ID: 1175912878

View in Genome Browser
Species Human (GRCh38)
Location 20:62413087-62413109
Sequence GGGGCGGGAACCCCAACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175912878_1175912886 -1 Left 1175912878 20:62413087-62413109 CCATCAGTTGGGGTTCCCGCCCC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1175912886 20:62413109-62413131 CTGGCTTGGATGCTGCATGATGG No data
1175912878_1175912887 0 Left 1175912878 20:62413087-62413109 CCATCAGTTGGGGTTCCCGCCCC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1175912887 20:62413110-62413132 TGGCTTGGATGCTGCATGATGGG No data
1175912878_1175912888 1 Left 1175912878 20:62413087-62413109 CCATCAGTTGGGGTTCCCGCCCC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1175912888 20:62413111-62413133 GGCTTGGATGCTGCATGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175912878 Original CRISPR GGGGCGGGAACCCCAACTGA TGG (reversed) Intronic