ID: 1175913010

View in Genome Browser
Species Human (GRCh38)
Location 20:62413608-62413630
Sequence AGGGGTCCCACCGGCTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175913010_1175913022 26 Left 1175913010 20:62413608-62413630 CCTGGACAGCCGGTGGGACCCCT 0: 1
1: 0
2: 0
3: 23
4: 150
Right 1175913022 20:62413657-62413679 CTGCCTTTCCCTTTATAGTGTGG 0: 1
1: 0
2: 0
3: 22
4: 174
1175913010_1175913018 0 Left 1175913010 20:62413608-62413630 CCTGGACAGCCGGTGGGACCCCT 0: 1
1: 0
2: 0
3: 23
4: 150
Right 1175913018 20:62413631-62413653 CTTGAGGCTGCAGCTGGTGGAGG 0: 1
1: 0
2: 3
3: 58
4: 426
1175913010_1175913020 2 Left 1175913010 20:62413608-62413630 CCTGGACAGCCGGTGGGACCCCT 0: 1
1: 0
2: 0
3: 23
4: 150
Right 1175913020 20:62413633-62413655 TGAGGCTGCAGCTGGTGGAGGGG 0: 1
1: 0
2: 4
3: 89
4: 720
1175913010_1175913019 1 Left 1175913010 20:62413608-62413630 CCTGGACAGCCGGTGGGACCCCT 0: 1
1: 0
2: 0
3: 23
4: 150
Right 1175913019 20:62413632-62413654 TTGAGGCTGCAGCTGGTGGAGGG 0: 1
1: 0
2: 3
3: 34
4: 444
1175913010_1175913013 -6 Left 1175913010 20:62413608-62413630 CCTGGACAGCCGGTGGGACCCCT 0: 1
1: 0
2: 0
3: 23
4: 150
Right 1175913013 20:62413625-62413647 ACCCCTCTTGAGGCTGCAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 268
1175913010_1175913017 -3 Left 1175913010 20:62413608-62413630 CCTGGACAGCCGGTGGGACCCCT 0: 1
1: 0
2: 0
3: 23
4: 150
Right 1175913017 20:62413628-62413650 CCTCTTGAGGCTGCAGCTGGTGG 0: 1
1: 0
2: 0
3: 37
4: 675

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175913010 Original CRISPR AGGGGTCCCACCGGCTGTCC AGG (reversed) Intronic
900083439 1:875690-875712 AGGGGCCTCACCTGCTTTCCCGG - Intergenic
900168311 1:1253813-1253835 GGGGGTCACACCTGCTGGCCTGG - Intergenic
900471642 1:2857864-2857886 TGGGGTCCCACCGGCTCCCGAGG - Intergenic
900794531 1:4700189-4700211 AAGGGTGCCACAGGCTGGCCCGG - Intronic
901465364 1:9417801-9417823 CGGGGCCCCAGAGGCTGTCCTGG - Intergenic
903179037 1:21596357-21596379 AGGGCTCCCAGCAGCTGTGCCGG + Intronic
905667417 1:39771275-39771297 AGGGCTCACACCACCTGTCCTGG - Exonic
905866498 1:41379745-41379767 AGGGGTCCTTCCTGCTGCCCAGG - Intronic
906787314 1:48627179-48627201 AGGGGTCCCACTGGGTCACCAGG - Intronic
908344874 1:63222009-63222031 AGGGGTGCCACTGGATGTCTGGG + Intergenic
910448503 1:87323986-87324008 AGGGGTCTCACTGGTTGCCCAGG - Intergenic
914502908 1:148263340-148263362 TGAGGTCCGACCAGCTGTCCTGG - Intergenic
917345120 1:174021920-174021942 AGGGCCCCCGCCGGCTGTTCTGG - Intronic
922180891 1:223231797-223231819 AGGGGGCCCCCAGGCAGTCCCGG - Intronic
923055867 1:230425796-230425818 AGGGGTTCCCGCCGCTGTCCGGG + Intergenic
923405332 1:233653715-233653737 AATGGTACCACCGGCTTTCCTGG + Intronic
1063009762 10:2011067-2011089 AAGGGTTCCACTGGCTGTCAGGG + Intergenic
1063381503 10:5588915-5588937 ATGGGTCCCACATGCTTTCCTGG + Intergenic
1067295457 10:44972991-44973013 AGGCGTCCCCTCGGCTGGCCAGG + Intronic
1072070187 10:91908406-91908428 CGGGGTCCCAGCGGCTGGGCCGG + Exonic
1075405941 10:122195857-122195879 AATGGTCCCACAGGCTGGCCAGG + Intronic
1075736897 10:124669727-124669749 TGGGGGCCCACGGGCTGTCGGGG + Intronic
1075760209 10:124849718-124849740 ATGAGTCCCACCTGCTCTCCAGG - Intergenic
1076479423 10:130775149-130775171 AGGGGTGCCACCTGCTCCCCAGG + Intergenic
1076642904 10:131931012-131931034 GGGGGCCCCACTGGGTGTCCTGG + Intronic
1076698391 10:132257795-132257817 AGGGGACCCATCAGCTGCCCTGG + Intronic
1077107333 11:847901-847923 AGGGGTGCCACTGGCTAGCCTGG + Intronic
1077433355 11:2526766-2526788 AGGGGGCCTTCTGGCTGTCCTGG + Intronic
1081545357 11:44067655-44067677 AGGGCTCCCACCACCTGTCTGGG + Exonic
1083484911 11:62977173-62977195 TGGGGGCCCACCTGCTCTCCAGG + Exonic
1084673050 11:70618924-70618946 AGGGGACACACAGGCTGACCCGG + Intronic
1084945277 11:72634855-72634877 TGGGACCCCACTGGCTGTCCTGG + Intronic
1085455748 11:76664441-76664463 AGAGCTCCCACCCACTGTCCTGG + Intronic
1086453524 11:86940080-86940102 AGGGGCCCCACCAGCTCTTCGGG - Intronic
1088495909 11:110430695-110430717 AGGCTTCCCTCCTGCTGTCCTGG + Intronic
1092117423 12:6019233-6019255 AGGAGCCCCAACGGATGTCCCGG - Exonic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1097178243 12:57156033-57156055 AGGGGTTCCTCCCTCTGTCCTGG - Intronic
1097250000 12:57627286-57627308 TGGGGGCCCAGCGGCTGTGCTGG + Intronic
1102010513 12:109615753-109615775 AGGACTCCCGCCAGCTGTCCTGG - Intergenic
1106413236 13:29525305-29525327 CAGGGTCCCACTGGCTGGCCTGG + Intronic
1107295507 13:38902771-38902793 ATGGGACCCACTGGCTGTCCAGG - Intergenic
1112330586 13:98474460-98474482 AGGGGCTCCACCTGCTGTCTGGG - Intronic
1113727432 13:112615581-112615603 AGGGCTCCCTCCGGCTGCCAAGG - Intergenic
1118753790 14:68824039-68824061 AGAGGCCCCAACTGCTGTCCTGG + Intergenic
1119539407 14:75428510-75428532 AGGGAGCACCCCGGCTGTCCAGG - Intronic
1124007340 15:25805124-25805146 AGGGGTCCCATAGGCTGCCGGGG - Intronic
1125505067 15:40263087-40263109 TGGGGAACCACTGGCTGTCCAGG + Intronic
1129748601 15:78043266-78043288 AGGGGTCCCACTGGTTTTTCAGG - Intronic
1132515599 16:364344-364366 AGGGGTCCCAGGGACTGTACCGG - Intergenic
1136414751 16:30096253-30096275 AGGGGACCCGCCTCCTGTCCCGG + Intronic
1136664884 16:31801828-31801850 ATGGGACCCACCTGCCGTCCAGG - Intergenic
1137341731 16:47614061-47614083 AGAGGTTCCACAGGCTGTACAGG + Intronic
1142272639 16:89098589-89098611 AGGTGTCCCACCGGCCTTCCGGG + Exonic
1142398188 16:89844954-89844976 ACAGGTCCCACAGTCTGTCCCGG - Intronic
1142637020 17:1264119-1264141 AGGGTTCCTACCTGCTGCCCAGG - Intergenic
1143391072 17:6559563-6559585 AGTGCTCACACCAGCTGTCCAGG - Intergenic
1146400684 17:32497944-32497966 AGAGGACCAACTGGCTGTCCCGG - Intronic
1146675711 17:34772525-34772547 AGGGGACCCTCCGGCTCTGCGGG - Intergenic
1147994028 17:44351626-44351648 AGGGGCCCCACCAGGTGCCCTGG + Exonic
1148853631 17:50566893-50566915 AGGGGTCCAAGCAGATGTCCTGG + Intronic
1149534808 17:57424807-57424829 AGGGATGACACTGGCTGTCCTGG - Intronic
1151918572 17:77137259-77137281 AGAGGTTCCACAGGCTGTTCAGG + Intronic
1152224261 17:79085468-79085490 AGGGCTCCCAGCAGCTGTCCTGG - Intronic
1152230189 17:79110449-79110471 CCGGGTCCCACCTGCTGTCCAGG - Intronic
1152244234 17:79176974-79176996 GGAGGTCCCAGCTGCTGTCCCGG + Intronic
1152919850 17:83060768-83060790 CCGGGTCCCACAGGCTGTACAGG - Intergenic
1155213012 18:23619229-23619251 TGGGGGCCTCCCGGCTGTCCTGG - Intronic
1157801169 18:50622459-50622481 AGGGTTCACACCTCCTGTCCAGG - Intronic
1159241715 18:65750857-65750879 AGGGGCCCCTCCGGCTCGCCCGG - Intronic
1160907162 19:1456780-1456802 AGGGCTCCGACCGGGTTTCCAGG + Intronic
1161101091 19:2422251-2422273 AGGGATCCCTCCGTCTCTCCCGG - Intronic
1161262202 19:3344243-3344265 TGAGGTTCCACCGGTTGTCCCGG - Intergenic
1161344265 19:3760147-3760169 TAGGGTCCCACTGGCTGTCAGGG + Exonic
1161911651 19:7198539-7198561 AGGGGGCCCCTCGGCAGTCCCGG - Intronic
1161976490 19:7610663-7610685 AGGGGTCCCGTCTGCTGACCCGG + Intronic
1162066205 19:8126731-8126753 AGGGGTCCAGCCGGCTGCCAGGG + Exonic
1162420956 19:10565819-10565841 AGTGGCCCCGCCGGCTGACCTGG - Intronic
1162796947 19:13091992-13092014 AGGAGTCCCAGCGGGGGTCCAGG + Intronic
1163403142 19:17106563-17106585 AGGGGGCTCAACGGCTCTCCAGG + Intronic
1165462600 19:35953020-35953042 AGGGGCCCCAGGGGATGTCCAGG - Intergenic
1166831536 19:45642406-45642428 AGGGGTCCCTCCCGCCTTCCTGG + Exonic
1168713238 19:58513418-58513440 ATGCGGCCCACAGGCTGTCCTGG - Intergenic
932571337 2:72940034-72940056 AGGGGCCCCTGCGGCAGTCCTGG - Intergenic
933710195 2:85319697-85319719 AGGGGTCCCACAGCTTTTCCTGG - Intronic
933819779 2:86100114-86100136 ATGGGTTCCCCAGGCTGTCCAGG + Exonic
935719555 2:105967984-105968006 GGAGGGCCCACTGGCTGTCCAGG - Intergenic
938598932 2:132817699-132817721 AGGGTTCCCAGCGCCTGGCCAGG + Intronic
942742178 2:179193873-179193895 AAGGGTCCCACCTGGTGGCCGGG - Intronic
944329333 2:198446776-198446798 TGGTGTCCCACCTGGTGTCCTGG - Intronic
947050301 2:226035099-226035121 AGAGGTCCTACAGGCTGTACAGG + Intergenic
948984161 2:241509671-241509693 AGGGGTTCAAGGGGCTGTCCTGG - Intronic
1170749080 20:19129383-19129405 AGGGGTCACAGGGGCTGGCCTGG + Intergenic
1171240720 20:23565291-23565313 AGGGGAACCCCGGGCTGTCCTGG + Intronic
1171244860 20:23602967-23602989 AGGGGAACCCCAGGCTGTCCTGG + Exonic
1171473427 20:25390199-25390221 AAGGGTCCCCCCGGCTTCCCCGG + Intronic
1172215972 20:33236017-33236039 AGAGGTCTCAGCAGCTGTCCTGG - Exonic
1175913010 20:62413608-62413630 AGGGGTCCCACCGGCTGTCCAGG - Intronic
1178368858 21:32010456-32010478 CGTGGTTCCACAGGCTGTCCAGG + Intronic
1179628833 21:42664448-42664470 AGGGGTTCTACCTGCTTTCCGGG + Intronic
1180568862 22:16697646-16697668 AGGAGCCCCAACGGATGTCCCGG - Intergenic
1181639297 22:24188358-24188380 GGTGGTCCCACCGGCTGTCTCGG - Intronic
1182295497 22:29309495-29309517 TGGGGCCCCACCCCCTGTCCTGG + Intronic
1183050675 22:35257970-35257992 GGGGGTCCCTCGGGCTGTCAGGG + Intronic
1184775347 22:46620347-46620369 AGGGCTCACCACGGCTGTCCAGG - Intronic
950522467 3:13505223-13505245 AGGGTTCCCACCTGCTGCCTGGG - Exonic
952497531 3:33928940-33928962 GAGGGTCCCCCAGGCTGTCCAGG + Intergenic
954699374 3:52443395-52443417 AGGGCTCCCACCTCCAGTCCAGG + Intronic
959633086 3:108531267-108531289 TGGGGTCCCACCGGCTTCTCTGG - Intergenic
960090330 3:113632126-113632148 AGGGGTCCCATCTCCTGTCCCGG + Intergenic
961673596 3:128551577-128551599 ACAGCTCCCACAGGCTGTCCTGG - Intergenic
962746712 3:138402302-138402324 AGGGGTCCCGAGGGCTGGCCAGG - Exonic
966465643 3:180228293-180228315 CTGGGTCCCCCCGGCTGTCTTGG - Intergenic
968451252 4:677046-677068 AGGGATCCCACCTGCTGTTGTGG + Intronic
968476750 4:814085-814107 AGGGGTTCCACCTGCTGGACGGG - Intronic
969125510 4:4945144-4945166 AGGGGTTCCATGGGCTATCCAGG + Intergenic
972045800 4:34663695-34663717 AGGGGCCCCAGGGGCTGACCTGG + Intergenic
973004864 4:44993917-44993939 AGGGTTCCAACAGGCTCTCCAGG + Intergenic
980355569 4:131729696-131729718 ATGGCTCCCACCGGCTGATCGGG - Intergenic
980356114 4:131732187-131732209 ATGGCTCCCACCGGCTGATCGGG - Intergenic
980356646 4:131734675-131734697 ATGGCTCCCACCGGCTGATCGGG - Intergenic
980357185 4:131737163-131737185 ATGGCTCCCACCGGCTGATCGGG - Intergenic
980357727 4:131739658-131739680 ATGGCTCCCACCGGCTGATCGGG - Intergenic
980358263 4:131742144-131742166 ATGGCTCCCACCGGCTGATCGGG - Intergenic
980358797 4:131744638-131744660 ATGGCTCCCACCGGCTGATCGGG - Intergenic
980359337 4:131747111-131747133 ATGGCTCCCACCGGCTGATCGGG - Intergenic
980359880 4:131749579-131749601 ATGGCTCCCACCGGCTGATCGGG - Intergenic
980360420 4:131752074-131752096 ATGGCTCCCACCGGCTGATCGGG - Intergenic
980360961 4:131754546-131754568 ATGGCTCCCACCGGCTGATCGGG - Intergenic
980361503 4:131757029-131757051 ATGGCTCCCACCGGCTGATCGGG - Intergenic
980362044 4:131759501-131759523 ATGGCTCCCACCGGCTGATCGGG - Intergenic
980362586 4:131761984-131762006 ATGGCTCCCACCGGCTGATCGGG - Intergenic
980363129 4:131764463-131764485 ATGGCTCCCACCGGCTGATCGGG - Intergenic
981753527 4:148117318-148117340 AGGGGGCAAACCGGCAGTCCTGG - Intronic
985025736 4:185737548-185737570 ATGGGTCTCACAGGCTGTCTAGG - Intronic
996434834 5:123423068-123423090 GGGGGTCCCGCCGGGGGTCCCGG - Exonic
1004429799 6:15533191-15533213 TGGGGACTCACCGGCTGTGCGGG - Intronic
1006179720 6:32147613-32147635 AGGGGTCACACCTGCTGTCTGGG + Intergenic
1006612124 6:35300451-35300473 CGGGCTCCCAGTGGCTGTCCTGG + Intronic
1013569084 6:111402358-111402380 AGGGCTCCCACCTGCTGGGCAGG + Intronic
1017902990 6:158734406-158734428 CAGGATCCCACCGGCTGTCATGG - Intronic
1018612516 6:165660177-165660199 TGGGGCCCCACCAGCTCTCCCGG - Intronic
1018688158 6:166319376-166319398 AAGTCTCCCACTGGCTGTCCTGG - Intergenic
1019463253 7:1172602-1172624 AGGGTTCCCCCCCTCTGTCCAGG + Intergenic
1020008790 7:4797165-4797187 AGGGCTGCCACTGGCTGTTCTGG - Intronic
1022003065 7:26244335-26244357 TGGTCTCCCTCCGGCTGTCCAGG + Intergenic
1037597798 8:20369008-20369030 AGGGGTGCCACTGGCTGCCTTGG + Intergenic
1040287118 8:46106076-46106098 AGAAGCCCCAACGGCTGTCCTGG - Intergenic
1040331006 8:46385749-46385771 AGGAGCCCCAAAGGCTGTCCTGG + Intergenic
1048977367 8:139680445-139680467 AGGTGGCCCTCCTGCTGTCCAGG - Intronic
1052434888 9:28413711-28413733 AGGGGTGGCACCTGCTGTGCAGG + Intronic
1054885142 9:70188794-70188816 TGGGGTCTCACATGCTGTCCAGG + Intronic
1060246036 9:121946927-121946949 AGGGGTCCCAAGTGCTGTCAGGG - Intronic
1061145019 9:128792506-128792528 ACGTGTTCCACCGGCTGTCAGGG - Exonic
1062151310 9:135020593-135020615 AGGGGTCCCAGCTTCAGTCCTGG + Intergenic
1203761007 EBV:13012-13034 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203761114 EBV:13306-13328 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203761936 EBV:16084-16106 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203762043 EBV:16378-16400 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203762865 EBV:19156-19178 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203762972 EBV:19450-19472 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203763794 EBV:22228-22250 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203763901 EBV:22522-22544 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203764723 EBV:25300-25322 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203764830 EBV:25594-25616 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203765652 EBV:28372-28394 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203765759 EBV:28666-28688 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203766581 EBV:31444-31466 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203766688 EBV:31738-31760 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203767510 EBV:34516-34538 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1203767617 EBV:34810-34832 CGGGGTCCCTCCGGCTGGCCTGG - Intergenic
1185892827 X:3835720-3835742 AGGGGCCGCGGCGGCTGTCCCGG - Intronic
1185897935 X:3874140-3874162 AGGGGCCGCGGCGGCTGTCCCGG - Intergenic
1185903054 X:3912571-3912593 AGGGGCCGCGGCGGCTGTCCCGG - Intergenic