCTTGG - Exonic
919861095 1:201739972-201739994 GTGGGCACCCAGCGCCCCCCAGG - Intronic
924594745 1:245435251-245435273 GAGGACAGCCACCGCCCTCAGGG + Intronic
1070600701 10:77864465-77864487 CAGGACACCCAGAGCCGTCCAGG + Intronic
1076112970 10:127874688-127874710 GAGGCCACCCTGAGCCGTCAAGG + Intergenic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1081228289 11:40552539-40552561 CTGGACATCCAGTGCCCTCATGG - Intronic
1083842081 11:65310311-65310333 GTGCACACCCAGCATCGCCATGG - Intergenic
1084688946 11:70713699-70713721 ATGGACACCCGGCGCTGTGACGG - Intronic
1084694450 11:70745349-70745371 GTGGGCACCCAGGGCTGGCATGG - Intronic
1088772107 11:113045258-113045280 GTGGACTCCCTCCACCGTCATGG + Intronic
1091550312 12:1531044-1531066 GCGGACACCCAGCGCGGCCGCGG - Intronic
1095820729 12:46476014-46476036 ATGGACAACCAGCACCCTCAGGG - Intergenic
1095943875 12:47742809-47742831 GTGGACTCCCAGACCCGTGAAGG - Intronic
1110776914 13:79418432-79418454 GTGAACACTCAGCCCAGTCAGGG - Intergenic
1114075847 14:19160778-19160800 GTGGACACCCAGCGCCCAGATGG - Intergenic
1114086316 14:19238794-19238816 GTGGACACCCAGTGCCCAGATGG + Intergenic
1115451578 14:33553880-33553902 GTGGACTCCAAGCGACTTCAAGG - Intronic
1121453967 14:94026819-94026841 GCGCCCACCCAGCGCCGTCGAGG - Intronic
1122136868 14:99638471-99638493 GTGGACACCCAGCGCCTCTCTGG - Intergenic
1123019372 14:105390467-105390489 GTGGAGACCCAGGGCTGGCAGGG - Intronic
1202897857 14_GL000194v1_random:20413-20435 GTGGACACCCAGCGCCCAGATGG + Intergenic
1132839851 16:1973712-1973734 CTGGCCACCCACCGCCGGCAGGG + Intronic
1132880035 16:2158117-2158139 ATGGACACCCTGCGGGGTCAGGG + Intronic
1134689023 16:16178855-16178877 GTGGGCATCCAGGGCCGCCAGGG + Exonic
1136453972 16:30370137-30370159 GTGGCCCCGCCGCGCCGTCATGG - Exonic
1142365553 16:89647896-89647918 GTGGACACCCAGCGCGGGGTCGG + Intronic
1146431130 17:32796003-32796025 TTGGACACTCAGCACCGTTAAGG - Intronic
1147473289 17:40684758-40684780 CTGGAGACCCAGCTCCTTCAAGG - Intergenic
1150067706 17:62125392-62125414 GTGGTCACCCACCTCTGTCAAGG - Intergenic
1152820905 17:82437211-82437233 GTGGGCAGCCAGTGCCTTCAAGG + Exonic
925584965 2:5456412-5456434 CTGGACACCCCGGGCAGTCATGG - Intergenic
935255804 2:101308662-101308684 GCGGACACCCACCGCCGCCCTGG + Exonic
937408255 2:121650042-121650064 GTGGACACACAGCTCTGTTACGG - Intergenic
942276462 2:174327206-174327228 GGGGACGCCCAGCCTCGTCAAGG + Intergenic
947434239 2:230059182-230059204 GAGGACACCCAGGGCCATCTGGG + Exonic
948707832 2:239806218-239806240 GTGAACACCATGCGCCGTGAGGG - Intergenic
1169164066 20:3407529-3407551 GTGTACCCCCCGCGCCGGCAGGG - Exonic
1173329740 20:42065088-42065110 CTGGACATCCAGCCCAGTCAAGG + Intergenic
1174897622 20:54467711-54467733 GTGGACAGCCAGCTCCATGAGGG + Intergenic
1175908638 20:62394116-62394138 GTGGACACCCAGCGCCGTCAGGG - Intronic
1175997392 20:62817761-62817783 GGGGACAGCCAGTGCCTTCACGG + Intronic
1176159362 20:63640723-63640745 GTGGACACCCTGGGCCTTCCTGG - Exonic
1176617541 21:9036402-9036424 GTGGACACCCAGCGCCCAGATGG + Intergenic
1178272926 21:31209953-31209975 GTGGAAACCCAGAGCCGTGTGGG - Intronic
1178686470 21:34715183-34715205 GTGGAGACCCAGAGCCATAAAGG - Intronic
1179552440 21:42151512-42151534 GGGGCTACCCAGGGCCGTCAGGG + Intergenic
1180291547 22:10853942-10853964 GTGGACACCCAGCGCCCAGATGG - Intergenic
1180494352 22:15883364-15883386 GTGGACACCCAGCGCCCAGATGG - Intergenic
1180871475 22:19149505-19149527 CCGGACGCCCAGCGCCGTCCAGG + Intronic
1181778872 22:25178695-25178717 GTGGACACCCTGGGCCTTCCTGG - Intronic
1185070340 22:48652559-48652581 CTGGCCACCCAGCGCCATCCAGG + Intronic
950707600 3:14792734-14792756 GTGGCCACCCCGGGCCGGCAAGG - Intergenic
959936414 3:112034074-112034096 GTTGACACCCAGTGCCCACAGGG + Intergenic
959992478 3:112644520-112644542 GAGGCCACCCAGTGCCGTAATGG - Intronic
969334705 4:6500843-6500865 ATGAACACCCAGCTCCCTCAGGG - Intronic
969423734 4:7111831-7111853 GTGCCCACCCAGCACCTTCATGG - Intergenic
972416183 4:38842686-38842708 ATGGCCACCCAGCTCCGACAGGG + Intronic
975800879 4:78057999-78058021 GAGGACACCCATCGCCGCCTCGG - Exonic
983941535 4:173538445-173538467 GTGGACCCCCAGCTCCGTCTCGG + Intergenic
985956696 5:3271066-3271088 GTGGCCACCCAGCACGGCCAGGG + Intergenic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1004163491 6:13235167-13235189 GTGGACACACAGAGACCTCAGGG + Intronic
1010657629 6:78530453-78530475 GAGGACACCCAGCACTGACAGGG + Intergenic
1012548670 6:100448552-100448574 GCTGCCTCCCAGCGCCGTCACGG - Exonic
1017816751 6:158021851-158021873 GTTGACACCCAGCTCCCTGAGGG + Intronic
1018727708 6:166626817-166626839 GTGGACCCCGAGACCCGTCAGGG - Intronic
1019607476 7:1917389-1917411 GTGGGCACCCAGCCCTGTCTCGG - Intronic
1024930616 7:54664152-54664174 GTGACCTCCCAGCGCCGTCCTGG + Intergenic
1031078773 7:117238727-117238749 CTGGACACCCTGGGCCGTCTCGG + Intergenic
1034427013 7:151019264-151019286 GTGGATGTCCAGCTCCGTCAGGG + Exonic
1035033700 7:155881634-155881656 GTGTCCACCCAGAGCTGTCATGG + Intergenic
1035657463 8:1320710-1320732 GTGCACACCCACCCCAGTCATGG + Intergenic
1047163316 8:122406921-122406943 GGGGACACCCAGCCCAGTCTTGG - Intergenic
1053104818 9:35400450-35400472 GTGGATACCCAAAGCCCTCAGGG - Intronic
1053644800 9:40114005-40114027 GTGGACACCCAGGGCCCAGATGG - Intergenic
1053761185 9:41350846-41350868 GTGGACACCCAGGGCCCAGATGG + Intergenic
1054325821 9:63711885-63711907 GTGGACACCCAGGGCCCAGATGG - Intergenic
1054539776 9:66261964-66261986 GTGGACACCCAGGGCCCAGATGG + Intergenic
1060479898 9:124011905-124011927 GCGGACACCTAGCGGCTTCAGGG + Exonic
1062475142 9:136722984-136723006 CTGGCCAACCAGCGCCGGCAGGG - Exonic
1062517663 9:136944377-136944399 GGGGACACCAGGCGCCGTCCGGG + Intronic
1062598718 9:137310715-137310737 GTGGGCACCCAGCCCCCTCCTGG - Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic