ID: 1175913592

View in Genome Browser
Species Human (GRCh38)
Location 20:62415730-62415752
Sequence GAGGATCCCTGGTCCTGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175913583_1175913592 -9 Left 1175913583 20:62415716-62415738 CCCAGCCCCAGGGGGAGGATCCC 0: 1
1: 0
2: 2
3: 30
4: 207
Right 1175913592 20:62415730-62415752 GAGGATCCCTGGTCCTGCGGGGG 0: 1
1: 0
2: 2
3: 17
4: 133
1175913584_1175913592 -10 Left 1175913584 20:62415717-62415739 CCAGCCCCAGGGGGAGGATCCCT 0: 1
1: 0
2: 1
3: 15
4: 249
Right 1175913592 20:62415730-62415752 GAGGATCCCTGGTCCTGCGGGGG 0: 1
1: 0
2: 2
3: 17
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175913592 Original CRISPR GAGGATCCCTGGTCCTGCGG GGG Intronic