ID: 1175913485

View in Genome Browser
Species Human (GRCh38)
Location 20:62415309-62415331
Sequence GGCCACGCATGCCCCCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175913485_1175913490 18 Left 1175913485 20:62415309-62415331 CCTGGGCGGGGGCATGCGTGGCC 0: 1
1: 0
2: 0
3: 14
4: 197
Right 1175913490 20:62415350-62415372 ATAGCCTCTGCTGCCTGCCCTGG 0: 1
1: 0
2: 2
3: 27
4: 289
1175913485_1175913491 19 Left 1175913485 20:62415309-62415331 CCTGGGCGGGGGCATGCGTGGCC 0: 1
1: 0
2: 0
3: 14
4: 197
Right 1175913491 20:62415351-62415373 TAGCCTCTGCTGCCTGCCCTGGG 0: 1
1: 0
2: 2
3: 49
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175913485 Original CRISPR GGCCACGCATGCCCCCGCCC AGG (reversed) Intronic