ID: 1175913197

View in Genome Browser
Species Human (GRCh38)
Location 20:62414261-62414283
Sequence GCTGCTGCTGGGCCAGGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 990
Summary {0: 1, 1: 1, 2: 7, 3: 114, 4: 867}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175913183_1175913197 16 Left 1175913183 20:62414222-62414244 CCCTTGGCCTGACACTGCCTGCC 0: 1
1: 0
2: 0
3: 21
4: 242
Right 1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG 0: 1
1: 1
2: 7
3: 114
4: 867
1175913182_1175913197 17 Left 1175913182 20:62414221-62414243 CCCCTTGGCCTGACACTGCCTGC 0: 1
1: 0
2: 1
3: 20
4: 219
Right 1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG 0: 1
1: 1
2: 7
3: 114
4: 867
1175913187_1175913197 -1 Left 1175913187 20:62414239-62414261 CCTGCCCTGGCCCTAGCCCGCAG 0: 1
1: 0
2: 3
3: 55
4: 492
Right 1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG 0: 1
1: 1
2: 7
3: 114
4: 867
1175913184_1175913197 15 Left 1175913184 20:62414223-62414245 CCTTGGCCTGACACTGCCTGCCC 0: 1
1: 0
2: 6
3: 44
4: 417
Right 1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG 0: 1
1: 1
2: 7
3: 114
4: 867
1175913188_1175913197 -5 Left 1175913188 20:62414243-62414265 CCCTGGCCCTAGCCCGCAGCTGC 0: 1
1: 0
2: 3
3: 14
4: 296
Right 1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG 0: 1
1: 1
2: 7
3: 114
4: 867
1175913186_1175913197 9 Left 1175913186 20:62414229-62414251 CCTGACACTGCCTGCCCTGGCCC 0: 1
1: 0
2: 4
3: 65
4: 608
Right 1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG 0: 1
1: 1
2: 7
3: 114
4: 867
1175913189_1175913197 -6 Left 1175913189 20:62414244-62414266 CCTGGCCCTAGCCCGCAGCTGCT 0: 1
1: 0
2: 3
3: 21
4: 286
Right 1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG 0: 1
1: 1
2: 7
3: 114
4: 867

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175913197 Original CRISPR GCTGCTGCTGGGCCAGGAGC AGG Exonic
900095696 1:939279-939301 GCTGCTGCTGCCGCGGGAGCTGG + Exonic
900097202 1:944735-944757 GCAGCAGCTGGCCCAGGGGCCGG - Exonic
900098864 1:952492-952514 GGAGCTGCTGGCCCTGGAGCCGG - Exonic
900117193 1:1033798-1033820 GCTGGGGCTGGGCCCGGGGCCGG - Intronic
900186014 1:1333624-1333646 CCTGCTGCTGAGCCTGGCGCTGG + Exonic
900291247 1:1924436-1924458 GCTGCTGCTGGCCCCGGCCCCGG + Exonic
900298490 1:1964860-1964882 CCCGCAGCTGGGCCAGGAACGGG - Intronic
900360596 1:2287077-2287099 GCTGCTGTGGGGCCTGCAGCTGG - Intronic
900514243 1:3073783-3073805 GCTCCCGCTGGGCCAGGGTCGGG - Intronic
900765486 1:4502173-4502195 GCTGCTGATGGTCCAGGGGGTGG - Intergenic
901136475 1:7000072-7000094 GCTGGTGCTGGGTGAGGGGCTGG + Intronic
901206499 1:7500599-7500621 GCTGCTGCTGCTACAGAAGCGGG - Intronic
901493332 1:9607671-9607693 GCTGCTGGTTGGCGAGGGGCAGG - Exonic
901497601 1:9630851-9630873 CTCCCTGCTGGGCCAGGAGCCGG - Intergenic
901516814 1:9753235-9753257 GCTGCTGATGTGACAGGAGGTGG + Intronic
901644454 1:10709110-10709132 GCCGCTGCTGGTCCAGGACTTGG + Intronic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
901665723 1:10825060-10825082 GCTGCTGCCAGGCCGGGAGGTGG + Intergenic
901700517 1:11042770-11042792 GCTCCTTCTGGGCCAGGACTAGG - Intronic
902232598 1:15037187-15037209 CCTGCTGCTGGGCATGGGGCTGG - Intronic
902437866 1:16409733-16409755 GCAGGTTCTGGCCCAGGAGCTGG + Exonic
902447840 1:16478391-16478413 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902449340 1:16486634-16486656 GCTGCAGCTGGGAGGGGAGCTGG - Intergenic
902467740 1:16628604-16628626 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902505408 1:16936643-16936665 GCTGCAGCTGGGAGGGGAGCTGG + Exonic
902506840 1:16944124-16944146 CCTGCTGCTGGGCCACCTGCAGG - Exonic
902631163 1:17705526-17705548 GCTGGGGCTGGGCCATGAGCTGG + Intergenic
902761136 1:18581459-18581481 GCTGGAGGTGGCCCAGGAGCAGG - Intergenic
902795859 1:18800009-18800031 GGTGCTGCTGTGCCTGGGGCTGG + Intergenic
902833697 1:19033865-19033887 GCTGATGCTGGGCCAGATCCTGG - Intergenic
903112681 1:21150174-21150196 GCTGCTGCTGCAGCAGGGGCGGG - Intronic
903328869 1:22586726-22586748 TCTGCTGGTGGGGCAGGGGCGGG + Intronic
903385225 1:22921625-22921647 GCTAGGGCTGGGCCTGGAGCTGG + Intergenic
903468450 1:23568408-23568430 GCCGCGGCGGGGCCAGGCGCCGG + Intergenic
904082666 1:27882062-27882084 GCTGCTGCTGAGCGAGGTCCTGG + Exonic
904299653 1:29546121-29546143 GCTTTTGCTGGGCCAGGATGGGG - Intergenic
905017315 1:34786499-34786521 GCTGCAGCTGGGGCTTGAGCTGG + Intronic
905137127 1:35808354-35808376 GCGGCGGCGGGGCCCGGAGCGGG + Exonic
905340828 1:37276148-37276170 GCTGCTGCTCCACCAGGAGACGG + Intergenic
905581393 1:39085050-39085072 GCTGCTGCTTGGCAAAGAGCTGG - Intronic
905732732 1:40307669-40307691 GCTGCTGATGGGACTGGGGCAGG - Intronic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906294629 1:44641923-44641945 GCTGCTGCCCGGCTGGGAGCTGG + Intronic
906962425 1:50426695-50426717 GCCTCTGCTGTGCCAGGGGCTGG + Intergenic
907270920 1:53290718-53290740 GCTGCTGCTTGGGAAGAAGCTGG - Intronic
907328502 1:53656342-53656364 TCTGCAGCTTGGCCAGGAGGAGG - Intronic
907515950 1:54993615-54993637 GGTGCAGCAGGGCCAGGGGCAGG - Intergenic
908277927 1:62495669-62495691 TCTGCTGCAGGTCCAGGATCTGG - Exonic
911070798 1:93830504-93830526 GGAGCTTCTGAGCCAGGAGCAGG - Intronic
911079708 1:93916439-93916461 GGACCTGCTGAGCCAGGAGCGGG + Intergenic
911164125 1:94709948-94709970 GCTGAGGCTGGGACAGGAGAGGG + Intergenic
911176148 1:94820331-94820353 GCTGGGGCTGGGGCTGGAGCCGG - Exonic
911647498 1:100352341-100352363 GCTGCTGCGGAGAAAGGAGCGGG + Intronic
912418803 1:109529904-109529926 GCTGCTGCTTGCCCAGGCCCGGG + Intergenic
912715799 1:111982734-111982756 GCGGCTGCCGGCCCAAGAGCTGG - Exonic
914950537 1:152110012-152110034 GCAGCTGCTGGGAGAGGAACGGG - Exonic
914950578 1:152110282-152110304 GCAGCTGCTGGGAGAGGAACCGG - Exonic
914950749 1:152111299-152111321 GCTGCTGAAGAGCGAGGAGCAGG - Exonic
914999369 1:152574075-152574097 GCTGATGATGGGCATGGAGCAGG + Intronic
915300210 1:154947416-154947438 GCTGCTGCAGGCCCAGCTGCAGG - Exonic
915557620 1:156669236-156669258 GCTGCTCCTGAGCAGGGAGCGGG + Exonic
915590693 1:156868563-156868585 GCTGCTGCGGTGCCAGGTGGAGG + Exonic
915973112 1:160367650-160367672 GCTGCTGCCGGGACTGGAACTGG + Intronic
917631340 1:176894140-176894162 GCTGCAGCTGGGCCAGGCTAAGG + Intronic
918265192 1:182835980-182836002 GCTGCTGCTGTGACAGGAAGCGG + Intergenic
919758236 1:201079364-201079386 GCTGCTGGGAGGTCAGGAGCAGG - Intronic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
920446756 1:206023749-206023771 GCTGCTGGTGCTCCTGGAGCTGG - Exonic
921217548 1:212950653-212950675 GCTGCTGCTGGGCCTGGGGCTGG - Exonic
921671161 1:217925289-217925311 CCCGCAGCTGGGCCAGGTGCCGG - Intergenic
922346275 1:224699364-224699386 GCTGCCGAAGGGCCAGGAGAAGG - Intronic
922472949 1:225887910-225887932 GCTGCGGCTCTTCCAGGAGCCGG - Exonic
922480953 1:225939880-225939902 GCTGCGGCTCTTCCAGGAGCCGG - Exonic
922575553 1:226658814-226658836 GCAACTGCTGGGCCTGGGGCAGG + Intronic
922804171 1:228377187-228377209 CGTGCAGCTGGGCCAGGTGCGGG - Exonic
923567635 1:235088333-235088355 GCTAGTGCTGGGCTTGGAGCTGG + Intergenic
923704436 1:236332592-236332614 GCTGCTGATCGGACAGGAGGCGG - Intergenic
923822119 1:237456669-237456691 GATGTTGCTGGGCGAGAAGCAGG + Exonic
924043875 1:240009194-240009216 GCTCCAGCTGGGCCAGGAGTAGG - Intergenic
924052519 1:240092748-240092770 GCTGTTGCTGGAGCTGGAGCTGG - Exonic
924052520 1:240092754-240092776 GCTGCTGCTGTTGCTGGAGCTGG - Exonic
924277048 1:242399779-242399801 GCTGCTGCTCTGACAGGAGGCGG - Intronic
924375481 1:243403617-243403639 GCTGCTGCTCCGACAGGAGATGG - Intronic
924404750 1:243730858-243730880 GCTGCAGCCTGGCAAGGAGCCGG + Intronic
924727431 1:246683532-246683554 GCTGCTGCGCTGCCATGAGCGGG + Intergenic
1063295095 10:4797264-4797286 ACTGCTGCAGGCCCAGGGGCAGG - Intronic
1063366236 10:5492728-5492750 GCTGATGGTGGCCCAGGAGGAGG + Intergenic
1063983216 10:11473276-11473298 GGTGCTGGTGAGGCAGGAGCCGG + Intronic
1064942112 10:20746606-20746628 GCTGCTGCTCTGACAGGAGGTGG - Intergenic
1065122312 10:22542029-22542051 GCTTCAGCTGGGCCAGAAACTGG + Exonic
1065140370 10:22714083-22714105 GCTGCTGCGGGGCGGGGAGCCGG - Intronic
1065626844 10:27638542-27638564 GCTGAGGCTAGGCCAGGAGTGGG + Intergenic
1065917709 10:30366573-30366595 GCTGCAGCTGGTCCATGAGCTGG + Intronic
1066397539 10:35040890-35040912 GCTGCTGATGTGACAGGAGGCGG + Intronic
1066431615 10:35357179-35357201 GCTGGGGCTGGGGCAGGGGCAGG - Intronic
1066685351 10:37976423-37976445 GCCGCTCCGGGGCCAGGAGGCGG + Intronic
1067045559 10:42983312-42983334 GCTGCAGCTGGGCCAGAGGGAGG - Intergenic
1067055325 10:43046510-43046532 GCTGCTGCTGGGCCCTCAGGTGG - Intergenic
1067078362 10:43200681-43200703 TCAGCTGCTGGGCCAGCACCAGG + Exonic
1067273130 10:44809919-44809941 GCTGCAGCTGGAGCTGGAGCAGG - Intergenic
1067299239 10:44994056-44994078 GCTGCTGCTGGGCATTGAGCGGG - Exonic
1067577646 10:47418412-47418434 GCAGCAGCAGGGTCAGGAGCAGG - Intergenic
1067697786 10:48548184-48548206 GCTGTCACGGGGCCAGGAGCTGG - Intronic
1067839757 10:49666250-49666272 GCTGGAGCTGGGGCTGGAGCTGG - Intergenic
1067839762 10:49666268-49666290 GCTGGAGCTGGGGCTGGAGCTGG - Intergenic
1068204181 10:53827459-53827481 GCTGCCACTGGTGCAGGAGCCGG + Exonic
1068940997 10:62681228-62681250 GTTGCTGCTGGGCCACCAGCAGG - Intergenic
1069202110 10:65632958-65632980 GCTGCTTCTGGGTCAGGGGAAGG - Intergenic
1069613765 10:69793054-69793076 GCTACTGCTGGGGAAAGAGCTGG + Intergenic
1069634323 10:69916256-69916278 GGGGCAGCTGGGCCGGGAGCAGG + Intronic
1069793989 10:71040857-71040879 CCTGCTGCTGGGAGGGGAGCTGG - Intergenic
1069995196 10:72337433-72337455 GCTGACCCTGGGCCAGGTGCTGG + Intronic
1069997703 10:72353228-72353250 GCTGCTGCGGGCTCAGGAGCAGG - Intronic
1070152173 10:73811674-73811696 GCGGCTGCTAGGGCCGGAGCCGG - Intronic
1070352953 10:75611051-75611073 GCTGCTGCAGAGGCTGGAGCTGG + Intronic
1070536217 10:77379769-77379791 GGAGCTGCTGGCCCATGAGCTGG - Intronic
1070609921 10:77926325-77926347 GCTGCTCTTGGCCAAGGAGCGGG - Exonic
1070801460 10:79246713-79246735 GCTGCTGCTCTGCCAGGCCCTGG - Intronic
1070806262 10:79272878-79272900 GCTGGGGCTGGGACAGCAGCAGG - Intronic
1070831385 10:79420075-79420097 GCAGCTGCTGGGGGTGGAGCAGG - Intronic
1071491750 10:86140985-86141007 GCTGCTGATGGACAAGGGGCTGG - Intronic
1071857872 10:89644687-89644709 GCTGCAGCTCCGGCAGGAGCGGG + Exonic
1072102321 10:92240293-92240315 GCTGCTGCTGGGGCTGGGGCTGG + Exonic
1072679772 10:97498579-97498601 GCGGCTGCTGGGCACGCAGCCGG + Exonic
1073176324 10:101559716-101559738 GCTGGTACTGGGCAAGGGGCTGG - Intergenic
1073295853 10:102438251-102438273 GCTGGGGCAGGGCCAGGAGGAGG + Intergenic
1073349527 10:102809966-102809988 GCCGCTGCTGGGCCTGAAGGCGG - Exonic
1073363680 10:102919434-102919456 ACTGCTGCTGGGCAACGTGCTGG + Exonic
1073683240 10:105727760-105727782 GGTGCTTCTGAGCCAGGAGAAGG - Intergenic
1075697624 10:124448126-124448148 GATGCTGCGGGCCCAGGCGCCGG - Exonic
1075911558 10:126129445-126129467 GGTTCCTCTGGGCCAGGAGCTGG + Intronic
1076110465 10:127855760-127855782 GCTCCTGCAGGGGCTGGAGCTGG + Intergenic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1076272119 10:129162917-129162939 GCTGCTGCGGGTCCTGCAGCAGG + Intergenic
1076272455 10:129166182-129166204 ACATCTGCTGGGACAGGAGCTGG + Intergenic
1076367784 10:129933589-129933611 GAGGCTGCTGGGCTGGGAGCGGG - Intronic
1076370727 10:129951458-129951480 GCTGCTGCAGGGCCTGGGGAAGG + Intronic
1076476729 10:130758804-130758826 ACTCCTGCCAGGCCAGGAGCTGG + Intergenic
1076571866 10:131438429-131438451 CCAGCTGCTGGGCAAGGAGGAGG + Intergenic
1076854024 10:133106476-133106498 GCCCCTGCTGTGCCAGGATCTGG + Intronic
1076882721 10:133247471-133247493 GGTGCTGCTGGAGCAGGTGCAGG + Intergenic
1076882874 10:133248082-133248104 GGGGCTGCTGGCCCGGGAGCTGG + Intergenic
1076910424 10:133385388-133385410 GGTGGGGCTGGGCCTGGAGCAGG - Intronic
1076921678 10:133457612-133457634 GATGATGCTGGGCCCGGACCTGG + Intergenic
1077066061 11:641345-641367 GCGGCAGCGGGGCCAGGGGCTGG + Intergenic
1077112943 11:869920-869942 GCTGGAGCTGGCCCGGGAGCTGG - Exonic
1077145157 11:1041305-1041327 GTAGCTGCTGGGCCTGGAGGTGG + Intergenic
1077225290 11:1436827-1436849 GCTGCGGGTGGGGCAGGACCCGG + Intronic
1077356462 11:2121125-2121147 GGTGGTGCTGGGCCGGGCGCAGG - Intergenic
1077416713 11:2427351-2427373 GCGGCTGCTGGCCAAGGCGCGGG + Intergenic
1077433746 11:2528411-2528433 GCTGCTGCTGGGACACCAGCAGG - Intronic
1077491599 11:2863233-2863255 GCTCCTGCTGGGGCTGGAGATGG - Intergenic
1077562573 11:3273087-3273109 GCTGGTGCTGGTGCAGGTGCAGG + Intergenic
1077568466 11:3318906-3318928 GCTGGTGCTGGTGCAGGTGCAGG + Intergenic
1077610347 11:3639999-3640021 GCAGCTGCAGGGCCCGGATCAGG + Exonic
1077634926 11:3835913-3835935 GCTGCAGCTGGGCTGGGAGGAGG + Intronic
1077635119 11:3837025-3837047 GCTGCTGCTAGGCGGGGAGGAGG - Intronic
1077662490 11:4082330-4082352 GCTGCTGGTGGCCAAGGAGGGGG + Exonic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1078528910 11:12121310-12121332 GCTACTGCTGGAGCAGGAGCAGG + Intronic
1078631935 11:13010722-13010744 GCTGCTGCTGGAGCAGGAACGGG + Intergenic
1079090338 11:17476353-17476375 GCTTCTGCAGGGCCAAGAGCTGG - Intronic
1080239405 11:30109470-30109492 GCTAGTGCAGGGCCAGAAGCAGG - Intergenic
1080418546 11:32091241-32091263 GCTGCTGCTGGCGCTGGTGCTGG + Exonic
1081614927 11:44585139-44585161 GCTGCTCCTGGGTAAGGGGCTGG - Intronic
1082076765 11:47980987-47981009 GCTGCTGCTGCGCCTGGGCCAGG + Exonic
1082790724 11:57345138-57345160 GAAGCTGCAGAGCCAGGAGCTGG - Intronic
1083281395 11:61629224-61629246 GCTGGTGCTGGGCATTGAGCGGG + Intergenic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083712453 11:64557568-64557590 GGTGCTGAGGGGCCAGAAGCAGG + Intronic
1083735082 11:64675590-64675612 GCTGCTGCAGAGCCAGGACTGGG + Intronic
1083779903 11:64912369-64912391 GCTGCCTCGGGGTCAGGAGCAGG + Exonic
1083800139 11:65041748-65041770 GCTGCTGCAGGCCCAGGTGCAGG + Exonic
1083811352 11:65108530-65108552 GCGGCGGCTGGCGCAGGAGCAGG + Exonic
1083920108 11:65777954-65777976 GCTGCTGCTGCGGCTGGAGGCGG - Exonic
1084274307 11:68043856-68043878 GCTGCTGCAGGGCCCCGAGGCGG - Exonic
1084468529 11:69341595-69341617 GCTGCTGTGGGTCCAGGGGCTGG - Intronic
1084564371 11:69920897-69920919 CCTCCTGCTGCCCCAGGAGCGGG + Intergenic
1085394675 11:76201257-76201279 GCTGACGCTGGGACAGGAGCAGG + Intronic
1085530366 11:77189053-77189075 GCGGCTGCTGAGCCCAGAGCAGG + Intronic
1085782547 11:79422772-79422794 GCTGGTTCTGGGCCTGGGGCAGG + Intronic
1086455327 11:86954980-86955002 GCTGCTCCTGGGGCCGGCGCGGG - Exonic
1088599593 11:111462774-111462796 CCGGCTGCAGGGCCAGGAGGAGG + Intergenic
1088743509 11:112785794-112785816 GGTGTTGATGGGCCTGGAGCTGG - Intergenic
1089080963 11:115775951-115775973 GCTGCAGCTGGGCCAGCATTTGG - Intergenic
1089138729 11:116269857-116269879 CCTGCTGCTGGGAGAGAAGCAGG + Intergenic
1089163593 11:116458072-116458094 GCTGGTGGGGGGCCAGGGGCGGG + Intergenic
1089249004 11:117144293-117144315 GCTGCTGCTGGTGCTGGGGCCGG + Exonic
1089249006 11:117144299-117144321 GCTGGTGCTGGGGCCGGAGGAGG + Exonic
1089352336 11:117828683-117828705 GCAGCTGCGGGGCTGGGAGCCGG + Intronic
1089366665 11:117924837-117924859 GCTGGTGCTGGGTGAGGAGGTGG - Intronic
1089759814 11:120715159-120715181 GCTTATCCTGGGCCAGGTGCTGG + Intronic
1089774605 11:120827454-120827476 CCTGCTGCTGGGCCATGGTCTGG + Intronic
1090302144 11:125651708-125651730 GCTGCTACTGAGTGAGGAGCAGG + Intronic
1090797880 11:130150891-130150913 GCCGCTGCCGTCCCAGGAGCAGG - Intergenic
1091274706 11:134342442-134342464 GCTGCTGCTGGGGCCGGGGCGGG - Intronic
1091299851 11:134500676-134500698 GCTGGTGCTTGGCCAGGTCCTGG - Intergenic
1091312462 11:134584451-134584473 GCAGCTCCCTGGCCAGGAGCTGG - Intergenic
1091643769 12:2257537-2257559 GCTGCTGATCTGACAGGAGCTGG + Intronic
1091758529 12:3072049-3072071 GGTACTGCTGGGCCAGAAGGTGG - Intergenic
1092159603 12:6308933-6308955 CCACCAGCTGGGCCAGGAGCAGG + Intergenic
1092488045 12:8919803-8919825 GCTGCTGCTGGAGCATGAACTGG - Exonic
1094142759 12:27198093-27198115 GCTGCTGTTGAGCTAGGGGCTGG - Intergenic
1094437064 12:30432300-30432322 GCTGCTGCAGAGCAAGTAGCTGG + Intergenic
1094494562 12:30981257-30981279 GCTGCTGGAGGGCCGGGTGCTGG - Intronic
1094813264 12:34162333-34162355 GCAGCTGCTTGGCCAGATGCAGG - Intergenic
1095038625 12:37420021-37420043 GCTGGGGCTGGGGCTGGAGCTGG - Intergenic
1096045719 12:48560361-48560383 AGTGCTGCTGAGCCAGGAGGAGG - Intergenic
1096073792 12:48789569-48789591 GCTGGGGCTGGGGCAGGGGCAGG - Intergenic
1096092783 12:48914478-48914500 GCCTCTGCAGGGCCAAGAGCTGG - Exonic
1096103146 12:48981334-48981356 GGAGCTGCTGCGCCTGGAGCCGG + Exonic
1096685976 12:53288549-53288571 GCTGCCTCAGGGCCCGGAGCTGG - Exonic
1096895879 12:54820237-54820259 GCTGCTGCTGGCCCACGTGTGGG - Intergenic
1096911108 12:54984806-54984828 GATGTGGCTGGGCCAGGAGGCGG - Intergenic
1096946644 12:55414604-55414626 GCTGCTGCTGGAGCATGAACTGG + Intergenic
1096983714 12:55743349-55743371 GCAGCTCCAGGGCGAGGAGCAGG - Exonic
1097040626 12:56153976-56153998 GCTGCTGCTGGCTTAGCAGCAGG - Exonic
1097088697 12:56488268-56488290 GCTGGGGCTGGGGCAGGAGAAGG + Exonic
1097255949 12:57674742-57674764 GGTGCTGCTGGGCCGGAAGGTGG + Intergenic
1097266582 12:57749169-57749191 GCTGCTGCTGGTACTGGAGATGG - Exonic
1097383230 12:58920172-58920194 GCTGCTGCTGTGCGCGGTGCTGG - Exonic
1098293362 12:68980193-68980215 GCTGCTGCGTGCCCAGGAGTGGG - Intergenic
1098484245 12:71002117-71002139 CCTCCAGCTGGGCCAGGATCTGG - Intergenic
1100616991 12:96238476-96238498 GCTGCTGCTGGGCACGGGCCTGG + Intronic
1100808284 12:98311075-98311097 GGTGCTGCTGAGCCAGGCACGGG - Intergenic
1100980543 12:100159020-100159042 GCTGCAGCCGGTCCACGAGCTGG + Intergenic
1101594419 12:106151278-106151300 CCTACTGCTGAGGCAGGAGCCGG + Intergenic
1101824594 12:108210274-108210296 GCTGCAGCTGGCCCAGGAGTCGG + Exonic
1101910497 12:108857431-108857453 GCTGTTGCTGGCCGAGGAGGAGG + Exonic
1102186699 12:110953925-110953947 GCTGGTGCTGGGCTAGCAGGGGG + Intergenic
1102207281 12:111099186-111099208 GCCTCTGCTGGGGCAGGACCTGG - Intronic
1103209545 12:119156560-119156582 GCTGCTGCTGTACCAGGAGGAGG - Exonic
1103865355 12:124047433-124047455 GCTGCTGATCTGCCAGGAGGTGG - Intronic
1103908142 12:124337800-124337822 GCTGGGGCTGGAACAGGAGCCGG + Intronic
1103934160 12:124466461-124466483 GCTGCAGCTGGCCCTGGAGCTGG - Intronic
1104632435 12:130414591-130414613 GCTGCGGCCGTGCCAGGGGCAGG + Intronic
1104636711 12:130442130-130442152 GCTGCTGGTGGGCAAGGACGTGG - Exonic
1104857909 12:131910442-131910464 GCTGCAGCAGAGCAAGGAGCCGG - Intronic
1104864020 12:131942098-131942120 GCTGCTGCAGGAGCAGGGGCAGG + Intronic
1104877268 12:132044248-132044270 GCTGCGGCTGGAGCAGGAGGAGG + Exonic
1104967264 12:132513904-132513926 GTGGATGCTGGGCCAGGTGCCGG - Intronic
1104989567 12:132618322-132618344 GCTGCGGCGGAGGCAGGAGCTGG + Intergenic
1105070916 12:133234137-133234159 GCTCCTGCTGGTCCAGGACACGG + Exonic
1106033721 13:26025355-26025377 GCTGCAGCAGGGCCAGCTGCAGG + Exonic
1106816881 13:33418367-33418389 GCTGCAGCTGGGCAAGGGGAGGG + Intergenic
1107006536 13:35618900-35618922 GGTGCTGCTGGGCCAAGTACAGG + Intronic
1107942989 13:45391282-45391304 GCTGCTGCTGGCGCTGGTGCTGG - Intergenic
1109073783 13:57806478-57806500 CCTGCTGTTGTGCCAGGAACAGG - Intergenic
1109521173 13:63512161-63512183 GCTACAGCTGGACCAGTAGCTGG - Intergenic
1112300212 13:98223126-98223148 GCAGCTGATGGGACAGAAGCAGG + Intronic
1112376285 13:98844607-98844629 GCTGCTGGTGGCCAAGCAGCAGG - Intronic
1112574452 13:100623173-100623195 CCTGCTGCAGGGCCAAGGGCAGG + Intronic
1112591279 13:100765216-100765238 GCCGCCACTGGGCCTGGAGCGGG + Intergenic
1112783318 13:102925823-102925845 GCAGCTGCTGGGGCTGGAGCAGG + Intergenic
1113255547 13:108500884-108500906 GCTGGAGCTGGGCAGGGAGCGGG - Intergenic
1113312131 13:109141266-109141288 GCTGCTGAGAGGCCTGGAGCTGG - Exonic
1113323908 13:109265279-109265301 GGAGCTGCTGAGCCAGGAGAAGG - Intergenic
1113557856 13:111253007-111253029 GCTGCTGCTGGGCCTGGCCCTGG - Intronic
1113802892 13:113095693-113095715 CCGGCTGCAGGGCCTGGAGCAGG - Intronic
1113817103 13:113180008-113180030 GCTGCTGCTGCACGAGGCGCTGG - Exonic
1114199916 14:20510513-20510535 GCTGCTGCTGGGCCTGGGGATGG + Exonic
1114267981 14:21083858-21083880 GCTGCTGCAGGGCTCGGGGCAGG - Exonic
1114454417 14:22845928-22845950 GCTGCTGCTGCTCCTGGTGCTGG + Exonic
1114519065 14:23321646-23321668 GCTGCTGCTGGAGCCCGAGCCGG + Exonic
1114670469 14:24408231-24408253 GCTGCTGCTGAGCCTGGTGCGGG + Exonic
1116941597 14:50796749-50796771 ACTGCTGCTGGGAAAGGAACTGG - Intronic
1116953111 14:50896581-50896603 GCAGCTTCTGAGCCAGGAGAAGG - Intronic
1117313461 14:54551178-54551200 GGTGCTGCTGGGCCTGGAGCTGG - Intergenic
1118071332 14:62249616-62249638 GCTGCTGCTGGGGGAGGTGTGGG - Intergenic
1118326759 14:64786535-64786557 TCTGCTTCTGGGCCAGCGGCTGG - Exonic
1118373373 14:65156649-65156671 GCTGCTGCTGGAGCGGGAGGAGG - Intergenic
1118717505 14:68570589-68570611 TCTGCAGCTGAGCCAGGAGGGGG + Intronic
1119196478 14:72720505-72720527 GCTGCTGCTTGGCCAGTATCTGG + Intronic
1119389123 14:74278488-74278510 GCTGGTGCTAGAGCAGGAGCAGG - Intergenic
1119473184 14:74911820-74911842 GGTGCAGCTGGTCCAGGACCCGG - Exonic
1119855980 14:77901337-77901359 ACTGCTCCTGGCCCTGGAGCTGG + Intronic
1120028319 14:79611026-79611048 GCTGCTGCTGGGGAAAGACCAGG + Intronic
1120787466 14:88550535-88550557 GCGGCTGCTGGGTGAGCAGCTGG - Exonic
1120892542 14:89504120-89504142 CCTGTTCCTGGGCCAGGAACTGG + Intronic
1120905671 14:89619120-89619142 GCTGCAGCTCGGCCGGGAGACGG - Exonic
1121016929 14:90554535-90554557 CCTGGTGCTGTGCCAGGTGCGGG + Intronic
1121452257 14:94016479-94016501 GCTGCTCCTGAGCCAAGAGCAGG - Intergenic
1121775134 14:96585319-96585341 GCAGCCGCTGGGCCTGGGGCGGG - Intergenic
1121868754 14:97387616-97387638 GCTCCTGCTGGCACAGGAGTGGG - Intergenic
1122068400 14:99189586-99189608 GCGGCTACTGGGTCAGCAGCTGG + Intronic
1122111052 14:99502894-99502916 GCTGCTGCTGGGCTGGTTGCTGG - Exonic
1122273917 14:100581463-100581485 GGGGCTGCGGTGCCAGGAGCCGG - Intronic
1122278889 14:100609875-100609897 GCTGGGGCTGGGGCAGCAGCAGG + Intergenic
1122445037 14:101761835-101761857 GCTGCTGCGGGGGCAGGCGGCGG + Exonic
1122517644 14:102319885-102319907 GCTGCGGCAGGTCCTGGAGCAGG + Exonic
1122635326 14:103127054-103127076 GCCGCTGCTGGCGCTGGAGCGGG + Exonic
1122635346 14:103127159-103127181 GCTGCTGCGCGACCAGGTGCTGG + Exonic
1122836344 14:104432755-104432777 CCCACTGCTGGGCCAGGAGCCGG - Intergenic
1122924963 14:104895199-104895221 GCAGCAGCCTGGCCAGGAGCTGG - Exonic
1122969531 14:105146899-105146921 GGTGCTGTTGGGCCAGGGTCAGG - Intronic
1123099354 14:105785780-105785802 GCTGCTGCAGGCCGAGAAGCAGG - Intergenic
1202904041 14_GL000194v1_random:58453-58475 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1123980480 15:25597449-25597471 GCTGCTGGTGGAGCAGGAACCGG - Intergenic
1124232530 15:27957631-27957653 CCTGCTGCTGGGGAAGGTGCTGG - Exonic
1124328823 15:28789549-28789571 GCTGCTGCGGCGCCATGATCTGG - Intergenic
1124848055 15:33310894-33310916 GCTGAGGCTGAGCCAGGAGCTGG + Intergenic
1125506323 15:40269806-40269828 GCTGCTGCTGCTGCAGGTGCTGG - Intronic
1125647641 15:41285541-41285563 GGTGCTTCTGAGCCAGGAGATGG + Intergenic
1126857814 15:52855929-52855951 GCTGCTAATGGGCCAAGGGCTGG + Intergenic
1126890146 15:53196407-53196429 GCTGCTGCTGTGCCTTTAGCTGG + Intergenic
1127287792 15:57546024-57546046 GCTGGGGCTGGGCCATCAGCCGG + Intronic
1127772890 15:62244834-62244856 GCTGCAGCTGGTCCACGAGCTGG + Intergenic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1127964803 15:63915606-63915628 GGCACTGCTGGGCCAGGAGGAGG - Intronic
1128107984 15:65058443-65058465 CCTGCTGCTGGGCAACAAGCTGG - Exonic
1128144820 15:65327208-65327230 GGTGCGGCTGGGGCAGGAGGGGG - Exonic
1128639211 15:69323457-69323479 GGTGCTCCTGGGCCAGAGGCAGG + Intronic
1128740559 15:70080856-70080878 GGTGCTGCAAGCCCAGGAGCAGG - Intronic
1128944276 15:71810783-71810805 GCTGCAGCTGCGCCTGCAGCTGG + Exonic
1129030061 15:72611519-72611541 GCTGCAGCTGGTCCACGAGCTGG - Intergenic
1129034141 15:72639632-72639654 GCTACTGCTCCACCAGGAGCTGG - Intergenic
1129038286 15:72664267-72664289 GCTGCAGCTGGTCCACGAGCTGG - Intronic
1129079141 15:73024021-73024043 GCATCTGCTGGCCCAGGTGCAGG + Intergenic
1129211604 15:74072964-74072986 GCTGCAGCTGGTCCACGAACTGG + Intronic
1129215741 15:74097584-74097606 GCTACTGCTCCACCAGGAGCTGG + Intergenic
1129297624 15:74608625-74608647 CCTCCTGCTGGCCCAGGGGCAGG - Intronic
1129349976 15:74950258-74950280 GCTTCTCATGTGCCAGGAGCTGG + Intergenic
1129398799 15:75268120-75268142 GCTGCAGCTGGTCCACGAACTGG - Intronic
1129402407 15:75292396-75292418 GCTGCAGCTGGTCCACGAACTGG - Intronic
1129409061 15:75338852-75338874 GCTACTGCTCCACCAGGAGCTGG - Intronic
1129475949 15:75784830-75784852 GCTACAGCTGGTCCATGAGCTGG - Intergenic
1129680580 15:77656482-77656504 GCGGCTGCGGGGGGAGGAGCTGG - Intronic
1129707380 15:77802469-77802491 CCTGCAGAGGGGCCAGGAGCAGG + Intronic
1129728725 15:77917239-77917261 GCTGCAGCTGGTCCACGAGCTGG + Intergenic
1129732876 15:77941912-77941934 GCTACTGCTCCACCAGGAGCTGG + Intergenic
1129839791 15:78736632-78736654 GCTGCAGCTGGTCCACGAGCTGG - Intergenic
1130128785 15:81118461-81118483 GCTGCTTGTGGGACCGGAGCGGG + Intronic
1131013043 15:89034285-89034307 GCTGCTTCTGGGGTAGGAACTGG - Intergenic
1131048808 15:89333316-89333338 TCTGCTTCTGGGCCAGGAGGCGG + Exonic
1131117929 15:89805812-89805834 GCAGCTGCTTTGCCAGCAGCTGG + Intronic
1131120947 15:89823099-89823121 GCTGCTGCTGGGGCTGGGGAGGG + Intergenic
1131282549 15:91033133-91033155 GCTGCAGCTGGTCCATGAGCTGG + Intergenic
1131507381 15:93030257-93030279 GCTGGTCCTGCTCCAGGAGCTGG + Intergenic
1131753598 15:95536792-95536814 GCTGCTGATCGGACAGGAGGCGG + Intergenic
1132130734 15:99275990-99276012 GCTGCTGATGGGACAGGAGGTGG - Intronic
1132578775 16:675808-675830 GCTGCAGCTCATCCAGGAGCAGG + Exonic
1132588363 16:715791-715813 GCTGCTGCTGGCCGAGGGCCCGG + Exonic
1132616224 16:842281-842303 GTTGCTGCAGGCCCAGGAGACGG - Intergenic
1132671808 16:1105104-1105126 GCGGCTCCGGGGCCAGCAGCAGG + Intergenic
1132691049 16:1182112-1182134 GCTGTGGCAGGGGCAGGAGCAGG + Intronic
1132805520 16:1773419-1773441 GCGGCTGCTGCGGCCGGAGCAGG + Exonic
1132806878 16:1778986-1779008 GCTGCAGCTGGGCCTGGTGTGGG - Intronic
1132932465 16:2465924-2465946 GCTGGTGCTGGGGCAGGTGTGGG + Intergenic
1132936461 16:2483741-2483763 GCTGCTGCTCGGCCCAGAGGAGG + Intronic
1132943264 16:2518957-2518979 GCTGCTGCTGGAGGAAGAGCTGG + Intronic
1133045743 16:3087430-3087452 GGAGCTGCTGGGACAGGGGCTGG - Intergenic
1133303234 16:4795606-4795628 GCTGGCGCTGGGCCAGGAGCGGG + Intronic
1133370017 16:5239988-5240010 GCTGCGGCTGGGGCTGGAGGGGG + Intergenic
1134466986 16:14487723-14487745 GCTGGTGCTGGGGCTGGAACGGG + Intronic
1135400931 16:22165859-22165881 TCTGTACCTGGGCCAGGAGCTGG + Intergenic
1135400986 16:22166039-22166061 GTAGGAGCTGGGCCAGGAGCTGG + Intergenic
1136146614 16:28320111-28320133 GCAGCAGCTGGGCCTGGCGCTGG + Exonic
1136392288 16:29973471-29973493 GCTGCTGCTGGGCGCGGAAAAGG - Intergenic
1136671719 16:31864593-31864615 GCTGCTGCTGCTGCAGGAGGAGG - Intergenic
1136688083 16:32007785-32007807 ACGGCTGCTGGGCAAGGTGCTGG - Intergenic
1137285705 16:47014233-47014255 GCCGCCGCTGGCCCAGGAACTGG + Intergenic
1137440922 16:48497996-48498018 GCTGCTGCTGGGCTAGAAGAGGG - Intergenic
1137496812 16:48975902-48975924 GTTGCTGAGGGGCCAGTAGCAGG + Intergenic
1137676467 16:50305979-50306001 GCTGCTCCTGGGCGGGGGGCAGG + Intronic
1137827830 16:51514954-51514976 TAAGCTGCAGGGCCAGGAGCAGG + Intergenic
1138265513 16:55657021-55657043 GCGGTGGCTGGGACAGGAGCTGG + Intronic
1138336882 16:56260429-56260451 CCGGCTGCTGGGCCAGAAGCAGG + Intronic
1138336881 16:56260429-56260451 CCTGCTTCTGGCCCAGCAGCCGG - Intronic
1138455230 16:57117135-57117157 GCTGCCGCAGGGGCAGGAGAAGG + Intronic
1138594227 16:58021152-58021174 GCCCCTGCTGGTACAGGAGCAGG - Exonic
1139123909 16:64054519-64054541 GCAGCTGCTGGGTAAAGAGCTGG - Intergenic
1140025800 16:71289348-71289370 GCGGCTGCGGGGCCCGGAGGTGG - Exonic
1140354898 16:74297164-74297186 GCGGCGGCTGGGGCAGGGGCGGG - Intronic
1141164655 16:81652420-81652442 CCTGCTGCTTGGCATGGAGCCGG - Intronic
1141220356 16:82063799-82063821 GCTGAGGGTGGGCCAGGACCTGG + Intronic
1141605568 16:85151659-85151681 CCTGCTGCCTGGGCAGGAGCGGG - Intergenic
1141620905 16:85236019-85236041 GCTGCGGCTGGGGCTGGGGCTGG + Intergenic
1141667463 16:85473314-85473336 GCAGGGGCAGGGCCAGGAGCTGG + Intergenic
1142015098 16:87741389-87741411 GCTGCTGCTTTGACAGGAGGTGG - Intronic
1142031701 16:87841702-87841724 GCTGCAGCCGGGGCAGGGGCAGG + Intronic
1142117234 16:88365462-88365484 TCTGCTGCTGGACCAGGAGGTGG + Intergenic
1142142371 16:88478348-88478370 GCTGCGGGTGGGCCAGGGGTGGG + Intronic
1142142901 16:88480446-88480468 GGTGCTGGTGGGGGAGGAGCGGG + Intronic
1142227702 16:88885587-88885609 GCTGCTGCTGCCCAAGGGGCAGG - Intronic
1142359615 16:89619922-89619944 GCTGCTGCTGGGCTAGTCACAGG - Intronic
1142421031 16:89970210-89970232 GATGCGGCTGGAACAGGAGCTGG - Exonic
1142903243 17:3026388-3026410 GCTGGTGCTGGAGGAGGAGCGGG - Exonic
1142967021 17:3588106-3588128 GCTGGAGCTGGACCAGGGGCTGG + Intronic
1143014215 17:3883104-3883126 GCAGCTGCTGCCCCTGGAGCGGG - Exonic
1143112875 17:4562602-4562624 GCTGAGGCTGGGGCAGGAGATGG - Intergenic
1143171341 17:4932376-4932398 GTTGGTGCTGGGGCAGGAGAGGG + Intronic
1143447481 17:7017990-7018012 TGTGCTGCTGGGGCGGGAGCAGG + Intergenic
1144422091 17:15107999-15108021 GATGCTGTTGGGTCAGAAGCAGG + Intergenic
1145235309 17:21203758-21203780 GCTGCTGGGTGGTCAGGAGCTGG - Intronic
1145886340 17:28384823-28384845 GCTGCTCCTGGGGGAGGAGTCGG - Exonic
1146640932 17:34541093-34541115 CCTGCTGCTGGGGAAGGAGGCGG - Intergenic
1147374963 17:40017842-40017864 GCTGGTGCCTGGCCAGGGGCTGG + Intergenic
1147647489 17:42042659-42042681 CCTGCAGCTGGCCCAGGACCAGG + Intronic
1147658771 17:42105816-42105838 GCTGCTGCTGGAGCCAGAGCAGG + Exonic
1147661870 17:42121147-42121169 GCTGCAGCTGGGGCAGGGGCTGG + Exonic
1147722597 17:42548117-42548139 GCCGGTGCTGGGGCAGGAGATGG + Intergenic
1148083125 17:44978362-44978384 GCTGCTGCTCTGCCAGAGGCTGG - Intergenic
1148225222 17:45894571-45894593 GCTGCTGTTGGTGCCGGAGCTGG - Exonic
1148382388 17:47209477-47209499 GCTGGTGCAGGGGCTGGAGCTGG - Exonic
1148541362 17:48483177-48483199 AGGGATGCTGGGCCAGGAGCTGG + Intergenic
1148568460 17:48647473-48647495 GCTGCGGCTGGGGCGGGAGGTGG - Intergenic
1148860204 17:50600655-50600677 TCTGCTGAGGAGCCAGGAGCCGG + Intronic
1149688067 17:58550018-58550040 GCAGATTCTGTGCCAGGAGCTGG + Intergenic
1149865398 17:60148705-60148727 TGTGATCCTGGGCCAGGAGCGGG + Intergenic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150217392 17:63478074-63478096 GCTGCCGCTTAGCCAGGGGCAGG - Intergenic
1150302188 17:64055867-64055889 GCTGCTGCTGCTGCAGGAGCTGG + Exonic
1150653545 17:67025018-67025040 GCTGGTGCTGGGCCGGGAGCTGG + Intronic
1151349572 17:73523828-73523850 GCTTCTGCTGGGGCAGCATCTGG - Intronic
1151509470 17:74549497-74549519 GCAGCTCCAGGACCAGGAGCAGG + Intergenic
1151554633 17:74840482-74840504 CCTGCTCCTGGGCCAGGCACTGG - Intergenic
1151598355 17:75091374-75091396 CCTGGAGCTGGGCCAGGAGGAGG + Intronic
1151634074 17:75332043-75332065 ACTGCTTCTGTGCTAGGAGCAGG + Intronic
1151675751 17:75596534-75596556 GATGCTGCTGGCCCAGGAGGAGG + Intergenic
1151703121 17:75753784-75753806 GCCCCTGCTGGGGGAGGAGCTGG + Exonic
1151703541 17:75755411-75755433 GCTGGGGCTGGGGCAGGAGAGGG + Intronic
1151895084 17:76974724-76974746 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1151946326 17:77321895-77321917 GCTCCTGCTGGGCGGAGAGCAGG - Intronic
1151947839 17:77329223-77329245 GCTGCTGCAGGCCCTGCAGCTGG + Intronic
1152124434 17:78437905-78437927 TCTCCTCGTGGGCCAGGAGCTGG - Intronic
1152447906 17:80356485-80356507 GGTGCTGCTGGCCCTGGGGCAGG - Intronic
1152466925 17:80471731-80471753 GCTGGTGCTGGGCCAGGAGCAGG - Exonic
1152581064 17:81165811-81165833 TCTGCTGCTGGGCTCGGGGCGGG + Intronic
1152588135 17:81198171-81198193 GCAGCTGCTGGAGAAGGAGCCGG - Exonic
1152630669 17:81409455-81409477 GGTTCTGGAGGGCCAGGAGCGGG + Intronic
1152635314 17:81428431-81428453 CCTGTGGCTGGGCCAGGACCAGG - Intronic
1152702115 17:81824336-81824358 GCTGCTGCTGGGTGGGGAGCGGG + Exonic
1152718539 17:81911347-81911369 GCCGCTGCGGGGCCATGATCCGG - Exonic
1152730644 17:81967977-81967999 GCCGCTGTTGCGGCAGGAGCAGG - Intergenic
1152757992 17:82095044-82095066 GCTGGTGCTGGGGCCGGGGCCGG - Intronic
1152775912 17:82201887-82201909 GCTGCTGCTTCGCAAGGAGGAGG - Exonic
1152801475 17:82332803-82332825 GCTGCTGCTGAGCCCAGAGCGGG - Intronic
1153137304 18:1930586-1930608 GCCACTGCTGGCACAGGAGCAGG + Intergenic
1153167504 18:2279525-2279547 TCTGCAGCTTGGCCAGGTGCTGG + Intergenic
1153662071 18:7333844-7333866 GCAGCTGCAGGGCAGGGAGCTGG + Intergenic
1154001038 18:10482555-10482577 GGTGGTGCTGAGCCAGGGGCCGG + Intronic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1154066431 18:11111116-11111138 GCTTCTTCAGGCCCAGGAGCAGG + Intronic
1155218404 18:23662855-23662877 GCTGCTGCCGGGCCGGGCGGCGG - Exonic
1155279879 18:24228546-24228568 CCCGCTGCTGGGCCATGCGCAGG - Intronic
1155504710 18:26521827-26521849 GGAGCTGCTGGGGAAGGAGCAGG + Intronic
1156455230 18:37289461-37289483 GGGGCTGCTCTGCCAGGAGCAGG + Intronic
1157479035 18:48040978-48041000 GCTCCTGGTGGTGCAGGAGCAGG - Exonic
1157568950 18:48699421-48699443 GCTGGGGCTGGGGCTGGAGCCGG + Intronic
1157678133 18:49582721-49582743 GAAGCTGCTGGGTCAGCAGCTGG + Intronic
1157742407 18:50105269-50105291 GCTGATGCTGGTACTGGAGCTGG + Intronic
1159153550 18:64553024-64553046 GCTGCTGATGTGACAGGAGGTGG - Intergenic
1159940139 18:74400568-74400590 GCTGCACCTGGGCCCGGGGCAGG - Intergenic
1160174876 18:76585041-76585063 GCTGTCGCTTCGCCAGGAGCAGG + Intergenic
1160212925 18:76898127-76898149 GCTTTAGCTGGGCCAGGAGGAGG + Intronic
1160500051 18:79396878-79396900 GGTCCTGCAGGTCCAGGAGCCGG - Intronic
1160536443 18:79597035-79597057 GCTGGAGCCGGGTCAGGAGCTGG - Intergenic
1160701091 19:507773-507795 GCTGCTGCTGCAGCAGGAGCTGG - Exonic
1160730557 19:639958-639980 GCTGCTGCTGGCGCGGGCGCCGG + Exonic
1160807833 19:1000455-1000477 GCTGTGGCTGGGCCTGGCGCTGG + Exonic
1160963247 19:1734106-1734128 GCTGATGCCAGGCCTGGAGCTGG - Intergenic
1161060402 19:2211821-2211843 GGAGCTGCTGGGCCAGGAGAAGG + Exonic
1161063710 19:2227543-2227565 GCTGCTGCGGGGCGGGGGGCCGG + Intronic
1161086799 19:2339175-2339197 GCGGCTACTGGGCCGGGAGTCGG + Exonic
1161105687 19:2442925-2442947 GCTGCTGCTGGCCCCGCACCAGG - Intronic
1161125190 19:2552034-2552056 ACTGCTGATGGGACAGGAGGCGG - Intronic
1161316584 19:3620242-3620264 GCTGCGGCTGGAGCGGGAGCGGG - Exonic
1161457171 19:4375232-4375254 GCGGCAGCTGGGCCAGGTGGGGG - Intronic
1161488381 19:4548118-4548140 GCGGCTGCTGAGCTTGGAGCTGG - Exonic
1161526943 19:4762015-4762037 GCTCCTGCTGTTCCCGGAGCAGG - Intergenic
1161576653 19:5058251-5058273 GCTCATGCTGGGCCCTGAGCAGG - Intronic
1161626949 19:5332669-5332691 CCTGCTGCTGGGCCTTGCGCAGG - Intronic
1161703101 19:5805385-5805407 GCGGCGGCTGGGGCAGGGGCTGG + Intergenic
1161719883 19:5896853-5896875 GCTGGGGCTGTGCCAGGAGAGGG + Intronic
1161720389 19:5899016-5899038 GGGGCTGCTGGGCCAGGAGCAGG - Intronic
1161723148 19:5914641-5914663 GCTGGTGCTGGACCAGGCGGAGG + Exonic
1162042623 19:7979788-7979810 GCTGCTGCTGAGCCAGGGTTTGG + Intronic
1162328047 19:10010319-10010341 GCTGCAGCGCGGCCAGGAGCAGG + Exonic
1162412221 19:10513375-10513397 GATGCTGGTGTGCCTGGAGCAGG - Exonic
1162470929 19:10871673-10871695 GCGGCGGCGGGGCCTGGAGCCGG + Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162591968 19:11597764-11597786 GGTGGGGCTGGGCCAGGAGCTGG + Intronic
1162648171 19:12065047-12065069 GGTGCGGCTGGGCCGGCAGCCGG + Intronic
1162657162 19:12140001-12140023 GGTGCGGCTGGGCCGGCAGCCGG - Intronic
1162668712 19:12237290-12237312 GGTGGGGCTGGGCCAGCAGCCGG - Intronic
1162718515 19:12648249-12648271 CCTCCTGCTCCGCCAGGAGCCGG + Exonic
1162904944 19:13817819-13817841 GCTGGGGCTGGGGCAGCAGCGGG + Exonic
1162992836 19:14314567-14314589 GCTGCTGCTGTGGCCTGAGCAGG + Intergenic
1163158752 19:15452683-15452705 GCAGCTGCGGGGCCAGCTGCAGG - Exonic
1163287113 19:16355758-16355780 GCGGCTGCGGCGGCAGGAGCAGG - Exonic
1163606869 19:18280455-18280477 CCTGGTGCTGGGGCAGCAGCTGG + Exonic
1163715514 19:18870244-18870266 GCAGCAGCAGGGCCAGGAGGAGG + Exonic
1163943965 19:20519052-20519074 GGAGCTGCTGAGCCAGGAGAAGG + Intergenic
1164105350 19:22105378-22105400 GCGGCTGGCGGGCCAGGGGCTGG - Intergenic
1164156590 19:22601193-22601215 GCTGCAGCTGGTCCATGAGCTGG - Intergenic
1164443909 19:28300928-28300950 GATGCTGCTCAGGCAGGAGCAGG - Intergenic
1164539451 19:29112116-29112138 ACTTCTGCTGGGCCAAGAGCTGG + Intergenic
1164812993 19:31172884-31172906 CCTACTGCTGTGCCAGGAACAGG - Intergenic
1164900020 19:31910454-31910476 GCAGCTGCTGGGGCTGGAGTGGG - Intergenic
1164918583 19:32071764-32071786 GCTCCTTCTGGGCCAGGAGCTGG + Intergenic
1165062339 19:33210987-33211009 GGGGCTGCTGGGCCCGGAGCAGG - Intronic
1165210356 19:34230992-34231014 GCTGCTGATGTGACAGGAGGTGG + Intergenic
1165351673 19:35279193-35279215 GCTGCAGCTGGGCTCGAAGCAGG - Exonic
1165453209 19:35896923-35896945 GCAGCTGCTGGCCCAGGATGAGG - Exonic
1165479178 19:36051925-36051947 GCTGCTGCTCTGACAGGAGGCGG - Intronic
1165699851 19:37929191-37929213 GCTGGGGCTGGGGCTGGAGCCGG + Intronic
1165954483 19:39493593-39493615 GGTGCTTCTGAGCCAGGAGAAGG - Intronic
1166043825 19:40218034-40218056 GCTGCTGGTGGGCCCGGGGGCGG + Exonic
1166100035 19:40566230-40566252 GCTCCTGCAGAGCCGGGAGCTGG + Exonic
1166331171 19:42078873-42078895 GCTCCTGGTGCTCCAGGAGCTGG - Exonic
1166364561 19:42272036-42272058 TCCTCTGCTGGGCCTGGAGCCGG - Intronic
1166375155 19:42323849-42323871 GCGGCGGCGGGGCCGGGAGCGGG - Intronic
1166408944 19:42543480-42543502 GCTCTTCCTGGGTCAGGAGCAGG + Intronic
1166762637 19:45234548-45234570 GGCGCAGCTGGGCCAGGTGCTGG - Intronic
1166789770 19:45391935-45391957 GGAGCTGGTGGGGCAGGAGCAGG + Exonic
1166898044 19:46036325-46036347 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1166898068 19:46036435-46036457 GCAGCTGCAGGGGCAGGAGGAGG - Intergenic
1167013323 19:46823234-46823256 GAAGCTGCTGGGCCTAGAGCAGG + Intergenic
1167019102 19:46861112-46861134 GCCGCCGCTGGACTAGGAGCAGG + Intergenic
1167055977 19:47112032-47112054 GCTGCCCCTGCGCCCGGAGCTGG - Intronic
1167125478 19:47545645-47545667 GCCGGGGCTGGGCCAGGAGAAGG + Exonic
1167145674 19:47679920-47679942 GCACCTGCTTGGCCAGGAGCTGG - Exonic
1167145998 19:47681072-47681094 GCTGCTGGAGGCCCAGGGGCAGG - Exonic
1167272596 19:48514256-48514278 GCAGGCGCTGGGCCAGAAGCTGG + Intergenic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1167518811 19:49939876-49939898 ACTGCTGCTGGTGCAGGGGCAGG - Intronic
1167594186 19:50418686-50418708 GCTGGAGATGGGACAGGAGCTGG - Intronic
1167647635 19:50714212-50714234 GCGGCTGCTGGACAAGGGGCTGG - Exonic
1167663406 19:50809983-50810005 GCTGCTGATGGGACAGGATTTGG + Intergenic
1168063849 19:53908610-53908632 GCCGCCGCGGAGCCAGGAGCCGG - Intergenic
1168082127 19:54017863-54017885 TCTGATGCTAGGCCAGGTGCTGG + Intergenic
1168217916 19:54939870-54939892 TCGGCTGCTGCGCCAGGAGCTGG + Exonic
1168297395 19:55384127-55384149 GCTGCTGCTGGCCGTGGCGCTGG - Exonic
1168301128 19:55405838-55405860 GCTGCTGATGGGCTAGGGGAGGG - Intronic
1168701037 19:58439758-58439780 GTTGCTGATGGGCCCGGCGCAGG - Exonic
924959286 2:19187-19209 GCTGCCGCTGGGCCTGGCACTGG - Intergenic
925404602 2:3597808-3597830 ACTGCTGCTGAGGCAGGAGCCGG + Intronic
925609907 2:5693740-5693762 GCTGCTGCTGGACGAGGAGGTGG - Exonic
926298992 2:11588943-11588965 CCTGCCACTGGGCCAGGAGGTGG - Intronic
926326420 2:11788173-11788195 GCTGCTGCTGGGCCCTCAACTGG + Intronic
926892406 2:17649759-17649781 GCTGCAGCGGGGACAGAAGCAGG - Intronic
927484050 2:23476966-23476988 GCTACTGAAGGGACAGGAGCTGG + Intronic
927672649 2:25082063-25082085 GCTGCTGGTGGCCCAGGTGAGGG + Intronic
927894929 2:26775558-26775580 GCTGGTGCTGAGCCAGTGGCTGG + Exonic
928245766 2:29625774-29625796 GCTGCTGGAGGGCCAGGCTCTGG + Intronic
929545087 2:42850534-42850556 GCAGGGGCTGGGCCAGGGGCTGG - Intergenic
929684576 2:44022828-44022850 GCTGCTAATGGGCCATGAACTGG + Intergenic
930439802 2:51391278-51391300 GCTGCTGCTGGGAAGGGAGGAGG + Intergenic
930872628 2:56184175-56184197 GCTGCAGCTGGGCAAGGGGGAGG + Exonic
931197210 2:60064182-60064204 GAGGCTCCTGGGGCAGGAGCTGG + Intergenic
931429216 2:62196092-62196114 GCGGCTGCTGCGCCTGGAACCGG + Exonic
931747135 2:65300311-65300333 GCTGCAGCTTGGCCTGGAGGAGG - Intergenic
932271736 2:70416272-70416294 ACTGCTGCTGGGGGAGGAGAAGG + Intergenic
932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG + Exonic
932812137 2:74834465-74834487 TCGGCTGCCGGGCCGGGAGCTGG - Exonic
933703104 2:85270045-85270067 GCTCCTGCAGGCCCAGCAGCTGG - Intronic
934708223 2:96499506-96499528 TTTGCTGCGGGGCCAGGGGCGGG - Intronic
934730073 2:96650798-96650820 CCAGCTGCTGCGCGAGGAGCAGG - Intergenic
934888458 2:98045413-98045435 GGAGCTCCTGGGCCAGGAGAAGG + Intergenic
935034560 2:99356735-99356757 GCTGATTCTGGGGCAGGGGCTGG - Intronic
935318225 2:101859049-101859071 GCAGCAGCTGCTCCAGGAGCAGG + Exonic
935814882 2:106838287-106838309 GGAGCTGCTGGGCCAGCACCCGG + Intronic
935971524 2:108534453-108534475 GCTACTGGCGGGCCCGGAGCAGG - Intronic
936280878 2:111138737-111138759 GCTGCTCTTGGGTCTGGAGCAGG + Intronic
937259900 2:120578591-120578613 GCTGCTGCAGAGCCAGGGCCTGG - Intergenic
937298022 2:120821511-120821533 GATGAGGCTAGGCCAGGAGCTGG - Intronic
937803937 2:126115694-126115716 GCTGCTGCTAGGCAAGGAAGGGG + Intergenic
938303410 2:130231550-130231572 GCAGCGGCTGGCCCAGGGGCCGG + Intergenic
938305472 2:130251644-130251666 GCAGCTGCTGGGGCAGGACCTGG - Intergenic
938313982 2:130314071-130314093 GCTGCTTCTGGACCAGCAGCAGG + Intergenic
938781010 2:134584927-134584949 ACTGGTGCTGGGTCTGGAGCTGG - Intronic
940759822 2:157725667-157725689 GCTGCTGTTTGGCCAGGAAAAGG - Intergenic
940777878 2:157903564-157903586 GCTTCTGCTGGGCTAGCAGCAGG + Intronic
940900772 2:159124441-159124463 GTTGCTGTTGGTCCAGGGGCTGG + Intronic
941403781 2:165063549-165063571 GCTGCTGATGGGACAGGAGGTGG + Intergenic
942064044 2:172253568-172253590 GCTATTGCTGGGCCTGGAGTTGG - Intergenic
942780594 2:179637293-179637315 GCTGCTGCTGGTCCTAGGGCAGG - Intronic
942950379 2:181714346-181714368 GCTGCTGCTGGAGCACAAGCAGG + Intergenic
943093741 2:183404456-183404478 GCTGCTGCTGGCACATGAGAAGG - Intergenic
943769972 2:191705614-191705636 GCTGCTCCTGAGCTTGGAGCAGG + Intergenic
943847416 2:192669692-192669714 GCTGCTGCTTGGCCAGCTCCCGG - Intergenic
944302770 2:198143309-198143331 GCTGCTGATGTGACAGGAGTGGG + Intronic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
946167995 2:217877129-217877151 CCTGCTCCTGGGCCAGGAGGAGG - Intronic
946167996 2:217877129-217877151 CCTCCTCCTGGCCCAGGAGCAGG + Intronic
946239215 2:218343684-218343706 GTCGCTTCTGGGCCAGGAACTGG - Intronic
946347133 2:219119588-219119610 ACTTGTGCTGGGCCAGGGGCAGG - Intronic
946413857 2:219529532-219529554 GATGGGGCTGGGGCAGGAGCTGG + Intronic
946774668 2:223125034-223125056 GCTGCTCCTGGGGCAAGGGCAGG + Intronic
947089742 2:226496599-226496621 TCCTCTGCTGGCCCAGGAGCTGG - Intergenic
947528383 2:230893431-230893453 GCTGGGGCTGGGGCTGGAGCTGG - Intergenic
947731768 2:232435223-232435245 GCTGCTGATGGGGCCGGAGTTGG - Intergenic
948140342 2:235668463-235668485 GCTGTTTCTGGGCAAGGTGCTGG - Intronic
948462998 2:238139214-238139236 GCTGCTGCCGGGCGATGGGCAGG - Intronic
948498315 2:238370020-238370042 GCTGATTCTGGGGCTGGAGCAGG - Intronic
948647156 2:239412581-239412603 GCTTCTGCCTGGCCAGGAGGAGG + Intergenic
948757633 2:240168659-240168681 GCTGCTGCTCTGACAGGAGGCGG + Intergenic
948850034 2:240701338-240701360 GCTGCTGCGGCGCCAGCCGCGGG + Intergenic
948898905 2:240946182-240946204 CCTCCTGCTTGGCCAGCAGCTGG - Intronic
948981130 2:241495413-241495435 AATACTGCTGGGCCAGGAGAGGG + Exonic
949036367 2:241817302-241817324 GAGGCTGCAGGGCCAGGCGCGGG + Exonic
1168767170 20:389467-389489 TCTGCTGCTGCCCCAGGAGGAGG - Intronic
1168788088 20:557102-557124 TTGGCTGCTGGGCCAGGAGCAGG + Intergenic
1168854124 20:997040-997062 ACAGCTGCTGAGCCAGGACCTGG - Intronic
1168979837 20:1995006-1995028 GCTGCTGCTGGTCCAGGCCAAGG - Intergenic
1169208199 20:3751677-3751699 GGTGCTGTTCGGCCAGGCGCCGG + Exonic
1169508753 20:6241776-6241798 CCTGGTACTGAGCCAGGAGCTGG - Intergenic
1170299096 20:14861842-14861864 GGTCCTGCTTGGCCAGCAGCAGG - Intronic
1170571752 20:17636654-17636676 GCAGCTGGTGGCCCGGGAGCAGG - Exonic
1170782505 20:19438378-19438400 GCAGGTGATGGGCCAGGAGCCGG - Intronic
1170899957 20:20452947-20452969 GCTGCTGCTGGTTCAGGTCCTGG + Intronic
1171176279 20:23052478-23052500 GAGGGTGCTGGGCCAGGAACTGG - Intergenic
1171282960 20:23916917-23916939 GCTTCTTCTGGGCCAAGAGATGG - Intergenic
1171442544 20:25176859-25176881 GCTGTGGCTGGGCCTGGAGGAGG - Intergenic
1171509726 20:25671936-25671958 GGTGCTGCTCTCCCAGGAGCTGG - Intergenic
1172484267 20:35288847-35288869 GGTGCTCCTGGGCAAGGAGCAGG + Exonic
1172484686 20:35291187-35291209 TCTGCAGCTGGGCCTGAAGCAGG - Intronic
1172702696 20:36862930-36862952 GCGCCTGCTGGGCCTGGAGCTGG - Exonic
1173662851 20:44746024-44746046 GCGACTGCTGGTCCAGAAGCGGG + Exonic
1174097533 20:48101250-48101272 GGTGCTGCAGAGCCAGGATCAGG + Intergenic
1174194853 20:48765922-48765944 GCTGCTGATGTGACAGGAGGCGG - Intronic
1174292658 20:49519889-49519911 GGTGCTGCTGGGCCAGGGTCAGG - Intronic
1174317056 20:49712026-49712048 GATGCTGCTGGGGTAGGGGCAGG - Intronic
1175518986 20:59587733-59587755 GCTGGAGCTGGGGCTGGAGCCGG + Intronic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1175945885 20:62558558-62558580 GCTGCTCCCTGGCCAGGAGGTGG + Intronic
1175972867 20:62695718-62695740 CCTGCGGCTGGGCGAGGAGAGGG + Intergenic
1176284501 21:5012367-5012389 GCTGCTGGAGGGACAGGGGCAGG + Intergenic
1176623413 21:9073220-9073242 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1178763672 21:35428815-35428837 GCTGCTTGTGGGCCAGGTGATGG + Intronic
1178785135 21:35646726-35646748 TCTGCTGCTGTGGCAGCAGCAGG + Intronic
1178889568 21:36509882-36509904 AATGCTGCTGGGCCAGGCGCGGG - Intronic
1178992561 21:37367479-37367501 GCTGCGGCGCGGCCAGGAGCCGG + Intronic
1179209389 21:39313083-39313105 GCAGGTGCTGGTGCAGGAGCTGG - Exonic
1179396724 21:41046942-41046964 ACTGCTGCTGGTCCAGCGGCTGG - Intergenic
1179422407 21:41247333-41247355 GCTGCAGCTGCGCCAGTGGCTGG - Intronic
1179504870 21:41833728-41833750 GGTGCTGTTAGGCCAGGTGCTGG - Intronic
1179596028 21:42443772-42443794 GCTGCTGCTGGTGCAGTAACCGG + Intronic
1179812038 21:43877954-43877976 GCTGGTGGTGGGGCAGGAGGCGG - Intronic
1179872680 21:44251108-44251130 GCTGCTGGAGGGACAGGGGCAGG - Intronic
1180049968 21:45326604-45326626 GATGCTGTGGGGGCAGGAGCAGG - Intergenic
1180076042 21:45463372-45463394 GCTGCTATTGTGCCAAGAGCTGG + Intronic
1180090602 21:45531989-45532011 GCTGCTGCTGGGCCACTCGGTGG - Exonic
1180222749 21:46369851-46369873 GGTGCTGATGCTCCAGGAGCAGG - Intronic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181031421 22:20150301-20150323 GCTGGGGCTGGGGCAGGGGCAGG + Intronic
1181031441 22:20150344-20150366 GCTGGGGCTGGGGCAGGGGCAGG + Intronic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181276228 22:21688816-21688838 GTTGCTGTTGGGCCCGGAGTTGG - Exonic
1181324317 22:22032968-22032990 GCTGCTTCTAGTGCAGGAGCTGG - Intergenic
1181395261 22:22616769-22616791 GCTGCTGCTGGGGTGGGGGCAGG - Intergenic
1182476396 22:30578935-30578957 GCAGCGGCTGGCCCAGGAGGAGG - Exonic
1182527805 22:30932502-30932524 GCTGCTGCTGGCCCTGGGGTGGG + Intronic
1182619951 22:31613503-31613525 GCAGCTGCAGGCCCAGCAGCAGG + Exonic
1182834729 22:33332797-33332819 GCTGGGGCTGGGGCTGGAGCTGG - Intronic
1183353126 22:37344530-37344552 GCTGGCACTGGGCCAGGACCAGG - Intergenic
1183386186 22:37516131-37516153 GCGGCTGCGGGACCAGCAGCAGG - Exonic
1183420211 22:37707445-37707467 GCTGCTGCTGGGGTTGGGGCGGG + Intronic
1183593284 22:38794070-38794092 GCTCCTGCGGGGGCCGGAGCCGG + Exonic
1183598834 22:38828395-38828417 GCAGCTGCTGGCCCAGGTGCTGG - Exonic
1184019869 22:41813744-41813766 TCTGCAGATGGCCCAGGAGCTGG + Exonic
1184233258 22:43169605-43169627 GCCTCCGCTGGGCCGGGAGCAGG + Intronic
1184276633 22:43412437-43412459 GCTGCTGCTGGCGGAGTAGCTGG + Intronic
1184594787 22:45507155-45507177 GCTGGGGCTGGGCCTAGAGCTGG + Intronic
1184612310 22:45612627-45612649 GCCGCTGCTGGGGCGGGGGCCGG - Intergenic
1185203661 22:49523873-49523895 GCCGGTGCTGGGCCTGGAGCAGG - Intronic
1185231696 22:49687509-49687531 GCTGCTGCTGGCCTGGGAGGAGG + Intergenic
1185349411 22:50326814-50326836 CCTGGAGCTGGGCCAGGCGCTGG - Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
949518353 3:4827183-4827205 GGTGCTGTCGGGGCAGGAGCAGG - Intronic
950470436 3:13181722-13181744 GCTTTTGCTGGGCTAGGTGCTGG - Intergenic
950515270 3:13460804-13460826 GCTGCTGCTGTGGCGGGGGCTGG + Intergenic
950604247 3:14064370-14064392 GCTGCTGCTGGGGCTGCTGCTGG - Exonic
950740575 3:15047994-15048016 ACTACTGCTGGGCCAGGCCCTGG - Exonic
951898410 3:27633011-27633033 GCTGCTGCAGGGCCTAGATCTGG - Intergenic
953796407 3:45989406-45989428 GGTCCTGCTGGCCCAGGGGCTGG + Intronic
954005621 3:47588222-47588244 GAGGCTGGCGGGCCAGGAGCAGG + Exonic
954034356 3:47842944-47842966 GCTGCTGCATAGCCAGGAGCAGG - Intronic
954424795 3:50437700-50437722 GCTCCTGCTGGGCCTGCAGGTGG - Intronic
954631760 3:52051638-52051660 GCTGCTGCCAGGCCATGACCTGG + Intronic
954637721 3:52080371-52080393 GCTGCTGCTGGGTGAGGACAGGG - Intronic
954686590 3:52373346-52373368 GCTGCTGCGGGGGCAGGAAGCGG + Intronic
954707606 3:52489397-52489419 GCTGCTGCAGGGGCTGGAGCTGG - Exonic
956054847 3:65287979-65288001 ACTCCTGCAAGGCCAGGAGCTGG - Intergenic
956189657 3:66596539-66596561 GCTTCTGCTGGGGATGGAGCAGG + Intergenic
956233785 3:67043972-67043994 GGAGCTTCTGGGCCAGGAGAAGG + Intergenic
956646966 3:71465824-71465846 GCTGCTGATGTGACAGGAGGCGG - Intronic
958421663 3:93938201-93938223 GGAGCTGCTGAGCCAGGAGAAGG - Intronic
959664136 3:108902692-108902714 GTTGCAGCTGGTCCAGGAGGAGG - Intergenic
959863780 3:111243302-111243324 GCTCTTGGGGGGCCAGGAGCAGG - Intronic
961454821 3:127018700-127018722 CCTGCTGCAGGGCCAGGCCCTGG - Intronic
961509479 3:127392128-127392150 GCTGGGGCTGGGGCTGGAGCTGG + Intergenic
961829153 3:129614512-129614534 ACTGCTGCTGGGTCTGGAGAAGG + Intergenic
962129829 3:132660561-132660583 GCAGCAGCGGGTCCAGGAGCTGG + Exonic
964744749 3:160001866-160001888 GCGGCTGCAGAGCCAGGATCAGG + Intergenic
965522045 3:169678030-169678052 GGGGCTTCTGGGCCAGTAGCAGG - Intergenic
965604632 3:170485952-170485974 TCTGCTGCTGCCCCAGGGGCTGG - Intronic
966230147 3:177642603-177642625 GCTGCTGCTGTGCTGGGTGCTGG + Intergenic
966861374 3:184232750-184232772 GCTCCTGATGGTTCAGGAGCAGG + Intronic
967740445 3:192997601-192997623 GCTGCTGCCGAGCCATGAACTGG - Intergenic
967847848 3:194058263-194058285 GCTGATGCTGGGGCTGGGGCTGG - Intergenic
967959506 3:194909182-194909204 GCCTCTGCTGGGCCTGGAGGGGG - Intergenic
968472407 4:788148-788170 GGGGCTGCTGAGACAGGAGCAGG - Intronic
968473724 4:793288-793310 GGCCCTGCTGGGGCAGGAGCTGG + Intronic
968631659 4:1655134-1655156 GCTGCTGCTGGCCCAGGGCAGGG + Exonic
968870853 4:3241449-3241471 GCTGCTGCTGATGTAGGAGCTGG + Exonic
969474205 4:7412071-7412093 GCAGCTGCTGGCCCAGGAGGTGG + Intronic
969532818 4:7739277-7739299 GCTCCTGCTGGGGCAGGAGGTGG + Intronic
969616459 4:8255735-8255757 GCTGGTGCTGGGTCAGGAGTAGG + Intergenic
969619066 4:8269882-8269904 GCCGCTGCGGGGCCGGGCGCCGG - Exonic
969624844 4:8297186-8297208 GCAGGAGCAGGGCCAGGAGCAGG + Intronic
970124288 4:12791976-12791998 GCTGGAGATGGGGCAGGAGCTGG + Intergenic
970332803 4:15002925-15002947 TCTGCTGATGCGCCAGGAACGGG - Exonic
970430488 4:15984634-15984656 GCTGCTGCTCTGACAGGAGGTGG - Intronic
972358376 4:38303653-38303675 GCTGCAACTGTGCCAGGGGCAGG + Intergenic
972828250 4:42786374-42786396 ACTGCTCTTGGACCAGGAGCAGG - Intergenic
975620465 4:76291299-76291321 GCTGCTGCTGGGTAAGGTGCTGG - Intronic
975670822 4:76779009-76779031 GATCAAGCTGGGCCAGGAGCAGG + Exonic
975986195 4:80203001-80203023 GCTGGTGCTGGGCCAGAAGCTGG + Exonic
977167017 4:93711755-93711777 GCTGCTGCTGGGGCATGGGCGGG + Intronic
977446719 4:97139891-97139913 GCAGCTTCTGAGCCAGGAGAAGG + Intergenic
977795348 4:101158237-101158259 GCTGGTGATGCACCAGGAGCAGG - Intronic
980405035 4:132344814-132344836 GCTGCGGCTGGGGCCGGGGCCGG + Intergenic
980405060 4:132344893-132344915 GCTGCGGCTGGGGCCGGGGCTGG + Intergenic
980550546 4:134328597-134328619 GCAGCAGCTGGCCCAGGAGGAGG + Intergenic
981081903 4:140644726-140644748 GCAACTGCTGGGCCTGGTGCAGG + Intronic
981483396 4:145260149-145260171 GCTGCAGCTGGAGCTGGAGCTGG + Intergenic
982176501 4:152710151-152710173 GCTCCTGCTGGGGCAGGACCTGG - Intronic
982765772 4:159346877-159346899 GCTGCTGCTGGGGCTGTGGCAGG - Exonic
984512978 4:180701558-180701580 GCTCCTGTTGGGCCACCAGCTGG - Intergenic
984961488 4:185102052-185102074 GCTGCTGCGGAGCCAGGAAATGG - Intergenic
985279461 4:188270895-188270917 GCTGCTGCTGGTGCTGGTGCTGG - Intergenic
985368125 4:189255309-189255331 ACTGCTGCTGGGCCACTAACAGG + Intergenic
985549087 5:524265-524287 GCTGCTGCTGGCGCTGGCGCTGG - Exonic
985565297 5:612382-612404 GCTGGTGCTGAGCGAGGAGGCGG + Exonic
985625305 5:982505-982527 CTTGCAGCTGGGCCTGGAGCTGG - Intergenic
985892314 5:2725082-2725104 GCACCTGCTGGGTGAGGAGCTGG - Intergenic
986605558 5:9520092-9520114 GCTGCTGCTAGGCCAGGTGAGGG - Intronic
986607420 5:9536020-9536042 GCTGCTGCTATGACAGGAGCAGG - Intronic
988155268 5:27441726-27441748 TTTGCTGATGGGCCAGCAGCTGG + Intergenic
990376240 5:55173409-55173431 CCTGCGGCTGGGCCTGGCGCCGG + Intergenic
990491311 5:56305656-56305678 GCTGCTGCTGGCCCTGGCACAGG - Intergenic
992417360 5:76564821-76564843 GGTGATGCTGGGAGAGGAGCAGG + Intronic
995489840 5:112679293-112679315 GCTCCTGCTGAGCCAGGCACGGG + Intergenic
995650388 5:114362289-114362311 GCTGCTGGTGCGCGAGGTGCGGG - Exonic
995745057 5:115394167-115394189 GCTCTTGGGGGGCCAGGAGCAGG - Intergenic
995870433 5:116738474-116738496 GCTGCTCCTGTGCCTGGAACAGG + Intergenic
996142491 5:119929238-119929260 GGGACTGCTGGGCCAGAAGCTGG + Intergenic
997365822 5:133324654-133324676 GTGGATGCTGGGCCAGGTGCTGG - Intronic
997457375 5:134027275-134027297 GCTGCTGATGGGGCGGGAGAGGG - Intergenic
997612689 5:135226319-135226341 GCTGCTGCTGCGCCCGGCCCGGG + Intronic
997740888 5:136252769-136252791 GCTGCTGATCTGACAGGAGCTGG + Intronic
997882508 5:137602994-137603016 GCTGCTTCTGGGCTGGGAGCTGG + Intergenic
997900603 5:137760459-137760481 GCTGCTGCTGTGACAGTAGACGG + Intergenic
998003101 5:138640005-138640027 GCTGCTCCTTGGCAAGGTGCGGG - Intronic
998138555 5:139687359-139687381 GGTGATTGTGGGCCAGGAGCTGG + Intergenic
998148616 5:139744681-139744703 GCTGGGTCTGGGGCAGGAGCGGG - Intergenic
998674760 5:144394999-144395021 GCTGCTTCTGATCCAGGACCAGG - Intronic
999243183 5:150139085-150139107 TCTTCTGCTGGGCCTGGGGCTGG + Intronic
999315647 5:150582348-150582370 GCTGGTGCTGGGAGAAGAGCCGG - Intergenic
999447560 5:151652265-151652287 GCCGTTGGTGGGGCAGGAGCTGG + Intergenic
999453556 5:151696564-151696586 GCCGCTGCTGGTCCAGGTCCAGG + Intergenic
999498035 5:152119435-152119457 GCAGGTGCTGTGTCAGGAGCAGG + Intergenic
1000358266 5:160421959-160421981 GCTGCGGCTGGGGCTGAAGCTGG + Exonic
1000790631 5:165602560-165602582 CCTGCTGCTGAGACAGGATCTGG + Intergenic
1001280863 5:170385414-170385436 GCTGGTGATGGCCCAGAAGCGGG - Exonic
1001556570 5:172641257-172641279 GCGGCAGCTGGGGCGGGAGCCGG - Exonic
1001661443 5:173396511-173396533 GCAGGCGCTGGGCCTGGAGCTGG + Intergenic
1001745052 5:174086143-174086165 TCTGGGGCTGAGCCAGGAGCTGG - Intronic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002279392 5:178121791-178121813 GCGACTTCGGGGCCAGGAGCAGG + Exonic
1002338246 5:178495187-178495209 GCTGCTGATGGGCGGGGTGCAGG - Intronic
1002352074 5:178590233-178590255 GGTGCTGCTGGGGCAGAGGCTGG + Exonic
1002560486 5:180078595-180078617 GCTGCTGATGTGACAGGAGGTGG - Intergenic
1002790967 6:437093-437115 GCGTCTCCTGGGCCTGGAGCTGG - Intergenic
1002807288 6:589659-589681 CTGGCTGCTGTGCCAGGAGCCGG - Intronic
1002926106 6:1606565-1606587 GCTCCACCTGGCCCAGGAGCTGG - Intergenic
1003507588 6:6752390-6752412 GCTTCAGCTTGTCCAGGAGCCGG + Intergenic
1004273697 6:14216792-14216814 GCTGCCGCCGGTCCTGGAGCGGG + Intergenic
1004840551 6:19579324-19579346 GCTGCCTCTGGGCCAGCAGAAGG - Intergenic
1005882325 6:30071062-30071084 GCAGCTGCAGGGCCAGTGGCCGG + Exonic
1005992764 6:30913851-30913873 GCTGCTGCTGGCCCACGCGCGGG + Exonic
1005994444 6:30922837-30922859 GTGGCTGCAGGGCCAGGACCTGG - Intronic
1006310049 6:33250924-33250946 GCTGCGGCTGGGACAGCACCCGG + Exonic
1006514741 6:34539559-34539581 GCCGCTGCAGGGCAAGGAGAGGG + Exonic
1006614965 6:35319948-35319970 GCTGCTGCTGGGCCTGCTGCAGG - Exonic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1006917197 6:37602276-37602298 CATGCTGCTGGGGCAGGGGCAGG - Intergenic
1007244427 6:40450328-40450350 GACTCTGATGGGCCAGGAGCTGG - Intronic
1007576684 6:42929639-42929661 GCTGCTGCCGGCCCCGGAGCTGG + Exonic
1008661374 6:53671467-53671489 GCTGTGGCTGGGCCATGAGGGGG + Intergenic
1009274245 6:61654863-61654885 GCTGCTGCTGGGGAAGGCGCAGG + Intergenic
1010236816 6:73581761-73581783 CCTGCTGCTGTGTGAGGAGCAGG - Intergenic
1013081766 6:106819154-106819176 ACTGATGCTGGGCCAGAATCTGG + Intergenic
1013318255 6:108961479-108961501 GCAACAGCAGGGCCAGGAGCCGG - Intronic
1014265258 6:119269618-119269640 GGTACTGCTGGGCCAGAAGGTGG - Intronic
1015275045 6:131375521-131375543 ACTGCTGGAGGGCCAGAAGCTGG - Intergenic
1015544937 6:134352161-134352183 GCAGCTGGAGGGCTAGGAGCTGG - Intergenic
1017950271 6:159130240-159130262 GCTGATGGTGGGGCAGGGGCAGG - Intergenic
1018380222 6:163252274-163252296 GCTGACGCTCGGCCAGGCGCCGG + Intronic
1018830117 6:167435584-167435606 GCTGCTGCTGTGCTCGGAGAGGG + Intergenic
1018903079 6:168060789-168060811 GCTGCGGCTGGTCCTGGGGCTGG + Exonic
1019169447 6:170123970-170123992 GCTGCTGTGGTGCCAGCAGCAGG - Intergenic
1019287168 7:229427-229449 GCTGCAGCTGGTCCAGGTCCTGG + Exonic
1019438467 7:1033885-1033907 GCTCCTCCAAGGCCAGGAGCAGG + Intronic
1019525719 7:1479594-1479616 GCAGGCCCTGGGCCAGGAGCTGG - Exonic
1019709506 7:2511811-2511833 GCTGCGGCAGGGGCAGGGGCTGG - Intergenic
1019821734 7:3248858-3248880 GATGAGGCTGGGCCAGAAGCAGG + Intergenic
1020097259 7:5376135-5376157 GCAGCTGCTGGGCGTGGTGCAGG + Exonic
1020120589 7:5501029-5501051 GACGCAGCCGGGCCAGGAGCTGG + Exonic
1020275419 7:6621783-6621805 GCAGCTGCTGGAACAGCAGCAGG + Exonic
1020380263 7:7537168-7537190 TCAGCTGCTGGGACAGGATCTGG - Intergenic
1021448862 7:20762475-20762497 ACTGATGCTGGGCCAGGACTTGG + Intronic
1022094551 7:27130562-27130584 GCTGCTGCAGCGGCAGGTGCTGG + Exonic
1022976729 7:35565457-35565479 GCTGCTCCAGGGACAGGATCTGG + Intergenic
1023191274 7:37585606-37585628 GCTGGTGTTGTGACAGGAGCAGG + Intergenic
1023353065 7:39339676-39339698 GCTGCTGCTGGAGCTGGAGCTGG - Exonic
1023353066 7:39339682-39339704 GCTGCTGCTGCTGCTGGAGCTGG - Exonic
1023709114 7:42973259-42973281 TCTGCTGCTGAGCCAAAAGCAGG + Intergenic
1023851606 7:44153264-44153286 GCTGCTTCTGGATGAGGAGCCGG + Intronic
1024671800 7:51602505-51602527 GTGGCTGTTGGGGCAGGAGCAGG - Intergenic
1026806809 7:73434034-73434056 GCTGCTGCTGTGGCAGCTGCTGG + Exonic
1026837829 7:73649938-73649960 GCCACCGCTCGGCCAGGAGCGGG + Intergenic
1026848129 7:73708932-73708954 GGAGCTGCTGAGCCAGGTGCAGG + Intronic
1026905444 7:74060378-74060400 GCTGCAGCTGGGCTTGGTGCTGG + Exonic
1026979556 7:74518351-74518373 GCTGGGGCTGGGCCAGGGCCGGG + Intronic
1027460164 7:78441966-78441988 ACTGCAGCTGGGCTAGGAGCTGG - Intronic
1027520425 7:79200027-79200049 GCTGCAGCTGGGGCTGGATCAGG - Intronic
1027734372 7:81914405-81914427 GCTGCTGCTGAGTCTGCAGCGGG + Intergenic
1028483130 7:91329738-91329760 CCTGCTGCTGGGCAAGGGGTGGG - Intergenic
1028556828 7:92134322-92134344 GCTGCTGCTGGGCTTGCTGCAGG - Exonic
1029255116 7:99264359-99264381 GCTGCTTCATGGCCAGGGGCAGG + Intergenic
1029255647 7:99267731-99267753 GATGCTGCAGGGCCAGGAAATGG - Intergenic
1029366882 7:100122323-100122345 GCTGGAGCTGGGGCAGGTGCTGG + Exonic
1029479734 7:100805290-100805312 GCTGCCGCTGGTCCAGGAGAGGG + Exonic
1030161112 7:106509379-106509401 GCAGCTGCTGGGCTGGGACCTGG + Intergenic
1030279578 7:107758627-107758649 GCAGGTGCTGGGGCAGGAGGTGG - Exonic
1031528473 7:122849932-122849954 GCTAGTACTGGGCCAGGAGCTGG - Intronic
1031596870 7:123658973-123658995 GATGCTGCAGGGGCAGGAGTTGG - Intronic
1032011832 7:128352124-128352146 GCTGCTCCTGGGGCTGGGGCTGG - Exonic
1032121835 7:129162378-129162400 GCTGCTTCTGGAAAAGGAGCCGG - Exonic
1032268000 7:130381764-130381786 GTCGCTGCTGGACGAGGAGCAGG + Exonic
1032467651 7:132156506-132156528 GCTCCTGCCGTGCCAGGGGCTGG + Intronic
1033290578 7:140079423-140079445 GCTGAAGCGAGGCCAGGAGCAGG + Intergenic
1033376195 7:140763489-140763511 GGGGCGGCTGGCCCAGGAGCTGG + Intronic
1034110089 7:148528495-148528517 GCAGCTGCTGGGTCAGGTTCTGG - Intergenic
1034276954 7:149828072-149828094 GCTGCTGCAGGGCCTGGAGTAGG - Intergenic
1034561269 7:151880844-151880866 GCTGGGGCTGGGGCTGGAGCCGG + Intergenic
1034865278 7:154636389-154636411 GGTGCTGCTTGCCCAGGAGAAGG - Intronic
1034896189 7:154877902-154877924 GTGGCTGCTGGGTCAGCAGCGGG + Intronic
1034908080 7:154968568-154968590 GCTGCTGCTGGTGCATGCGCTGG + Exonic
1035013244 7:155739816-155739838 GCTGGTGCTGGGGCGGGGGCTGG - Exonic
1035034088 7:155884096-155884118 CCTTCTGCTGGGCCTGGAGGAGG + Intergenic
1035175265 7:157045669-157045691 GCTGCTGCTGTGCCCGGCACAGG + Intergenic
1035373002 7:158391336-158391358 GGTGCAGCTTGGCCAGGAGAGGG - Intronic
1035560700 8:601720-601742 GCTACTGCCTGGCCAGGAGCAGG + Intergenic
1035598704 8:882266-882288 GGTGCCGCTGGGCCAGGCACGGG - Intergenic
1035598720 8:882318-882340 GGTGCCGCTGGGCCAGGCACGGG - Intergenic
1036238408 8:7062300-7062322 GCTGCTGCAAGGCTAGGACCTGG - Intergenic
1036553033 8:9831927-9831949 CTTGCTGCTGGGGCAGGAGGTGG + Intergenic
1036579060 8:10055485-10055507 GCTGCTGCTGCGGCAGGTGGGGG - Intronic
1036696544 8:10978909-10978931 GCTGAAGCTGGGCCAGTGGCAGG - Intronic
1037072998 8:14675612-14675634 GCAGCTGCTTGCCCAGGTGCTGG + Intronic
1037355359 8:18013526-18013548 GATGATGTTGGGGCAGGAGCTGG - Intronic
1037584758 8:20268768-20268790 GCTGCTGGTGGGTTGGGAGCAGG + Intronic
1037991137 8:23321944-23321966 CCTGCTGCCGGGCCAGGGCCAGG + Intronic
1037993803 8:23338861-23338883 GCTGCAGCAGGGCCAGCAGGTGG + Intronic
1038484132 8:27921655-27921677 GCTGCAGCTGAAGCAGGAGCTGG - Exonic
1039944280 8:42116564-42116586 GATGCTCCAGGGCCAGGTGCAGG - Intergenic
1040456062 8:47599072-47599094 GCTGCCTCGTGGCCAGGAGCTGG + Exonic
1040486977 8:47882983-47883005 GCTGGTGCTGGACCTGGTGCTGG + Intronic
1041201481 8:55454542-55454564 GCTGCTGATGGGCAGGGAGTCGG + Intronic
1041391170 8:57348799-57348821 TCAGCTGCCAGGCCAGGAGCTGG - Intergenic
1041706681 8:60853520-60853542 GCTGCTGCAGGGTCAGGAGAGGG - Intronic
1042546325 8:69954695-69954717 GCTGCTGCTGGGGGTGGAGGTGG - Intergenic
1042928466 8:73990507-73990529 GCTGCTGGTCTGACAGGAGCTGG - Intergenic
1043419279 8:80082679-80082701 GCTGCTGCTGGGAGAAGAGGGGG - Intronic
1043982575 8:86658501-86658523 GCTGCAGCTGGTCTATGAGCTGG + Intronic
1044073746 8:87793464-87793486 GCAGCTGCTGAGCCAGGCACAGG - Intergenic
1045277634 8:100721850-100721872 GCTGCTGCGGGGCCGCGGGCGGG + Exonic
1045290186 8:100826256-100826278 CCTCCTGCTGGGGCTGGAGCTGG + Intergenic
1045485935 8:102631232-102631254 TTTGCTGCTGGGGCAGCAGCAGG + Intergenic
1047807233 8:128373171-128373193 GGTGCTGCTGGTGCAGGTGCTGG + Intergenic
1047953319 8:129953669-129953691 GCTGCAGCTGGTCAAGGAGATGG + Intronic
1048028418 8:130608227-130608249 GCTGCTCCTTGTTCAGGAGCAGG - Intergenic
1048572811 8:135669274-135669296 TCTGCTGCAGGGCCAGGCGGAGG - Intergenic
1048918438 8:139205715-139205737 CGTGGTGCTGTGCCAGGAGCTGG - Intergenic
1048928732 8:139293883-139293905 CCTGCTGCTGAGGCAGCAGCTGG + Intergenic
1048969685 8:139638563-139638585 GCTACTGCAGGACCAGAAGCAGG + Intronic
1048982322 8:139709423-139709445 GCCTCTGCAGGGCCAGGAGTTGG + Intergenic
1049201665 8:141343487-141343509 CCTGCTGCTGGCCAAGAAGCTGG - Intergenic
1049214382 8:141401081-141401103 GCCTCTTCTGGGCCAGCAGCCGG + Intronic
1049385929 8:142342995-142343017 GCAGGTGCTGGGACAGGTGCAGG - Intronic
1049509779 8:143021744-143021766 GCTGCTGCTGAGCCTGCTGCCGG + Exonic
1049612509 8:143562068-143562090 GCTGCTGGAGGGCCTGGAGGGGG + Exonic
1049682267 8:143924720-143924742 GCAGCTGCTGGAGGAGGAGCTGG - Exonic
1049683327 8:143929449-143929471 GCTGCCGCTGGACAAAGAGCCGG - Exonic
1049683366 8:143929646-143929668 GCTGCTGCAGAGCCTGGAACAGG - Exonic
1050130417 9:2406547-2406569 GTTACTGGGGGGCCAGGAGCAGG + Intergenic
1050898063 9:10909398-10909420 GGAGCTTCTGGGCCAGGAGAAGG - Intergenic
1052299382 9:26936566-26936588 ACTGCTACTGTGCCAAGAGCAGG - Intronic
1052343425 9:27384885-27384907 GGGGCTGCTGGGCAAGGACCAGG - Intronic
1052988073 9:34502356-34502378 GCAGCTACTGGGCCTGGAACAGG + Intronic
1053159178 9:35801646-35801668 GCTGATGCTGGAGAAGGAGCTGG + Exonic
1053418349 9:37960971-37960993 GCTGCTGGTCTGGCAGGAGCTGG + Intronic
1055076002 9:72215722-72215744 GCTGCTGCTGGACATTGAGCTGG + Intronic
1055429659 9:76230676-76230698 GCTGCTGATGTGACAGGAGATGG - Intronic
1056105390 9:83341980-83342002 GCTTCTGATGGGCCATTAGCTGG - Intronic
1056167862 9:83956380-83956402 GCTGCTGCTGGCCAAGGCGGCGG - Exonic
1056235255 9:84587963-84587985 TTTGCAGCTGGCCCAGGAGCAGG - Intergenic
1056329712 9:85511316-85511338 GCTGGGGCTGGGCCAGGGCCTGG - Intergenic
1056761880 9:89421217-89421239 CCTGCTTCTGGGCCAGGATGAGG - Intronic
1057303445 9:93899497-93899519 GCTGCTGCTCTGCCTGGAGGTGG - Intergenic
1057526528 9:95808011-95808033 GCAGCTGTTGGGCTGGGAGCTGG - Intergenic
1057797962 9:98171804-98171826 GCTGCCGCTGGGAGAGGTGCTGG + Intronic
1059404498 9:114091731-114091753 CCTGCAGCTGGGCTAGGGGCGGG - Exonic
1059480789 9:114587868-114587890 GCTGCTGCAGGCCGAGAAGCGGG + Exonic
1060483984 9:124035591-124035613 GCTGCTGTTGGGCCAGGGGTGGG + Intergenic
1060544778 9:124453441-124453463 CCTGGTGCTGGGCCAGGATCAGG + Exonic
1060550550 9:124482868-124482890 GCTGCTGCTGTGCCTGGTGGAGG - Exonic
1060552329 9:124491511-124491533 GGTGCTGCTGGGCCTGGTGCTGG - Intronic
1060588509 9:124801578-124801600 CCTGCTGCTGGGCCAGGGCGCGG - Exonic
1060696209 9:125711144-125711166 GATGGTGCTGGGCCAGGGGCTGG + Intergenic
1060779256 9:126399611-126399633 GCTGCTGCTGGGACAGAGGTTGG + Intronic
1061062848 9:128259229-128259251 GCTGCAGCTGGTCCACGAGCTGG + Exonic
1061105075 9:128523714-128523736 GCTGCAGCTCAGCCAGCAGCTGG + Exonic
1061130928 9:128707263-128707285 GCTGCTCCAAGGCCAGGCGCAGG - Exonic
1061473568 9:130846761-130846783 GCTGGTGCTGTGCCAGACGCTGG - Intronic
1061582357 9:131545815-131545837 GCTGCTGGAGGGGCAGGTGCTGG + Intergenic
1061672799 9:132198514-132198536 GCGGCTGCTGCGCCCGGCGCTGG + Exonic
1061800019 9:133108703-133108725 GCTCCAGCTGGGCCAGGAGAAGG + Exonic
1061838206 9:133342831-133342853 TCTGCTGCAGGGCCGTGAGCAGG + Intronic
1061880372 9:133565949-133565971 CCTGCTCCTGGGCAGGGAGCTGG + Intronic
1061890461 9:133616615-133616637 GCTGCTGCTGGGACAGGCACAGG - Intergenic
1061976631 9:134071359-134071381 GCTGCTGATCTGACAGGAGCCGG + Intergenic
1062107467 9:134763798-134763820 GCTCCTGCTGGAGCAGGATCTGG + Intronic
1062322696 9:135998170-135998192 GGTGGGGCCGGGCCAGGAGCTGG - Intergenic
1062378640 9:136276286-136276308 GCTTCTGCTGGTCCAGCTGCAGG + Intergenic
1062405791 9:136395611-136395633 CCTGCTGCTGGCCCAGAACCGGG - Exonic
1062538520 9:137031405-137031427 GCGGCCGCTGGGCCAGGGGCAGG + Exonic
1062575436 9:137205099-137205121 GATGCTGTTGTGCCAGAAGCTGG - Exonic
1062586386 9:137251753-137251775 GCTGTTGTTGGGCCCGGAGCCGG + Exonic
1062617237 9:137403410-137403432 GCTGCTGCTGGGCTGGGGGTGGG - Intronic
1062678558 9:137763286-137763308 GCTGCCTCTGGGACAGGAGGGGG + Intronic
1203746597 Un_GL000218v1:43648-43670 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1203563512 Un_KI270744v1:75832-75854 GTTGCTTCTGGGCCAGCAGCAGG - Intergenic
1185475729 X:414148-414170 GCCGGGGCTGGGGCAGGAGCAGG + Intergenic
1185557326 X:1031722-1031744 GCTGCTGGTGGACCAGGCCCAGG - Intergenic
1185759347 X:2677926-2677948 GCTGCCGGGTGGCCAGGAGCAGG + Intergenic
1186660832 X:11665805-11665827 GCTGGGGCGGAGCCAGGAGCAGG + Intergenic
1188356623 X:29199661-29199683 GCTGCTGATGTGACAGGAGGCGG + Intronic
1188451032 X:30308511-30308533 GCTGCCCCTGGACCAGCAGCTGG - Exonic
1188789291 X:34388358-34388380 GAGGCTTCTGGACCAGGAGCTGG - Intergenic
1189744567 X:44156970-44156992 GCTGCTGATGGGCCAGGCAGAGG + Intronic
1189966203 X:46376445-46376467 TCAGCTGTTGGCCCAGGAGCAGG - Intergenic
1190299624 X:49049392-49049414 GCTGCTGCTGTGACAGAAGCTGG + Intergenic
1190852782 X:54262971-54262993 ACTTCTGCTGGGGCAGGAGCAGG + Intronic
1190867561 X:54397539-54397561 ACTTCTGCTGGGGCAGGAGTGGG - Intergenic
1192153015 X:68723736-68723758 TCTGCTGCGGGCCCAGGTGCTGG + Exonic
1192473685 X:71420801-71420823 GCTGCCGCTGGACCCCGAGCCGG - Intronic
1193360619 X:80574701-80574723 TCGGCTGCCGGGCCGGGAGCTGG + Intergenic
1193996314 X:88369218-88369240 GCTGCTGCTAGGGCTGGAGGAGG + Intergenic
1195672852 X:107484029-107484051 GCTGTGGCAGGGCCAGGAACTGG + Intergenic
1196950907 X:120875145-120875167 GCTGCTGCTGTCCCAGAGGCTGG - Exonic
1196951745 X:120931520-120931542 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196952429 X:120936381-120936403 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196953114 X:120941242-120941264 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196953799 X:120946102-120946124 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196954484 X:120950963-120950985 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196955167 X:120955823-120955845 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196955854 X:120960706-120960728 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196956536 X:120965567-120965589 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196957218 X:120970427-120970449 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196957900 X:120975287-120975309 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196958582 X:120980147-120980169 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196959263 X:120985007-120985029 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1197793732 X:130279950-130279972 GGTGCTTCTGAGCCAGGAGAAGG - Intergenic
1198312048 X:135433662-135433684 GCTGCAGCTGGGAGGGGAGCTGG + Intergenic
1198619197 X:138487998-138488020 GCAGCTGCTGGGCCATGTCCTGG + Intergenic
1199045583 X:143167446-143167468 GCAGGTGTTGGGCCAGAAGCAGG + Intergenic
1199619055 X:149683156-149683178 GCAGCTTCTGAGCCAGGAGAAGG - Intergenic
1199680292 X:150219812-150219834 GATGCTCCTGAGCCAGGAGATGG - Intergenic
1199975599 X:152893396-152893418 GCTGCTTCTGGGGCAGCAGCAGG + Intergenic
1200097886 X:153672660-153672682 GGTGGTGCTGGCCCAGGAGCGGG - Exonic
1200112935 X:153752091-153752113 GCTGCTGATCTGCCAGGAGATGG - Intergenic
1200128981 X:153830854-153830876 GCGGCTGCTGGACGAAGAGCGGG - Intergenic
1200234417 X:154461407-154461429 CCTGCTGCTGGCCCAGGCCCTGG + Exonic
1201159924 Y:11158662-11158684 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1201575304 Y:15456080-15456102 GCTGCGGCTGGGGCAAGGGCGGG + Intergenic