ID: 1175909041

View in Genome Browser
Species Human (GRCh38)
Location 20:62395873-62395895
Sequence ACAGCCTCTCAGGGTGCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 297}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175909031_1175909041 8 Left 1175909031 20:62395842-62395864 CCACAGGAACAGCCCCTGCGGCC 0: 1
1: 0
2: 1
3: 22
4: 276
Right 1175909041 20:62395873-62395895 ACAGCCTCTCAGGGTGCAGCCGG 0: 1
1: 0
2: 0
3: 34
4: 297
1175909034_1175909041 -6 Left 1175909034 20:62395856-62395878 CCTGCGGCCTCCCCGACACAGCC 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1175909041 20:62395873-62395895 ACAGCCTCTCAGGGTGCAGCCGG 0: 1
1: 0
2: 0
3: 34
4: 297
1175909033_1175909041 -5 Left 1175909033 20:62395855-62395877 CCCTGCGGCCTCCCCGACACAGC 0: 1
1: 0
2: 0
3: 24
4: 163
Right 1175909041 20:62395873-62395895 ACAGCCTCTCAGGGTGCAGCCGG 0: 1
1: 0
2: 0
3: 34
4: 297
1175909032_1175909041 -4 Left 1175909032 20:62395854-62395876 CCCCTGCGGCCTCCCCGACACAG 0: 1
1: 0
2: 1
3: 21
4: 214
Right 1175909041 20:62395873-62395895 ACAGCCTCTCAGGGTGCAGCCGG 0: 1
1: 0
2: 0
3: 34
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175909041 Original CRISPR ACAGCCTCTCAGGGTGCAGC CGG Intronic
900555003 1:3275942-3275964 ACAGACCCACAGGGCGCAGCTGG - Intronic
900704951 1:4074698-4074720 ACAGACTCTCAGGGCCCTGCTGG + Intergenic
900952446 1:5865515-5865537 AGAGGCTCTCAGGGCGCAGCAGG + Intronic
901397024 1:8988995-8989017 ACAGCCTCTCAGTGGGATGCTGG + Intergenic
902251098 1:15154536-15154558 ACAACGTCCCAGGGTGCGGCGGG + Intronic
903317289 1:22518150-22518172 TCAGCCTCTCTTGTTGCAGCAGG + Intronic
904276679 1:29389498-29389520 ACAGCAGCTCAGGGTCCAGCAGG - Intergenic
904323874 1:29714544-29714566 AAAGCCTCTCAGGGAGTTGCTGG - Intergenic
905210954 1:36373938-36373960 ACTTCCTCTCTGGCTGCAGCAGG - Intronic
906151838 1:43592054-43592076 ACAGCCTCTAAGGTTTCTGCTGG + Intronic
906791283 1:48660525-48660547 ACAGCCCCACAGGGCACAGCTGG - Intronic
907808959 1:57849530-57849552 ACAGAGTCTCAGGATGCAGGAGG + Intronic
907831222 1:58065983-58066005 CCAGCCTCTGAGAGTGCAGTGGG - Intronic
908477605 1:64505410-64505432 GCAGCCTCCAAGGGTGCAGCAGG - Intronic
912460757 1:109829407-109829429 CCAGCCTCATAGGGGGCAGCTGG - Intergenic
915041153 1:152969291-152969313 GCAGCTGCTCAGGGTGGAGCTGG - Intergenic
915968551 1:160334679-160334701 AGATCCTGTCAGGGTGCAACTGG + Intronic
916666579 1:166973204-166973226 ACAGCCTCTCCAGGTGCAGGTGG + Intronic
917557192 1:176102094-176102116 CCATCCTCTCAGTGTGCAGATGG - Intronic
917582383 1:176391919-176391941 ACAGCCTCCCTGGCTCCAGCAGG + Intergenic
917701854 1:177589756-177589778 GCAGGGTCTCAGGGTGCAGATGG + Intergenic
918515588 1:185359135-185359157 AAAGCCTCTGATGGGGCAGCAGG - Intergenic
918659421 1:187071659-187071681 TCAGCCTCCCAAGGTGCTGCTGG + Intergenic
919031825 1:192251989-192252011 CCAGCCTCCCTGGCTGCAGCAGG + Intergenic
919847738 1:201652070-201652092 ACAGGCCCTCAGTGTACAGCAGG + Intronic
920413838 1:205784280-205784302 TGAGCCTCTGAGGATGCAGCTGG + Intergenic
920825765 1:209423123-209423145 AGAGCCTCTCATGGGGCAGGGGG + Intergenic
923014037 1:230112300-230112322 ACTCCCTCTCAGGGTGCGCCTGG - Intronic
1063203131 10:3804756-3804778 ACAGATTCTCAGTATGCAGCAGG + Intergenic
1064440453 10:15348679-15348701 ACAGCCTCTCAGGGGCCACACGG + Intronic
1065445015 10:25789156-25789178 ACAGACTTTGGGGGTGCAGCTGG + Intergenic
1066241957 10:33546295-33546317 ACAGGATCTCAGTGTGAAGCTGG + Intergenic
1066400887 10:35074602-35074624 ACAGCCTCTCAAGGAGCTGGGGG + Intronic
1067233457 10:44427550-44427572 ACAGTCTTGCAGGGAGCAGCAGG - Intergenic
1069717428 10:70530013-70530035 CCAGCCTCTCAGGGTTCAGGCGG + Exonic
1071059050 10:81548425-81548447 CCAGCCTCTCTGGCTCCAGCAGG - Intergenic
1071431717 10:85611962-85611984 ACAGCCACTGAGGCTGCAGCTGG + Intronic
1071440802 10:85691934-85691956 ACAGTCTCCCAGTGTGCAGTGGG - Intronic
1071496086 10:86168588-86168610 GCAGCTCCTCAGGGTGCAGTGGG - Intronic
1072624333 10:97101318-97101340 ACAACCTCTCGGGGAGCAGAAGG + Intronic
1072891690 10:99330038-99330060 GCAGCCACGCAGGGGGCAGCAGG - Exonic
1073292305 10:102419321-102419343 CCACCCTCCCAGGATGCAGCAGG + Intronic
1076600559 10:131654538-131654560 CCAGCCTCTCAGAGGGAAGCAGG - Intergenic
1076850444 10:133089893-133089915 GCAGCACCTCAGGGGGCAGCAGG + Intronic
1077238033 11:1492542-1492564 GGAGCCTCTCAGGCTGCAGGTGG + Intronic
1077366395 11:2162981-2163003 CCAGCCCCTGAGGTTGCAGCTGG - Intergenic
1077372735 11:2191123-2191145 GCAGCCTCCCAGTGTGCAGGGGG + Intergenic
1078450095 11:11434394-11434416 ACAGGCACTGAGGGTACAGCAGG + Intronic
1079272399 11:19000489-19000511 ACAGCATCTCTGGGTGCTGGGGG - Intergenic
1079276063 11:19038845-19038867 CCAGTCCCTCAGGATGCAGCTGG - Intergenic
1083205666 11:61147310-61147332 GCAGCATTTCTGGGTGCAGCCGG + Intronic
1084340759 11:68498515-68498537 ACACCCTCTCTAGGGGCAGCCGG + Intronic
1084890526 11:72234603-72234625 ACAGCCTCACCGTGGGCAGCTGG - Exonic
1084973916 11:72786049-72786071 AGAGACCCTCAGGGTGCAGCAGG + Intronic
1085533656 11:77205771-77205793 GCAGCTGCTCAGGATGCAGCTGG + Intronic
1085535032 11:77212508-77212530 AAAGCCTCTCAGGCTGCGGGTGG + Intronic
1085866843 11:80304252-80304274 ACAGGCTCTCAGGGGGAAGGGGG + Intergenic
1087201205 11:95346417-95346439 AGAGCCTCTCTGGGTGCTGTGGG + Intergenic
1087681582 11:101224405-101224427 ACAGCCTGTCAGGATGCCTCTGG - Intergenic
1088675209 11:112186201-112186223 ACAGCCTCTCCTTCTGCAGCAGG - Intronic
1091068423 11:132540422-132540444 ACAACCTCTCAGGATCCAGTGGG + Intronic
1091234120 11:134008339-134008361 TCAGCCTCTCAAAGGGCAGCAGG - Intergenic
1091347730 11:134866546-134866568 ACAGGATCACAGGGGGCAGCTGG - Intergenic
1092215539 12:6679212-6679234 TCAGCCTCTCAGGCTGAAGAGGG - Intronic
1092700893 12:11229572-11229594 AAGGCCTCTCAGGGAACAGCAGG + Intergenic
1093194336 12:16112302-16112324 CCAGCCTCTCAGGCTCCAGGGGG - Intergenic
1094236487 12:28173148-28173170 ACATCTTCACATGGTGCAGCAGG + Intronic
1096719940 12:53513731-53513753 GGAGCCTCTCAGTGTGGAGCAGG + Exonic
1096761917 12:53849081-53849103 TCAGCCTCACAGGGTGCGGGTGG + Intergenic
1096901955 12:54892465-54892487 TCAGCCTCTCAAAGTGCTGCTGG - Intergenic
1097147152 12:56949590-56949612 AGAGCATCTCTGGGTGCTGCGGG - Intergenic
1099912981 12:88856245-88856267 CCAACCTATCACGGTGCAGCTGG - Intergenic
1100028109 12:90153470-90153492 ACAGCCTCCCTGGCTCCAGCAGG - Intergenic
1100390241 12:94141202-94141224 ACAGCCACCCACAGTGCAGCAGG + Intergenic
1100984061 12:100188255-100188277 ACAGCCTCCCTGGGTGCACCAGG - Intergenic
1101062518 12:100987001-100987023 GCAGCCTCTCAGCAGGCAGCCGG - Intronic
1101734891 12:107455789-107455811 ACGGCCTCTGATGGTACAGCTGG + Intronic
1103593061 12:122005973-122005995 TCAGCCTCCCAGGATACAGCTGG + Intergenic
1104943221 12:132404488-132404510 ACAGCCCCTCAGGATCCACCAGG - Intergenic
1107140617 13:36994894-36994916 ACTGCCTCTCACAGTGCATCTGG + Intronic
1107575715 13:41719598-41719620 AAAGCCTACCAGTGTGCAGCTGG - Exonic
1112212739 13:97396875-97396897 TCAGCCTCTCTGGATGCAGTTGG - Intergenic
1112609419 13:100941345-100941367 ACAGCTAATCAGGGTGCAGCAGG + Intergenic
1113565272 13:111315960-111315982 CCAGCCTCACAGAGTGCAGAGGG - Intergenic
1113777169 13:112954403-112954425 ACAGCACGTCAGGATGCAGCTGG - Intronic
1114055657 14:18965328-18965350 CCAGGCTCACAGGGAGCAGCTGG - Intergenic
1114106889 14:19436435-19436457 CCAGGCTCACAGGGAGCAGCTGG + Intergenic
1118330854 14:64814985-64815007 ACAGCCCCTCAGGTGGCAACTGG + Intronic
1118961412 14:70537141-70537163 AGAGACTCTCAGGATCCAGCGGG - Intergenic
1120022519 14:79546793-79546815 ACAACCTGTCAGGCTTCAGCTGG - Intronic
1121759879 14:96435865-96435887 AGAGCATCTCTGGGTGCTGCAGG - Intronic
1122094440 14:99361078-99361100 AGAGCCTCTCATGGTGGGGCAGG - Intergenic
1122133773 14:99620837-99620859 ACACCCTCTGAAGGAGCAGCAGG + Intergenic
1122883319 14:104699739-104699761 ACAGCCTCTCAGGATGCTCCTGG + Intronic
1124246871 15:28078634-28078656 ATAGCATCTCAGTGTTCAGCTGG - Intronic
1128565835 15:68699987-68700009 ACCCCCTCCCAGGCTGCAGCGGG - Intronic
1128660641 15:69498630-69498652 ACAACTTCTCTGGGTGCAGATGG + Intergenic
1128730375 15:70016653-70016675 ACAGCCTCTCAGCCTGCTGGAGG - Intergenic
1129057897 15:72835139-72835161 ACAAGCTCTCAGGATGCAGCTGG - Intergenic
1130158062 15:81370418-81370440 CCAGGGTCTCAGAGTGCAGCTGG - Intronic
1130991444 15:88878221-88878243 TCAGCTTCTCAGGGTGCTCCAGG + Exonic
1131098624 15:89671415-89671437 ACCGCCTCTCAGGGAGGAGAGGG - Intronic
1131612558 15:93980371-93980393 ACAGCATCTGAGGAAGCAGCTGG - Intergenic
1132846999 16:2005277-2005299 GCAGCCACTCAGGGTGCTGCTGG + Intronic
1132847012 16:2005334-2005356 GGAGCCACTCAGGGTGCTGCTGG + Intronic
1132892925 16:2213335-2213357 CCAGCCCCTCAGGGGGCAGAGGG - Exonic
1133285205 16:4687483-4687505 ACAGCGTCTCAGGCTGGAGTGGG - Intronic
1135487615 16:22879714-22879736 TCAGCCTCTCTGGGGGCCGCTGG + Intronic
1135776768 16:25263351-25263373 AAAGCTCCTCAGGGTGCAGAGGG + Intergenic
1136716450 16:32287069-32287091 ACAGCTCCTCAAGGTGGAGCAGG - Intergenic
1136716534 16:32287379-32287401 ACAGCTCCTCAAGGTGCAGCAGG - Intergenic
1136834836 16:33493347-33493369 ACAGCTCCTCAAGGTGGAGCAGG - Intergenic
1136834922 16:33493657-33493679 ACAGCTCCTCAAGGTGCAGCAGG - Intergenic
1137001675 16:35234917-35234939 ACATCCCCTCAGGGTGAAGGTGG - Intergenic
1138519221 16:57561447-57561469 AAAGCCTCTCAGGAAGCTGCTGG - Intronic
1139375408 16:66493617-66493639 TCACCGCCTCAGGGTGCAGCAGG + Intronic
1139388237 16:66588314-66588336 ACTGACTGTCAGGGTGCAGAGGG + Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140610585 16:76593773-76593795 AGAGCTTCTCAGGGTAAAGCAGG - Intronic
1141644589 16:85360413-85360435 GCAGCCTGACAGGGAGCAGCTGG - Intergenic
1141984409 16:87570715-87570737 ACAGCCTCACAGCCAGCAGCAGG + Intergenic
1203009881 16_KI270728v1_random:230375-230397 ACAGCTCCTCAAGGTGCAGCAGG + Intergenic
1203009967 16_KI270728v1_random:230685-230707 ACAGCTCCTCAAGGTGGAGCAGG + Intergenic
1203145003 16_KI270728v1_random:1793635-1793657 ACAGCTCCTCAAGGTGGAGCAGG - Intergenic
1203145085 16_KI270728v1_random:1793945-1793967 ACAGCTCCTCAAGGTGCAGCAGG - Intergenic
1143248542 17:5505260-5505282 GAAGCCTCTCAGGGTGGGGCAGG - Intronic
1143492577 17:7292940-7292962 ACAGCCTCTCCCGGTGCTGAGGG + Intronic
1144047560 17:11467584-11467606 AGAGCCTCTGAGCCTGCAGCAGG + Intronic
1145017120 17:19406473-19406495 ACAGGCCCTCAGGGTGCTGCTGG - Intergenic
1145760311 17:27421790-27421812 TCAGCCTCTCAGAGGGCAGGTGG + Intergenic
1146179966 17:30691689-30691711 TCAGCTTCCCAGGGAGCAGCTGG - Intergenic
1146742398 17:35298155-35298177 AGAGACTCTCAGGATCCAGCAGG - Intergenic
1147957955 17:44147996-44148018 AAAGCCTCTGAGGGAGCAGTGGG - Exonic
1148133229 17:45274729-45274751 TTAGCCTCTGAGGGTCCAGCAGG - Intronic
1150471093 17:65438338-65438360 AAAGCCTCTGAGGGTTCTGCCGG - Intergenic
1151658560 17:75507073-75507095 GCAGCCTCACAGGCTCCAGCCGG + Exonic
1151721870 17:75861499-75861521 AGAGCCTGGCAGGGAGCAGCAGG + Intergenic
1152029616 17:77834027-77834049 TCAGCCTCTCCGTGTTCAGCAGG + Intergenic
1152512510 17:80799937-80799959 ACATCCTCTCAGATGGCAGCGGG - Intronic
1152592186 17:81219077-81219099 ACACCAACTCAGGGTGCAGCAGG + Intronic
1152594510 17:81231870-81231892 ACAGCCATTCAGGGGCCAGCCGG - Exonic
1152905798 17:82970266-82970288 GCAGCCTCTCAGGGGGCCTCGGG - Intronic
1153416794 18:4854737-4854759 ACAGCCTAACAGGGAGCAGTTGG + Intergenic
1156027882 18:32676961-32676983 ACAGCATCACAAGGTGCAGTAGG - Intronic
1156613185 18:38751660-38751682 ACAGCTTCTCAGGATGAAGCAGG + Intergenic
1158157620 18:54443355-54443377 ACAGCCTCTGATGGTGAGGCAGG - Intergenic
1158296608 18:56003389-56003411 ACTGTCTCACAGGGAGCAGCAGG - Intergenic
1158863923 18:61619328-61619350 AGAGACTCTCAGGATCCAGCAGG - Intergenic
1160251817 18:77210011-77210033 ACAGCCTCCCTGGGGTCAGCAGG - Intergenic
1160565707 18:79785586-79785608 ACAGGTTCAGAGGGTGCAGCTGG - Intergenic
1160799589 19:961450-961472 CCAGCCTCACAGGGGGCAGTGGG - Intronic
1161680842 19:5679024-5679046 TCAGCCTCTCAAGCAGCAGCTGG + Intronic
1162978642 19:14223867-14223889 TCAGCCTCCCAGGGAGCAGCTGG + Intergenic
1163034608 19:14563606-14563628 ACAGCCTGGCAGGGCTCAGCCGG - Intronic
1163591965 19:18198893-18198915 TCAGCCCGTCAGGGTGGAGCTGG - Intronic
1163677557 19:18662922-18662944 CCAGAGTCTCAGGGTGCACCTGG + Intronic
1165945823 19:39441574-39441596 CCAGCCTCTCTGGGTGTACCTGG - Intronic
1166322676 19:42028382-42028404 AGAGCCTGGCAGGGCGCAGCAGG - Intronic
1167443627 19:49524754-49524776 GCAGCCCCTCAGGGTGGAGCTGG + Exonic
925008815 2:467188-467210 ACAGCCTCCCAGGGCCCAGGTGG - Intergenic
925059573 2:880631-880653 ACGGAGTCTCAGTGTGCAGCTGG - Intergenic
927309891 2:21618218-21618240 AGAGCCTCTCTGGGTGCTGGGGG - Intergenic
927591333 2:24360473-24360495 ACAGCCGCTCAGGGCTCCGCCGG + Exonic
928170913 2:29002532-29002554 ACAGCCTCTCTGGATCCAGGGGG + Exonic
928175189 2:29028631-29028653 AAAGCCTCTCTGGCTGCCGCAGG + Intronic
931470978 2:62537367-62537389 CCAGTCTCTCAGTGTGCAGGTGG - Intergenic
931653195 2:64487398-64487420 ACAACTTCAAAGGGTGCAGCTGG - Intergenic
934698218 2:96415845-96415867 ACAGCCTCCCAGGGTGGATGGGG - Intergenic
935328170 2:101956663-101956685 ATGGCCTCTCAGCCTGCAGCAGG + Intergenic
936451514 2:112637014-112637036 ACAGCCCCACAGGGCCCAGCTGG - Intergenic
937617465 2:123943389-123943411 AGAGCCTCTCTGGGTGCTGGGGG + Intergenic
938836897 2:135113182-135113204 ACAGCGTCACTGTGTGCAGCAGG - Exonic
942689737 2:178572785-178572807 AAAAAGTCTCAGGGTGCAGCAGG + Exonic
943528230 2:189045852-189045874 CCAGGCTCTCAGGGTGCCCCTGG - Exonic
944532516 2:200681239-200681261 AGAGCCTGTCAGGTAGCAGCTGG - Intergenic
948069882 2:235112061-235112083 ACAGCATTTCAGGGTGAAGCTGG + Intergenic
948251644 2:236534774-236534796 ACAGCCTCTTGGGATGCAGCTGG + Intergenic
1169357184 20:4917214-4917236 ACAGCCATTCTGGGTGCAGCAGG + Intronic
1169782595 20:9325427-9325449 ACTACCTCTCAGAGTGCAGAAGG - Intronic
1169980590 20:11379820-11379842 CCAGCCTCTCTGGCTCCAGCAGG - Intergenic
1172100678 20:32482932-32482954 ACGGCCGCTCGGTGTGCAGCGGG - Intronic
1172210310 20:33193274-33193296 AAAGCATCTCAGAGTGGAGCAGG + Intergenic
1172996320 20:39072596-39072618 ACAGCCTCTCAGGGCCGAGCTGG - Intergenic
1174025278 20:47569067-47569089 ACAGCCTCTCATGCTGAGGCAGG + Intronic
1175348451 20:58300559-58300581 ACAGCCTTTCAAGAAGCAGCTGG - Intergenic
1175852414 20:62100597-62100619 ACTGCCTCTCAGGTGGCTGCAGG - Intergenic
1175890878 20:62315410-62315432 CCAGCCTCTCAGGCCACAGCTGG + Intronic
1175909041 20:62395873-62395895 ACAGCCTCTCAGGGTGCAGCCGG + Intronic
1175909938 20:62400342-62400364 ACACCCCCTCAGCATGCAGCTGG - Intronic
1176069199 20:63217277-63217299 ACAGCCTCTCACACTGCTGCAGG + Intergenic
1176103132 20:63373566-63373588 CCAGTGTCTCGGGGTGCAGCCGG + Intronic
1176128711 20:63487304-63487326 ACAGCCAGTCATGCTGCAGCAGG - Intergenic
1179591524 21:42412347-42412369 GCAGCCACTCAGGGGGCATCAGG + Intronic
1179790363 21:43752766-43752788 ACAGACTCTCAGGGATCAGGTGG + Intronic
1180120593 21:45745032-45745054 ACAGGCTGTCACGGAGCAGCAGG + Intronic
1180247133 21:46555525-46555547 ACTGCCTCCCTGGGTGCAACTGG - Intronic
1180474133 22:15687880-15687902 CCAGGCTCACAGGGAGCAGCTGG - Intergenic
1180755587 22:18158702-18158724 TCAGCCTCTCAGGGTGACACTGG + Intronic
1182300150 22:29332653-29332675 ACACCGTCTCAGGGAGGAGCAGG + Intronic
1182318728 22:29464630-29464652 TCAGCCCCTCTGGGTGCAGACGG + Intergenic
1183739932 22:39663831-39663853 ACAGCCACTCACGGTGCTGCCGG - Exonic
1185055917 22:48578206-48578228 ACAGAGTGTCAGGATGCAGCTGG - Intronic
950095916 3:10330363-10330385 CCTGCCTCACAGGGTGCAGAGGG + Intronic
950197573 3:11019941-11019963 ACAGCCTTCCAAGCTGCAGCCGG - Intronic
950575631 3:13830520-13830542 TCAGCCTCCCAGGGTAGAGCAGG - Intronic
951622632 3:24622290-24622312 ACAGCCTGTAAGTGTGCAGTGGG + Intergenic
951729874 3:25798661-25798683 ATAGCCTCTGAGGCTGCAGTTGG + Intergenic
954271182 3:49510628-49510650 ACAGCCTCTGAGGGTTCACTGGG - Exonic
954541055 3:51393096-51393118 ACAGTCGCTCAGTGCGCAGCCGG + Exonic
954636539 3:52074004-52074026 ACGGCCCCTCTGGGGGCAGCAGG - Intergenic
955851065 3:63220485-63220507 AGAGCCTAACAGGGAGCAGCTGG - Intergenic
957619230 3:82573487-82573509 TCAGCCTCTCAATGTGCTGCTGG - Intergenic
961148035 3:124611712-124611734 ACAGCCTTGCAGGGCACAGCAGG - Intronic
961861024 3:129916857-129916879 CCAGCCTCTCAGGGAGCCCCAGG - Intergenic
961915299 3:130368140-130368162 ACAGCCTCTCCTGCTACAGCAGG + Intronic
962375220 3:134853362-134853384 GCAGCCTCTCACAGTGGAGCTGG + Intronic
962959478 3:140297267-140297289 ACAGCCACTCTGGGTGCTGGAGG + Intronic
963049612 3:141129700-141129722 ACAGCCCCACACGGTTCAGCTGG + Intronic
963997872 3:151731769-151731791 TCAGCCTGTCAGGTTGCAGCAGG + Intergenic
965996646 3:174891476-174891498 AGAGCCTCTCTGGGTGCTGGAGG + Intronic
968596874 4:1490258-1490280 ACAGCCTCTGTGGGTGCCGGGGG + Intergenic
968600261 4:1505316-1505338 ACAGCCTCTCGGAGTGCAGTGGG + Intergenic
969448670 4:7260239-7260261 CCAGCCCCTCAGGGGGCAACTGG - Intronic
969529381 4:7722286-7722308 GCAGCCTCTCAGGGAGGGGCGGG - Intronic
970990876 4:22211702-22211724 ACAGCATCTCAGGGCCAAGCTGG - Intergenic
971176089 4:24284028-24284050 TCAGCCTCCCAGAGTGCTGCTGG - Intergenic
973737216 4:53884519-53884541 ACAGACTTTCAGGGGGCAGTTGG - Intronic
977602850 4:98952606-98952628 ACACACTCTCAGTGTGCAGATGG - Intergenic
979142346 4:117193259-117193281 ACAGCCTCTCAAAGGGCAACAGG + Intergenic
982390934 4:154863106-154863128 ACAGCCTCCCAAGGTGGTGCAGG + Intergenic
982722004 4:158869097-158869119 ACAGCCTCCCACGGTGCAGGAGG + Exonic
983059864 4:163146692-163146714 CCAGCCTCCCAGAGTGCTGCAGG - Intronic
985666289 5:1183090-1183112 ACAGCCTCTCTGGGGCGAGCAGG - Intergenic
985672566 5:1213911-1213933 TCAGCCACTCATGGTGCAGATGG - Intronic
986260726 5:6143705-6143727 AGAGCCTCACAGGGAGCAACTGG + Intergenic
986528178 5:8703582-8703604 ACAGCTTCTCTGAGTGCAGGCGG - Intergenic
987894787 5:23930368-23930390 TCAGCCTCTCAAAGTGCTGCTGG - Intergenic
989125243 5:38046599-38046621 GGAGCCTCTCAGAGTTCAGCTGG - Intergenic
989504931 5:42216177-42216199 AGAGCCTCTCTGGGTGCAGGGGG - Intergenic
989777060 5:45221972-45221994 ACAGACACTCAGGGTGTAGTAGG - Intergenic
989805110 5:45594151-45594173 TCAGCCTCTCAGGGCTCAGAGGG + Intronic
991465424 5:66907320-66907342 TCATCCTCCCAGGGTGCAGGTGG + Intronic
991986512 5:72292566-72292588 CCAGCAGCTCAGGGTGCTGCTGG - Intronic
995003000 5:107158059-107158081 CCAGCCTCCCAGGTTCCAGCAGG - Intergenic
998788815 5:145743981-145744003 CCAGCCTCCCTGGCTGCAGCAGG - Intronic
999596886 5:153214841-153214863 CCAGCCTCTCTGGCTCCAGCAGG - Intergenic
1000551326 5:162668606-162668628 ACACCCTCTAAGGGGGCTGCTGG - Intergenic
1001956788 5:175853324-175853346 ACAGCCTCACACGGTGCCCCTGG + Intronic
1004020318 6:11770824-11770846 CCAGCCGCTCAGGCCGCAGCAGG + Intronic
1006339966 6:33441511-33441533 AGGGCCTCTGAGGGTGCAGGTGG - Intronic
1006480044 6:34285048-34285070 ACCCCCTCTCAGGCTGCAGAAGG - Exonic
1007258304 6:40544023-40544045 CCAGCATCTCAGGGTGGTGCTGG - Intronic
1007293920 6:40806764-40806786 AGAGCCTCTCAGAGAGCTGCTGG + Intergenic
1007899962 6:45401810-45401832 ACTGCCACTAAGGCTGCAGCTGG - Intronic
1008176852 6:48278602-48278624 ACTGCATCTCTGGATGCAGCTGG + Intergenic
1008662701 6:53684752-53684774 TCAGCCTCTCAAGTAGCAGCTGG + Intergenic
1012714178 6:102648192-102648214 AGAGCATCTCTGGGTGCAGGAGG + Intergenic
1013357415 6:109358527-109358549 ACTGCCTCTCATGGTGCAAAAGG - Intergenic
1013455628 6:110326875-110326897 TCAGCCTCCCGGGGTGGAGCAGG + Intronic
1015248090 6:131097782-131097804 ACAGTCACGCAGGGTGCAGGAGG - Intergenic
1015358182 6:132305172-132305194 CCAGCCTCTCTGGCTCCAGCAGG - Intronic
1016251452 6:142048393-142048415 AGAGCCTCTCCGGGTGCTGCGGG + Intergenic
1017379543 6:153813000-153813022 AGAGCCTCTCTGGGTGCTGGAGG + Intergenic
1018363761 6:163098223-163098245 ACAGCAGCTCAGGATGGAGCTGG + Intronic
1018381192 6:163259848-163259870 TCAGCCTCTGGGGGTGGAGCGGG - Intronic
1018572302 6:165224416-165224438 TCAGCCTCTCAGAGTGAATCTGG - Intergenic
1020525250 7:9251124-9251146 TCAGCCTCTCTGGCTCCAGCAGG - Intergenic
1023169062 7:37373103-37373125 TCAGCATTTCATGGTGCAGCAGG + Intronic
1023212319 7:37819995-37820017 TCAGCTTCTCTGGGTGGAGCAGG + Intronic
1023935858 7:44739266-44739288 ATAGCCTCACAGGGTCCACCAGG - Intergenic
1024819923 7:53316496-53316518 CCAACCTCTCAGGGTTCAGCTGG + Intergenic
1030754696 7:113273220-113273242 ACAGCCTCTGTGGCTCCAGCCGG - Intergenic
1033882572 7:145903233-145903255 ACAGCTTTTCTGGGTGCTGCGGG - Intergenic
1034338599 7:150338696-150338718 CCAGTGCCTCAGGGTGCAGCGGG - Exonic
1034562522 7:151890423-151890445 ACAGCCTGTCAGGTGACAGCAGG - Intergenic
1035022279 7:155806772-155806794 ACGTCCTCTCAGGGTAGAGCTGG + Intronic
1035063749 7:156090668-156090690 CCAGCCTCTCAGGTAGCACCGGG - Intergenic
1035354448 7:158268708-158268730 ACACCCTCTCTGTGTGCGGCTGG - Intronic
1035679725 8:1479079-1479101 AAGGCCTCTGAGGGTGGAGCAGG + Intergenic
1037411250 8:18600125-18600147 ACAGCTGGTCAGGATGCAGCAGG + Intronic
1037595216 8:20349160-20349182 AGAGGCTCTCAGGGAGGAGCTGG + Intergenic
1037808204 8:22069971-22069993 ACGGCCTCCCAGCATGCAGCCGG - Intronic
1038052635 8:23827913-23827935 TCAGCCACTCAGGGTAGAGCTGG - Intergenic
1038487916 8:27949782-27949804 ACAGCCTGCCCGGGTGCAGAAGG + Intronic
1039315246 8:36364531-36364553 GCACCCTCTCAGGGTGCATTAGG + Intergenic
1042227327 8:66524206-66524228 ACAGCTGCACAGGGTACAGCTGG - Intergenic
1042459212 8:69043126-69043148 TCAGCCTCTCAGTCTGCAGAAGG + Intergenic
1046728236 8:117697366-117697388 ACAGCCTCTGAGGATGGAGGGGG + Intergenic
1047147244 8:122216665-122216687 ACAGCCTCTCAGATTGAATCAGG + Intergenic
1047458498 8:125038852-125038874 ACAGCCTATCTGGAGGCAGCTGG - Exonic
1047998378 8:130357887-130357909 ACACCCCCTCAGGGAGCCGCCGG - Intronic
1048133014 8:131718365-131718387 ACTCCCACTCAGGCTGCAGCAGG - Intergenic
1049169198 8:141148120-141148142 ACAGCCTCTAAGCTTGCAGTGGG - Intronic
1049499967 8:142957109-142957131 ACAGCCCCTCACAGTGCAGCCGG + Intergenic
1049615208 8:143572917-143572939 ACAGGCACTCAGGCTGCAGGTGG - Exonic
1049791381 8:144474232-144474254 AGAGCCTCACAGGCTGCACCAGG + Exonic
1050618315 9:7426402-7426424 CCAGCCTCTCTGGCTCCAGCAGG + Intergenic
1053160475 9:35810382-35810404 ACAGCCTGTCAGAGCCCAGCTGG + Intronic
1053289184 9:36868767-36868789 ATAGCCAGTCAGGGAGCAGCTGG - Intronic
1053447955 9:38167447-38167469 CTAGCCTCTCAGAGTGCAGGGGG + Intergenic
1055076885 9:72224688-72224710 ACTGCCCCTCCGGATGCAGCAGG - Intronic
1055249274 9:74282665-74282687 ACAGCCTTTCAGGGAGCTTCAGG + Intergenic
1056719655 9:89060799-89060821 GGAGCCTGTCAGGGGGCAGCAGG + Intronic
1058793785 9:108477141-108477163 ACGGCCACACAGGGTTCAGCAGG - Intergenic
1058982767 9:110185495-110185517 AGAGCCTCTCAGGGTCATGCGGG + Intergenic
1059154569 9:111978340-111978362 ACTGGCTCTCAAGGTGGAGCTGG - Intergenic
1059435135 9:114271530-114271552 GGAGTCTCTCAGGGAGCAGCAGG - Intronic
1060796641 9:126516429-126516451 ACAGCCCCTTAGGGCTCAGCTGG + Intergenic
1061377176 9:130233434-130233456 ACAGCCTCTCCGGCTGCCGAAGG - Exonic
1061812008 9:133167668-133167690 AGAGCTGCTCAGGGTGGAGCTGG - Intergenic
1062043236 9:134413725-134413747 ACAGCCCCTCAGGGTCAAGCAGG - Intronic
1062386033 9:136311879-136311901 ACAGCCCCTCAGGGCCTAGCAGG - Intergenic
1062635369 9:137487775-137487797 ACGGCCTCTCGGGGGCCAGCTGG - Intronic
1062682095 9:137787659-137787681 AGAGCCTCACAGGCTGCACCGGG + Intronic
1185460853 X:332246-332268 ACAGCTGCTCAAGGCGCAGCAGG - Intergenic
1185891824 X:3828658-3828680 GCACCATCTCAGGGTCCAGCTGG + Intronic
1185893341 X:3838614-3838636 ACAGCCTGGCAGGGAGGAGCGGG - Intronic
1185896931 X:3867072-3867094 GCACCATCTCAGGGTCCAGCTGG + Intergenic
1185898455 X:3877038-3877060 ACAGCCTGGCAGGGAGGAGCGGG - Intergenic
1185902049 X:3905498-3905520 GCACCATCTCAGGGTCCAGCTGG + Intergenic
1185903570 X:3915467-3915489 ACAGCCTGGCAGGGAGGAGCGGG - Intergenic
1186519114 X:10189703-10189725 ACAGCCACTGAGGGGACAGCCGG - Intronic
1186839426 X:13470190-13470212 ACAGCCACTCAGGGAAGAGCAGG - Intergenic
1189117856 X:38361394-38361416 ACAGCCTCTCAAACAGCAGCAGG - Intronic
1189813166 X:44799337-44799359 TCAGCCTCCCAGAGTGCTGCTGG - Intergenic
1192930265 X:75799323-75799345 CCAGCCTCTCTGGCTCCAGCAGG + Intergenic
1193702172 X:84776942-84776964 AAAGCCTCTCAGGGAGCACTGGG - Intergenic
1194889716 X:99363886-99363908 AGAGCCTCTCTGGGTGCGGGAGG + Intergenic
1195172484 X:102282367-102282389 AGAGCATCTCTGGGTGCAGGGGG - Intergenic
1195186380 X:102404728-102404750 AGAGCATCTCTGGGTGCAGTGGG + Intronic
1197017062 X:121637540-121637562 ACACCATGTGAGGGTGCAGCAGG - Intergenic
1197602159 X:128543466-128543488 CCAGCCTCCCTGGCTGCAGCAGG + Intergenic