ID: 1175912728

View in Genome Browser
Species Human (GRCh38)
Location 20:62412524-62412546
Sequence CCATTCTCCAGGCAGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175912724_1175912728 -6 Left 1175912724 20:62412507-62412529 CCATCATTCTGAGGCTGCCATTC 0: 1
1: 0
2: 0
3: 15
4: 195
Right 1175912728 20:62412524-62412546 CCATTCTCCAGGCAGCCAGGAGG 0: 1
1: 0
2: 0
3: 35
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175912728 Original CRISPR CCATTCTCCAGGCAGCCAGG AGG Intronic
901203402 1:7479540-7479562 GCCTTCTCCCAGCAGCCAGGTGG - Intronic
902282032 1:15381780-15381802 CCACTCCCCAGGAAGTCAGGAGG + Intronic
902702667 1:18183201-18183223 ACATTCTTCAGCCAGCCAGCAGG - Intronic
902932539 1:19741640-19741662 CTATACTGAAGGCAGCCAGGTGG - Intronic
903377675 1:22876783-22876805 CCTTTCTCCTGGAATCCAGGGGG - Intronic
904443673 1:30550628-30550650 CCATGCTCCACGGAGCCAGCAGG + Intergenic
904492626 1:30870285-30870307 CCTGTCTCCAGGAGGCCAGGAGG - Intronic
905335372 1:37241062-37241084 ACTCTCGCCAGGCAGCCAGGCGG + Intergenic
906818817 1:48907493-48907515 CCATTCTGGAGCAAGCCAGGGGG + Intronic
907787777 1:57630059-57630081 CCATTATCAAAGCATCCAGGTGG - Intronic
908070655 1:60455704-60455726 CCAGTCTCCAGGCCCCCAGGTGG - Intergenic
912560477 1:110548075-110548097 CCATTCCCCAGGGACCAAGGTGG + Intergenic
912932734 1:113979500-113979522 CCACTCTCCAGGCTGCCATGGGG + Exonic
913029948 1:114892066-114892088 CCCTTCATCAGGCACCCAGGAGG + Intronic
913340985 1:117758088-117758110 CCTATCACAAGGCAGCCAGGGGG - Intergenic
913689625 1:121266943-121266965 CCTGCCTCCAGGCAGCCATGGGG - Intronic
914147973 1:145013329-145013351 CCTGCCTCCAGGCAGCCATGGGG + Intronic
914343116 1:146776822-146776844 CCATCTTCCAGGCAGGCAGCAGG + Intergenic
916411792 1:164553477-164553499 CCATGCTCCATGCAGGCTGGTGG + Intergenic
916800671 1:168213359-168213381 CCTTGCTCAAGGCAGTCAGGCGG + Intergenic
917996425 1:180443544-180443566 GCATTTTCCAGGCTGCAAGGAGG - Intronic
919513565 1:198494732-198494754 CCCTGCCCCAGGCAGCAAGGAGG - Intergenic
920476948 1:206285417-206285439 CCTGCCTCCAGGCAGCCATGGGG - Intronic
922236746 1:223727817-223727839 CCATTCTCCAAGAAGCAGGGAGG - Intronic
922356747 1:224783500-224783522 CAATTTTCCAGCCAGCCAGAAGG - Intergenic
922412738 1:225391796-225391818 CCTTTCTCCATGCACCCAGGGGG + Intronic
922665504 1:227465423-227465445 GCATTCTCCAAGCAGCCTGCAGG + Intergenic
923085884 1:230703448-230703470 ACATTTTCCAGCCTGCCAGGAGG + Intronic
923588111 1:235294151-235294173 CAATTTTCCAGGTGGCCAGGTGG - Intronic
923622403 1:235589262-235589284 CCATTTTGCAGGTAGACAGGGGG + Intronic
924488630 1:244513235-244513257 CCAATCCCCAGGCCTCCAGGTGG + Intronic
924772130 1:247087872-247087894 CCAGGCTCCTGTCAGCCAGGAGG + Intergenic
924939817 1:248805263-248805285 TCTTTCTCCAGGCAGGCAGGTGG - Intergenic
1063060628 10:2547748-2547770 GCAATCTACAGGAAGCCAGGAGG - Intergenic
1063184160 10:3635294-3635316 CCATTCTCCACCCTGCCAGCCGG - Intergenic
1064326163 10:14353562-14353584 CCCATCTCCAGGCAGCCTTGTGG - Intronic
1067044034 10:42974590-42974612 CCCTTCCCCAGGGACCCAGGGGG - Intergenic
1067688981 10:48488971-48488993 ACTTTCTCCAGGCAGTCAGCTGG + Intronic
1067734077 10:48835505-48835527 CCAGCTTCCAGGCAGCCACGGGG + Intronic
1068402404 10:56547421-56547443 CCATGCCCAAGGTAGCCAGGAGG - Intergenic
1068569878 10:58616949-58616971 CCACCTTCCTGGCAGCCAGGTGG + Intronic
1070439600 10:76430547-76430569 GATTTCTCCAGGCAGGCAGGAGG + Intronic
1070631165 10:78085773-78085795 GTATTCTCCAGGCTGCAAGGAGG + Intergenic
1072659084 10:97351499-97351521 CCATTCTCCTAGCAGCCTGTTGG - Intergenic
1074445620 10:113519035-113519057 CCACTCTCCAGGCAAGCATGAGG + Intergenic
1075743259 10:124708818-124708840 CCTCTCTCTAGGAAGCCAGGTGG + Intronic
1075766983 10:124900801-124900823 CCATACTCCAGGGAGGGAGGTGG + Intergenic
1076048329 10:127312763-127312785 CCATCCTCCTGGCAGCCAGATGG + Intronic
1076099738 10:127766531-127766553 CTAGTCTCCAGGCAGGAAGGGGG + Intergenic
1076192470 10:128492329-128492351 TCAGTCTCAAGGAAGCCAGGAGG - Intergenic
1076310856 10:129506527-129506549 TTGTTCTCCAGGCATCCAGGGGG + Intronic
1076564927 10:131392167-131392189 CCATTCTCCTGGGAGCCACGTGG - Intergenic
1077010052 11:375679-375701 CCAGTCTCCAGCCAGCCACGTGG + Exonic
1077179096 11:1204236-1204258 CCATACTCCAGGCAGCCTCCTGG - Intergenic
1077720730 11:4625947-4625969 CCGTTTTTCAGGGAGCCAGGCGG - Intergenic
1079108153 11:17587524-17587546 CCATGCTCCAGCTAGCCAGATGG - Intronic
1079631347 11:22680643-22680665 CCATTCTCCAGTCTACAAGGTGG + Intronic
1080133154 11:28819926-28819948 CAAGTCACCTGGCAGCCAGGAGG - Intergenic
1080393677 11:31871125-31871147 CCCTTGCCCAGGCAGCGAGGAGG - Intronic
1080394239 11:31875171-31875193 TAAATCTCCAGGCAGCCAGCTGG - Intronic
1080644931 11:34181541-34181563 CCCTTCTCCATCCACCCAGGAGG + Intronic
1080690740 11:34555672-34555694 CTATTCTCAAGGCTGCGAGGTGG + Intergenic
1081018205 11:37908475-37908497 CCATTTTGCAGACAGACAGGAGG - Intergenic
1081688503 11:45059125-45059147 GCCTTCTCCAGGCCCCCAGGAGG - Intergenic
1081705238 11:45179093-45179115 CCATTCTCCATCCTGCCATGGGG - Intronic
1081855371 11:46300063-46300085 CCCTACGCCAGGCATCCAGGCGG + Exonic
1082952919 11:58837166-58837188 CCTTTCTCCAGGTTGCCAAGAGG - Exonic
1083305144 11:61758142-61758164 CCATACTCTAGGCCGGCAGGGGG - Intronic
1083691475 11:64411489-64411511 CGTTCCTCGAGGCAGCCAGGGGG - Intergenic
1084321720 11:68377102-68377124 CCACTCCCCAGGCAGGCAGTGGG - Intronic
1085338834 11:75718253-75718275 CCAGTCTGCAGGCTGCCAAGTGG + Intronic
1085458225 11:76677839-76677861 CCATCCACCAGGAGGCCAGGTGG - Intergenic
1085510190 11:77084241-77084263 CCATTCCCCAGGGGCCCAGGTGG - Intronic
1085679366 11:78557347-78557369 TGCTTCTACAGGCAGCCAGGAGG + Intronic
1086184718 11:83999345-83999367 CCAGTCTCCAGGCCCACAGGTGG - Intronic
1088788500 11:113203620-113203642 CCTTTCCCCAGGCAGCAATGAGG - Intronic
1089297339 11:117478045-117478067 TCATTCTGCAGGGAGCCAGAAGG + Intronic
1089591754 11:119546370-119546392 CCTTGCCCCAGGCTGCCAGGGGG + Intergenic
1089684448 11:120137937-120137959 CCATTCTCCAGGCTGCCACTGGG + Exonic
1089852314 11:121510342-121510364 CCTACCTCCAGGCAGCAAGGGGG - Intronic
1091108122 11:132942217-132942239 GCATGCTCCAGGCAGAGAGGTGG - Intronic
1091328762 11:134713959-134713981 CGATTCTCCAGGGAGGCAAGGGG + Intergenic
1091624269 12:2110475-2110497 CCTTTCAGCTGGCAGCCAGGAGG + Intronic
1091848948 12:3679752-3679774 ACATTCTCAAGGTAACCAGGAGG - Intronic
1092313418 12:7383305-7383327 CAATTCTCCAGGCCCCCAGGTGG - Intronic
1093114688 12:15194891-15194913 CCAATTTCCAGGCTGCCAGATGG + Intronic
1093745106 12:22731430-22731452 AAATTCTCCAGGCTGACAGGAGG - Intergenic
1094476613 12:30845470-30845492 CCATTTTTCGGGGAGCCAGGGGG + Intergenic
1096408902 12:51363276-51363298 CCCCTCTCCAGGCAGCCTGTTGG - Intronic
1098027206 12:66216261-66216283 CCATTGTCCTGGGAGCCAGATGG - Intronic
1098171772 12:67754034-67754056 CCTTTCACCTGGCAGCCAGAAGG + Intergenic
1098404493 12:70109320-70109342 CCAGTCTCCAGGCACACAGGTGG - Intergenic
1099927887 12:89040254-89040276 CCTTCCTCCAGGCGGCCAGGTGG - Intergenic
1100459539 12:94785727-94785749 CCATGTTCCAGGCAGCAGGGTGG + Intergenic
1105811286 13:23997948-23997970 CCATTGTTCATGCAGCCAGTTGG + Intronic
1106565286 13:30879425-30879447 CCATTTTACAGGCCGCCAAGAGG - Intergenic
1108180547 13:47835962-47835984 CCATCTTCCAGGCAGAAAGGGGG - Intergenic
1113453850 13:110433233-110433255 TCCTGCTCCAGGCTGCCAGGCGG - Intronic
1114648414 14:24268409-24268431 TCTTTCCCCAGGCCGCCAGGAGG - Exonic
1114823169 14:26045984-26046006 CTAGTCTCCAGGCAACCAGAGGG + Intergenic
1115499018 14:34033165-34033187 TCATTCTCCTGGCTGCCACGTGG - Intronic
1115734166 14:36306081-36306103 CTATTTTCCAGGCAGGCAGCAGG - Intronic
1119469067 14:74882211-74882233 GCCTTCTCCAGGCAGCCTGCGGG + Intronic
1119806476 14:77485439-77485461 CCAGGCCCCAGGCAGGCAGGCGG - Intronic
1120166147 14:81202602-81202624 CCACTCTTCAGGCAACCTGGTGG - Intronic
1121615536 14:95311331-95311353 GGGTTCTCCATGCAGCCAGGAGG - Intronic
1122573281 14:102723400-102723422 CCTTTCTCCAGTCAGCAAAGAGG - Intronic
1123772426 15:23541627-23541649 CCATTCTCCAGGGAGGCAAGAGG - Intergenic
1123920859 15:25068783-25068805 CCATTCTGAAGGCATCCAGAGGG + Intergenic
1124820708 15:33043737-33043759 ACATGCTCCATGCAGCCAGTGGG + Intronic
1125859613 15:42986779-42986801 CCCTCCACCAGGCAGACAGGTGG + Intronic
1126388606 15:48120848-48120870 CCAATCTCCAGGGAGGCCGGAGG - Intergenic
1127410169 15:58697559-58697581 CCAGTCTCCAGGCCTGCAGGTGG - Intronic
1128390425 15:67179183-67179205 CCATCCTCCAGACAGACTGGAGG - Intronic
1128795899 15:70466396-70466418 ACAGTCTCCAGGCATCAAGGAGG - Intergenic
1129070526 15:72946598-72946620 CCATCCTCAAGGCCCCCAGGAGG - Intergenic
1130160552 15:81394847-81394869 TCAGTCTCCAGGGAGCCAAGGGG + Intergenic
1130666481 15:85873844-85873866 TCATTCTCCTGGCAGCCCTGGGG + Intergenic
1130865568 15:87930553-87930575 GCACTCTCCAGGCAGACAGAAGG - Intronic
1130902537 15:88217993-88218015 CCATTCTCCAGGCCGCCTCTGGG + Intronic
1131943349 15:97591888-97591910 CCATTCTTCAGGCTGGAAGGTGG + Intergenic
1134609757 16:15598684-15598706 CCATTCTGCAGGAACCCAGGTGG + Intronic
1135830219 16:25766259-25766281 CCAATCTCCTGGCACCCAGGAGG + Intronic
1136505581 16:30700784-30700806 TCATTCTTCAGGCATCCAAGGGG + Exonic
1137591866 16:49698669-49698691 ACATTCCCCAGGAAGCCAGCTGG + Intronic
1138076742 16:54050087-54050109 CTGTTCCCCAGGCAGCCAGGAGG - Intronic
1138684379 16:58711853-58711875 TGATTCTCCAGGCAACAAGGAGG - Intronic
1139301258 16:65947248-65947270 TCATTCTTTAGCCAGCCAGGTGG - Intergenic
1139990875 16:70938506-70938528 CCATCTTCCAGGCAGGCAGCAGG - Intronic
1140230484 16:73113481-73113503 TCATTCTCCAGGCTGTCATGTGG - Intergenic
1141111625 16:81275271-81275293 CCAATGTGCAGCCAGCCAGGGGG - Intronic
1141496458 16:84413847-84413869 CCTTTCTCCAGGCATACAGTAGG - Intronic
1141505168 16:84472158-84472180 CCAGTCTCCAGGCCCACAGGTGG - Intergenic
1141571156 16:84934356-84934378 GCCTTCCCCAGCCAGCCAGGTGG + Intergenic
1147319299 17:39636413-39636435 CCATCTTCCAGGCACCCAGGAGG - Exonic
1149591090 17:57830574-57830596 CCAAGCTCCAGGCAGACAGAAGG - Intergenic
1150247726 17:63688904-63688926 CCTTTCTTGAGGCAGCCAGCAGG - Intronic
1152272253 17:79331508-79331530 ACATTCTCCAGGGGTCCAGGGGG - Intronic
1152307846 17:79531558-79531580 CCCTTCTGCAGGCAGCGACGTGG - Intergenic
1152487378 17:80602866-80602888 CCATTCTGCAATCAGCGAGGTGG - Intronic
1152637184 17:81434982-81435004 CCCTTCTCCAGGTGGGCAGGAGG + Intronic
1153145010 18:2021346-2021368 CCATTCTATAGGCAGACAGAAGG - Intergenic
1153924701 18:9825749-9825771 TCATTCTCCAGGAAGCCTGAAGG - Intronic
1154310883 18:13265425-13265447 CCATGCTCCAGGCAGCACAGTGG - Intronic
1155910982 18:31504187-31504209 ACATTCCCCAGTCAGCCAGATGG - Intronic
1155965683 18:32033278-32033300 CCCTTCTCCTGGGAGCCAAGAGG + Intronic
1156734292 18:40234485-40234507 TCATTCTGCAGGGAGCCAGTGGG - Intergenic
1157517535 18:48321446-48321468 CAACTCTCCAGGCTGCGAGGCGG - Intronic
1160532252 18:79572276-79572298 GCATTCGGCAGCCAGCCAGGAGG - Intergenic
1160935755 19:1593706-1593728 CCCTTCCCCAGCCAGCCAGAGGG + Intergenic
1160946764 19:1647393-1647415 ACCTTCCCCAGCCAGCCAGGAGG + Intronic
1161041245 19:2111729-2111751 GCAGCCTCCAGGCAGCGAGGAGG - Exonic
1161902124 19:7126640-7126662 TCCTCCTCCAGGCAGCCAGATGG - Exonic
1163500663 19:17674373-17674395 TTCTCCTCCAGGCAGCCAGGGGG - Intronic
1163822717 19:19505446-19505468 CCATCCCCCAGTCAGCCACGTGG + Exonic
1164565745 19:29324618-29324640 CCACTCTCCCCACAGCCAGGTGG + Intergenic
1164856719 19:31530739-31530761 CCAGTCTCCAGGCACCTGGGTGG - Intergenic
1165136814 19:33674744-33674766 CCCTTCTCTACGCAGCCTGGAGG - Intronic
1165245684 19:34497258-34497280 GCAGTCTCCAGGCAGTCAGTCGG + Intronic
1165442225 19:35835660-35835682 CCATTCTCAGGGGAGCCGGGAGG + Intronic
1165493569 19:36139668-36139690 CCATACTCCAGGCCTCCAGGAGG + Exonic
1165882219 19:39052415-39052437 CCATTCTGGTGGCCGCCAGGGGG + Intergenic
1166976615 19:46608627-46608649 CCAGCCTTCAGGCAGACAGGCGG + Intronic
926122823 2:10254153-10254175 CTGGTCTCCAGGCAGTCAGGGGG - Intergenic
926229723 2:10993167-10993189 CAAGTCACCAGGCAGCCATGAGG - Intergenic
927506957 2:23620981-23621003 CCAGTGTTCAGGGAGCCAGGCGG + Intronic
930025128 2:47025062-47025084 GCAATCCCCAGGCAGTCAGGTGG - Intronic
931845776 2:66202471-66202493 CCAGTCTCAAGCCACCCAGGAGG - Intergenic
931906694 2:66850412-66850434 GCATTTTCCAGGTAGCCAGAAGG - Intergenic
935147998 2:100409346-100409368 CTGTTCTCCAGGAAGCCAGGTGG + Intronic
936075522 2:109399104-109399126 CCATTCTCCACGCTTCTAGGGGG - Intronic
936509407 2:113133050-113133072 CCATTCTGGAGGCAGCATGGAGG - Exonic
937158068 2:119735279-119735301 CCTGTCTCCAGGCAGCTGGGTGG - Intergenic
938067019 2:128286883-128286905 CTGTTCCCCAGGCAACCAGGTGG - Intronic
938108612 2:128549858-128549880 CCAGACTCCTGGCAGGCAGGAGG - Intergenic
939065492 2:137479208-137479230 CCAGTCTCCAGGCCCACAGGTGG + Intronic
939383830 2:141470484-141470506 CCATTCTCAAAGCAGCAAGATGG - Intronic
944036871 2:195304926-195304948 CCATTCTTCAGACATCCAGAAGG - Intergenic
945172651 2:207012841-207012863 CTAGTCTCCAGGCAGGAAGGGGG + Intergenic
945953875 2:216067064-216067086 CCTTTCTCCAGGCAGCAAGCTGG - Intronic
946467051 2:219921290-219921312 CCCTTCGTCTGGCAGCCAGGTGG + Intergenic
947535599 2:230938981-230939003 CCATGCCCCAGGCGGCGAGGTGG - Intronic
948510445 2:238460475-238460497 CCAGTCTCCAGGCTGCGAGGGGG + Intergenic
1169791124 20:9411998-9412020 CCATTCACCAGGCTGGCAGAGGG - Intronic
1170138990 20:13106492-13106514 GCATTCTCCAGACAGACAAGAGG + Intronic
1170399891 20:15970538-15970560 AAACTCTCCAGGCAGCCAGCTGG - Intronic
1172813794 20:37670631-37670653 CAACGCTCCAGGCAGCCAGCAGG + Intergenic
1172938200 20:38635975-38635997 ACATCCTCCAGACAGCCAGCTGG - Intronic
1173529869 20:43760949-43760971 ACATTCCCAAGGCAGCCATGGGG - Intergenic
1175202757 20:57289468-57289490 CCAGTCTCCAGGCACCCTTGAGG - Intergenic
1175912728 20:62412524-62412546 CCATTCTCCAGGCAGCCAGGAGG + Intronic
1176375364 21:6084460-6084482 GGCTTCTCCAGCCAGCCAGGGGG - Intergenic
1178467243 21:32859370-32859392 CCACTCTCCATGGAGCCAGCAGG - Intergenic
1178887514 21:36495622-36495644 CCAAGCTCCAGGCTGTCAGGAGG - Intronic
1178989248 21:37338708-37338730 CCATGGTCCAGACAGCCACGTGG + Intergenic
1179520460 21:41940490-41940512 CCATTTAGCAGGCAGCAAGGAGG - Intronic
1179597894 21:42455344-42455366 CCACTCACCAGGATGCCAGGCGG - Intergenic
1179748110 21:43453784-43453806 GGCTTCTCCAGCCAGCCAGGGGG + Intergenic
1180046261 21:45307171-45307193 CTTGTCTCCGGGCAGCCAGGCGG + Intergenic
1180056210 21:45360391-45360413 CCCTTATCCAGGGAGGCAGGAGG + Intergenic
1180141505 21:45896099-45896121 CCATTCTCCTGCCACCCGGGAGG + Intronic
1180179104 21:46110030-46110052 CCATGCTCCACGGAGCCAGCAGG - Intronic
1180188079 21:46150277-46150299 CCATTCTCCAGCCAGCCCCCAGG - Intronic
1180826686 22:18867755-18867777 TCCTTCTCCAGGGAGCCACGGGG + Intergenic
1180984268 22:19895291-19895313 CCATCCTGCTGGCTGCCAGGCGG - Intronic
1181045471 22:20212149-20212171 GCATGCGCCAGGCAGCCACGTGG - Intergenic
1181196365 22:21189426-21189448 TCCTTCTCCAGGGAGCCACGGGG - Intergenic
1181213162 22:21303698-21303720 TCCTTCTCCAGGGAGCCACGGGG + Intergenic
1182065670 22:27429911-27429933 ACGTGCTCCAGGAAGCCAGGAGG + Intergenic
1182773187 22:32810664-32810686 CTTCTCTGCAGGCAGCCAGGCGG - Intronic
1183948567 22:41340194-41340216 CCACTCTCCAGGCACCAAAGAGG - Intronic
1184109633 22:42387360-42387382 CCTTTCTCTTGCCAGCCAGGTGG - Intronic
1184293628 22:43510722-43510744 TCATTCCCCAGGCAGCCCCGAGG + Intergenic
1185334347 22:50264955-50264977 TCAATCTCCAGGCTGCCAGGTGG + Exonic
949982498 3:9510558-9510580 CTCTGCTCCAAGCAGCCAGGAGG + Intronic
950399654 3:12760228-12760250 TCATCAGCCAGGCAGCCAGGGGG + Intronic
951382030 3:21995744-21995766 CCATTCTCCAGATTGCCAGAAGG + Intronic
952649569 3:35709130-35709152 TCATTCCCCAGACAGCGAGGTGG + Intronic
953438947 3:42901484-42901506 CTAGTCTCCAGGCAGGAAGGGGG + Intronic
953636860 3:44671408-44671430 CCAAGCACCAGGCAGCCATGAGG + Intergenic
956462489 3:69485613-69485635 CCATGCTCCATGGAGCCAGCGGG - Intronic
957362196 3:79174027-79174049 CCATTTTACAGACAGCCAAGTGG - Intronic
957556169 3:81766874-81766896 CCATTTTACAGAGAGCCAGGTGG + Intergenic
960089972 3:113628993-113629015 TCATACTCCAGGCAACAAGGGGG - Exonic
960257446 3:115525972-115525994 CCATTGTCCAATCAGCCAAGAGG - Intergenic
961112608 3:124297854-124297876 CCATTCTTCTGGCAGCCTGAGGG - Intronic
961552433 3:127676960-127676982 CCAATGTCCAGGCGGCCTGGGGG - Exonic
962774801 3:138649426-138649448 CCAGTCTCCAGGCTCCTAGGTGG + Intergenic
966578214 3:181527731-181527753 CCATTCTCGAGGGAGTAAGGTGG + Intergenic
967101674 3:186221140-186221162 CCATTCTCCAGTCAGGCTGCTGG - Intronic
967931265 3:194692227-194692249 CAGGGCTCCAGGCAGCCAGGAGG + Intergenic
968093294 3:195910778-195910800 CCCTTCCCCAGGGAGCCAGGAGG + Intronic
968896961 4:3409886-3409908 CCACCCTCCAGGCAGCCAGAGGG + Intronic
969114983 4:4865819-4865841 CCAAACTCCAAGGAGCCAGGAGG - Intergenic
969857144 4:10009191-10009213 CCATTCTCAAGGAAACCAGGAGG - Intronic
970826626 4:20284147-20284169 CCATTCTCCAGGCAGGGTGGTGG - Intronic
971165099 4:24174780-24174802 CGATGATCCAGGCAGCCATGTGG + Intergenic
973109995 4:46386774-46386796 CCAGGCTCCATGTAGCCAGGAGG + Intronic
974187999 4:58465205-58465227 CCACACTCCAAGCAGCCAGCTGG + Intergenic
974515113 4:62898045-62898067 CCATGCTGCAGGCAGCAAGAAGG + Intergenic
977511226 4:97965265-97965287 CCAGGCTGCAGCCAGCCAGGGGG + Intronic
978249157 4:106610130-106610152 CCATGCTCCATGGAGCCAGTAGG + Intergenic
978476058 4:109131765-109131787 CCATTCACCAGGAACCCAGATGG + Intronic
979649684 4:123115094-123115116 CCCTGCTCCAGGCTGCAAGGAGG - Intronic
980503046 4:133681986-133682008 CCAGTCTCCAGGCCAGCAGGTGG + Intergenic
980642348 4:135596788-135596810 CCATTTTTCAAGCAGTCAGGGGG + Intergenic
981064746 4:140470701-140470723 ACATTCTTCAGGCAGACAGGGGG - Intronic
983109513 4:163731458-163731480 ACTTTCTCCAGGCAGCGAGATGG - Intronic
983428646 4:167619858-167619880 CCAGTCTCCAGGTACTCAGGTGG + Intergenic
985906833 5:2844905-2844927 CCAACCTCCAGGCTCCCAGGAGG + Intergenic
986429366 5:7666235-7666257 CCATTTCCTAGGCTGCCAGGAGG + Intronic
986962551 5:13232839-13232861 CTATTGTCCAGCCAGCCAGTTGG - Intergenic
987227124 5:15853636-15853658 TCATGCCCCAGGCAGGCAGGTGG + Intronic
987265211 5:16246278-16246300 CCACTCTTCAGTCAGCCAAGAGG + Intergenic
988629815 5:32916845-32916867 TCATTCTCCCTGCATCCAGGTGG - Intergenic
990289569 5:54334501-54334523 CCAATCTCCAGGCCCCCAAGTGG - Intergenic
992027051 5:72681088-72681110 CCAGTCTCCAGGCCTACAGGTGG + Intergenic
992693248 5:79259930-79259952 CCATGCTCCATGGAGCCAGTGGG - Intronic
992704910 5:79380850-79380872 CCATTCTCCAGGCCTGCAGGTGG - Intronic
997293554 5:132755052-132755074 AGACTCTCCAGGAAGCCAGGGGG - Intronic
997373965 5:133383725-133383747 CCATGCTCCAGTCACCAAGGCGG + Intronic
997398341 5:133582214-133582236 CCATTCTCCATGTCACCAGGAGG - Intronic
997610348 5:135211548-135211570 CCTGTCTCCAGGGAGACAGGAGG + Intronic
997613950 5:135233560-135233582 CCAATCTCCTGCCAGCCAGCAGG - Intronic
998094095 5:139387686-139387708 CCCGTCTGCAGGCAGCCAGGAGG - Exonic
998469934 5:142375711-142375733 CCATGGTCCAGGGAACCAGGTGG + Intergenic
998512228 5:142723058-142723080 GCATTCTCCAGGAACCCAGCTGG + Intergenic
999126439 5:149249694-149249716 CCTTTTCCCAGCCAGCCAGGGGG + Intronic
1001118522 5:168959580-168959602 ACCTACTCCAGGCAGCCTGGAGG - Intronic
1001325753 5:170722581-170722603 ACATCCTCCAGGCAGACAAGAGG + Intronic
1001547533 5:172579836-172579858 CTATTCTCCAGGCAGGCATCTGG - Intergenic
1001954258 5:175837510-175837532 CCATTCTGCAGACAGACTGGTGG + Intronic
1003109336 6:3240510-3240532 CCATTGTCAAGTTAGCCAGGGGG + Intronic
1003172289 6:3729403-3729425 CCCTTCTCCAGAAAGGCAGGTGG - Intronic
1003649019 6:7941220-7941242 CCATTCTGCATGCAGCAAGGAGG - Intronic
1003975655 6:11341289-11341311 CAAGTCTCCAGGCAGACAGCTGG - Intronic
1004425180 6:15502279-15502301 CCCTTCTCCAGCCTGCCAGTGGG + Intronic
1006575428 6:35041809-35041831 CCATTTTCCTGCCAGCCAGAGGG + Intronic
1007229901 6:40340964-40340986 CCATGCACCAGGCTGTCAGGAGG - Intergenic
1007767775 6:44171131-44171153 CCTCTCTCCAGGCAGCCAAGAGG + Intronic
1008154563 6:47997764-47997786 CCATGTTCCAGGAAGGCAGGTGG + Intronic
1008294583 6:49760283-49760305 CCATTAGCCAGTCAGCCATGTGG - Intergenic
1010273982 6:73948304-73948326 CCAGTCTCCAGGCCTGCAGGTGG + Intergenic
1010727708 6:79354190-79354212 CCCTTCTCCTGGTAGCCAAGAGG + Intergenic
1013070893 6:106728369-106728391 CGATCCTCCAGGCAGAAAGGAGG + Intergenic
1013149566 6:107430991-107431013 CTATTCTCCAGGTAGGAAGGAGG + Intronic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1019058668 6:169240812-169240834 CCGCTCTCCAGGAAGGCAGGTGG - Intronic
1019206450 6:170365776-170365798 CCCTGCTCCAGGCAGCCTGTGGG - Intronic
1019539886 7:1546789-1546811 CCATCCTCCCTCCAGCCAGGGGG - Exonic
1019929622 7:4215004-4215026 GCCTTCCCCAGGCAGCCATGAGG - Intronic
1021021265 7:15600534-15600556 GCATGCTCCAGGGAGCCAGCAGG - Intergenic
1021318516 7:19182125-19182147 CGATTCTCCAGGCTTCCAGATGG - Intergenic
1022114979 7:27253204-27253226 CCAGGCTCCAGTGAGCCAGGCGG - Intergenic
1022610578 7:31867532-31867554 CCAGTCTCCAGGCTCACAGGTGG - Intronic
1024025752 7:45408518-45408540 CCATGCTCCATGCAGCCTGAGGG + Intergenic
1024169871 7:46773651-46773673 CCAAGCTCCATGCAGCCAGCTGG - Intergenic
1024751112 7:52466717-52466739 TTCTTCTCCTGGCAGCCAGGAGG + Intergenic
1026042471 7:66879472-66879494 CCTACCTCCAGGCAGCCACGGGG - Intergenic
1026476962 7:70744601-70744623 GCATGCGCCCGGCAGCCAGGCGG - Intronic
1027235588 7:76295743-76295765 CTATTCTCCATCCAGCAAGGGGG - Intergenic
1029061866 7:97806550-97806572 CCAGTCTCCAGGCCTCCAGGTGG - Intergenic
1031195529 7:118609223-118609245 CCAGTCCCCAGGCACACAGGTGG + Intergenic
1031593342 7:123620090-123620112 CCATTTTCCAGGCAGCAGGAAGG + Intronic
1032018620 7:128394592-128394614 CCACCCTCCACGCAGCGAGGGGG - Exonic
1032441430 7:131945619-131945641 CGGGTCCCCAGGCAGCCAGGAGG - Intergenic
1034188654 7:149197228-149197250 CCCTTCCCCAGGAAGCAAGGAGG + Intronic
1035066055 7:156105772-156105794 GCAAGCTCCAGGCAGCCAAGGGG + Intergenic
1036629653 8:10502128-10502150 CCATTGTACGGGCAGCTAGGAGG + Intergenic
1036939930 8:13041552-13041574 GCATTTTCCAGGGAGCCAGGGGG - Intergenic
1038528375 8:28296345-28296367 CCATTCTGCAAGGAGTCAGGGGG + Intergenic
1039649825 8:39329422-39329444 CCATTTTTCGGGGAGCCAGGAGG - Intergenic
1040349662 8:46551509-46551531 CCAGTCTCCAGGTTCCCAGGTGG - Intergenic
1040368722 8:46747021-46747043 CCAGTCTCCAGGTTCCCAGGTGG + Intergenic
1040558680 8:48504296-48504318 ACAATCTCCAGGAAGCCAAGCGG - Intergenic
1041952945 8:63525027-63525049 CCATATTCCAGGCAGCCCAGAGG - Intergenic
1042130021 8:65579109-65579131 CCAGTCTCCAGGCCCACAGGTGG + Intergenic
1042667540 8:71222956-71222978 CCATGCTCCAGGCAGGAAGAGGG - Intronic
1043050614 8:75380832-75380854 CCATTCTCCAGACAAACAGAGGG - Intergenic
1043881353 8:85546989-85547011 CCACTCTGCAGCCAGCCATGGGG + Intergenic
1045438578 8:102188308-102188330 CTTTTCACCTGGCAGCCAGGTGG - Intergenic
1047392420 8:124463688-124463710 CCTTTCTTCAGGCAGCAAGTTGG + Intergenic
1047970632 8:130081351-130081373 CCAAGCTGCAGGCACCCAGGAGG + Intronic
1048973632 8:139658778-139658800 CCAGTGTCCAGGAAGCGAGGTGG + Intronic
1049240783 8:141536472-141536494 CCCCTCTCCAGGCAGCCTGCAGG - Intergenic
1049405177 8:142449201-142449223 CCATCATCCAGCCAGCCAGTGGG + Intergenic
1052166785 9:25339810-25339832 CCAGTCTCCAGGCCTGCAGGTGG - Intergenic
1055319471 9:75068220-75068242 CCATTCTCCACACAGCCAGAGGG + Intronic
1055934454 9:81591915-81591937 CAATTTTCCAGGCAGGCAGTGGG + Intronic
1056618277 9:88187458-88187480 CAATTCTCCTGGTATCCAGGTGG - Intergenic
1057114428 9:92507117-92507139 TCATTCTCTAGGCAGCAAGATGG + Intronic
1057297370 9:93857094-93857116 GGATTGTCCAGACAGCCAGGAGG + Intergenic
1057466184 9:95316992-95317014 CCATTCGCCGGGGCGCCAGGAGG - Intronic
1057703680 9:97382802-97382824 GCATTCTCCAGGGTGCCAAGAGG - Intergenic
1058146533 9:101418062-101418084 CCATGCTCAATGCAGCCTGGAGG - Intergenic
1058852635 9:109027480-109027502 CCAGCCTCCTGGGAGCCAGGAGG - Intronic
1059322280 9:113479216-113479238 CTACTGTACAGGCAGCCAGGTGG - Intronic
1059378572 9:113905895-113905917 TCATTCTCCAGGCAGCAAGATGG + Intronic
1060338654 9:122752225-122752247 CCAAACGCAAGGCAGCCAGGAGG + Intergenic
1060518587 9:124281135-124281157 CCAGTCACCAGGCAGCCTGCTGG - Intronic
1061296994 9:129682157-129682179 CCTTGCCCCAGGGAGCCAGGTGG - Intronic
1061445149 9:130633412-130633434 TAATCCTCCAGGCAGCAAGGTGG + Intronic
1062414042 9:136439116-136439138 GCGTTTTCGAGGCAGCCAGGAGG - Exonic
1062611105 9:137373835-137373857 CTGTTCTCCAGGCAGACAGAGGG + Intronic
1186718966 X:12282210-12282232 CCCTTCAGCAGGCAGCCTGGAGG - Intronic
1187534602 X:20128776-20128798 CCCTTTTCCAGCCAGCCAGCTGG + Intronic
1188168637 X:26893056-26893078 CCAGTCCCCAGTCATCCAGGTGG - Intergenic
1188757887 X:33987122-33987144 CCAGTCTCCAGGCCCACAGGTGG + Intergenic
1190328474 X:49221208-49221230 CCGTTCTCAAAGCAGCCAGAGGG + Intronic
1191817633 X:65265428-65265450 CCAGCCTACTGGCAGCCAGGTGG + Intergenic
1194097853 X:89665777-89665799 CCAATCTCCAGGCCCCCAGTTGG + Intergenic
1195696555 X:107671800-107671822 CCATTCCCGAGGCAGCCTAGTGG - Intergenic
1196998844 X:121415892-121415914 CCAGTCTCCAGGCCCACAGGTGG + Intergenic
1198650400 X:138857364-138857386 ACTTTCACCAGCCAGCCAGGGGG + Intronic
1199247389 X:145622091-145622113 CCATTATCTAGGCAGAGAGGTGG - Intergenic
1199501104 X:148506984-148507006 CCATTCTCTAGGAAGCAACGTGG - Intronic
1200127382 X:153822467-153822489 CAATGCTCCAAGCAGCCATGAGG + Intronic
1200450875 Y:3327165-3327187 CCAATCTCCAGGCCCCCAGTTGG + Intergenic