ID: 1175913592

View in Genome Browser
Species Human (GRCh38)
Location 20:62415730-62415752
Sequence GAGGATCCCTGGTCCTGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175913584_1175913592 -10 Left 1175913584 20:62415717-62415739 CCAGCCCCAGGGGGAGGATCCCT 0: 1
1: 0
2: 1
3: 15
4: 249
Right 1175913592 20:62415730-62415752 GAGGATCCCTGGTCCTGCGGGGG 0: 1
1: 0
2: 2
3: 17
4: 133
1175913583_1175913592 -9 Left 1175913583 20:62415716-62415738 CCCAGCCCCAGGGGGAGGATCCC 0: 1
1: 0
2: 2
3: 30
4: 207
Right 1175913592 20:62415730-62415752 GAGGATCCCTGGTCCTGCGGGGG 0: 1
1: 0
2: 2
3: 17
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175913592 Original CRISPR GAGGATCCCTGGTCCTGCGG GGG Intronic
900685813 1:3946861-3946883 GAGGATCCCTGGGGATGCTGTGG + Intergenic
901195887 1:7439533-7439555 GGGGAGCCCTGGTCCTGCATGGG - Intronic
901443245 1:9292424-9292446 GAGGCTCCCTGGACCCCCGGCGG + Intergenic
902702365 1:18181170-18181192 GTGGATCCTCGGTCGTGCGGCGG + Intronic
905674447 1:39815940-39815962 GAGAACACCTGGTCCTGCAGCGG + Intergenic
905825173 1:41021450-41021472 GAGGCTCCCTGGACTTGGGGCGG - Exonic
907268148 1:53275226-53275248 GAGGGTCCCTGCTCCTGCAGAGG + Intronic
907316848 1:53577691-53577713 CAGGATCCCAGGTCCTCCAGGGG - Intronic
915435681 1:155903986-155904008 GAGGATCCCTTGACCTGGGGAGG - Intronic
920781972 1:209002284-209002306 GAGGATCACTGAGCCTGGGGGGG + Intergenic
923151666 1:231238971-231238993 AAGGATCTCTGGTCCTGTGGGGG + Exonic
923389086 1:233496060-233496082 GAGGATCACTTGACCTGGGGAGG - Intergenic
923520706 1:234733092-234733114 GAGCATTCTTGGTCCTGGGGAGG + Intergenic
1064462663 10:15550333-15550355 GAGAATTCCTGTTCCTGCTGTGG - Intronic
1066620550 10:37345002-37345024 CAGGATCCAGGGTCCTGGGGAGG - Intronic
1067067155 10:43110655-43110677 GAGGCCCCCTGGTCCTGCATGGG + Intronic
1067128563 10:43541133-43541155 GAGGATCACTTGAGCTGCGGAGG + Intergenic
1069591439 10:69644668-69644690 GCGGATCCCTGGCTCTGCTGTGG + Intergenic
1070204191 10:74239620-74239642 GAGGATCTCTTGACCTGGGGAGG + Intronic
1077001760 11:326880-326902 GAGGATTCCAGGGCCTGTGGGGG + Intronic
1077192748 11:1262301-1262323 GAGGCTTCCTGGTCCTTCAGTGG - Intergenic
1082110295 11:48266620-48266642 GAGGCTCCTTGGTCCTCAGGAGG + Intergenic
1083116825 11:60468418-60468440 GAGGATTCCTGATCTTGGGGAGG - Exonic
1083399500 11:62413971-62413993 GGGGAGCCCTGGTCCTTGGGTGG - Intronic
1083802186 11:65053183-65053205 GAAGGTCCCTGGTCCAGGGGAGG + Intronic
1083890360 11:65592756-65592778 GAGGTTCCCAGGGCCAGCGGAGG + Intronic
1084539560 11:69777312-69777334 GAGGAGGCCAGGGCCTGCGGAGG - Intergenic
1084553975 11:69864983-69865005 GAGGGTCCCTGGGACTGCAGAGG + Intergenic
1085085097 11:73661495-73661517 GAGGATCCCTGCTACAGCGCCGG + Exonic
1088683975 11:112269572-112269594 GATGAACCCTGCTCCTGTGGAGG + Intronic
1089491421 11:118886562-118886584 GAAGATTCCAGGTCCTGGGGTGG + Intronic
1094048696 12:26195796-26195818 GAGGAGCCCCGGACCTGCTGCGG + Exonic
1101351151 12:103930649-103930671 GGGGATCCCGGGGCCTGCGGTGG + Intronic
1104120246 12:125791723-125791745 GAAGATCCCTGGGGCTGCAGGGG + Intergenic
1104443753 12:128816740-128816762 GAGGATCCCTTGAACTGGGGAGG + Intronic
1104582477 12:130021341-130021363 GAGGATCGCTTGAGCTGCGGAGG - Intergenic
1112228801 13:97567473-97567495 GAGAATCTCTGGTCCTTCAGTGG - Intergenic
1113491442 13:110695190-110695212 GAGGATCCCTGAGCCTGGGAGGG + Intronic
1114354732 14:21894790-21894812 AAGGAGCCCTGGTTCTGCTGAGG + Intergenic
1114650802 14:24283508-24283530 GAGGATCCCTTGAGCTGGGGAGG + Intergenic
1115193224 14:30769335-30769357 CAGAATCCCTGGTGGTGCGGTGG + Intergenic
1116861137 14:49996557-49996579 GAGGATCCCTTGACCTCGGGAGG - Intronic
1118258517 14:64225704-64225726 CAGGTTCCCTGCTCCTGGGGAGG - Exonic
1120862494 14:89267334-89267356 CAGGATCCCTGGCGCTGCAGTGG + Intronic
1124593145 15:31070982-31071004 GAAGATCCCTGATGCTGGGGCGG - Intronic
1124656935 15:31516408-31516430 GAGGATCCCAGCTCCAGCGGGGG + Intronic
1125603224 15:40926699-40926721 GAGGAACCCTGGGCCTGCGGAGG + Intergenic
1128794417 15:70454608-70454630 GAGGATCCCTTGAACTGGGGAGG - Intergenic
1130015852 15:80185899-80185921 GAGGATCCCTGGCTGTGGGGTGG + Intronic
1130041053 15:80405116-80405138 GAGCAGCCCTGGTCCTGCCCAGG + Intronic
1132592569 16:732548-732570 GAGGCTGCCTGGTCCTGCCCAGG + Intronic
1134038656 16:11051197-11051219 GAGAATCCCTGTCCCTGCTGAGG + Intronic
1134121705 16:11588411-11588433 GAGGATTCCTTGACCTCCGGAGG + Intronic
1135577404 16:23596321-23596343 AAGGAACCCTGGTCCGGAGGCGG - Intronic
1136092659 16:27931673-27931695 GTGGATCCTTGGTCCTTAGGAGG + Intronic
1136453831 16:30369737-30369759 GGGGGTCCCTGGTCCTGGGGCGG + Exonic
1136487743 16:30584053-30584075 GAGAATCCCTGGAACTGGGGAGG + Intronic
1136902289 16:34051584-34051606 GAGGCTCCAGGGTCCTGTGGAGG + Intergenic
1137377192 16:47962244-47962266 GAGGATCCCTTGTGCTCAGGAGG + Intergenic
1137619000 16:49864059-49864081 GAGGATCGCTTGTGCTGGGGAGG - Intergenic
1141431166 16:83970766-83970788 AAGGATCCCAGCTTCTGCGGTGG - Intronic
1144603493 17:16641370-16641392 GAGGATCCCTTGAACTGGGGAGG - Intronic
1144999630 17:19294783-19294805 GAGGGCCCCAGGTACTGCGGTGG + Intronic
1145267958 17:21389578-21389600 GGGGATCCCCAGTCCTGAGGGGG + Intronic
1148102778 17:45102844-45102866 GAGAATCCCTGGTCATTCGGCGG - Intronic
1148777174 17:50102250-50102272 GAGGAGCCCTGGCCCTGTGAGGG + Intronic
1150653875 17:67027097-67027119 CACCATCCCTGCTCCTGCGGAGG + Intronic
1151942757 17:77302935-77302957 GGGGCTCCCTGGTCCTGGAGAGG - Intronic
1153592010 18:6683784-6683806 GATGAGCCCTGGGCCAGCGGAGG + Intergenic
1155769755 18:29681732-29681754 GAGGATCACTGTGCCTGCAGGGG - Intergenic
1156242593 18:35267960-35267982 GAGGACGCCAGGTGCTGCGGAGG + Intronic
1160005840 18:75068448-75068470 GGGGCTGCCTGGCCCTGCGGAGG - Intergenic
1160871273 19:1278968-1278990 GAGGCTGCATGGTCCAGCGGTGG - Exonic
1161819855 19:6523371-6523393 GAGGATCGCTTGACCTGGGGAGG - Intergenic
1162033962 19:7929411-7929433 GAGGCTCCCAGGGCCTGGGGAGG + Intronic
1162780730 19:13005896-13005918 GAGGATGTTTGGACCTGCGGGGG - Intronic
1165405980 19:35631379-35631401 GAGAAGCCATGTTCCTGCGGCGG + Exonic
1166726494 19:45031545-45031567 GAGGATCCCTGGACATGAGGGGG + Intronic
1167004567 19:46767151-46767173 GGGGATCCCTGGGCCTGCTGAGG - Intronic
1167515044 19:49918453-49918475 GGGGATACCTGGTTCTGTGGAGG - Intronic
1168166647 19:54553208-54553230 GAGGGTCCGTGGTCCTGCGTAGG - Intergenic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
930600371 2:53435864-53435886 GAGAAAACCTGGTGCTGCGGTGG - Intergenic
935367804 2:102313390-102313412 GAGAATCCCAGATCCTGCTGGGG - Intronic
937233862 2:120418656-120418678 GAGAATCCCTGGGCGTGAGGGGG + Intergenic
937897907 2:126992308-126992330 GAGGTTCCCTGCTGCTGAGGTGG - Intergenic
942131428 2:172884132-172884154 TTGGCTCCCTGGTCCTGGGGTGG - Intronic
943627538 2:190216832-190216854 GAGGATCCCTGCAGCTGAGGAGG + Intronic
945129388 2:206552749-206552771 GAGGATCACTTGAGCTGCGGAGG - Intronic
948156691 2:235788896-235788918 CAGGATCCCTGGTCCTCCTGAGG + Intronic
948986971 2:241531682-241531704 CAGGAAGCCTGGTCCTGCAGAGG + Intergenic
1168881100 20:1206962-1206984 GAGGACGCCAGGTCCAGCGGAGG + Exonic
1171143818 20:22764835-22764857 GGGTATCCCTGGTCCTGCGGAGG - Intergenic
1172298476 20:33831028-33831050 GAGGATCCCTTGAGCTGTGGAGG - Intronic
1172665078 20:36593508-36593530 GAGGATCCCTGATCCCCCTGGGG - Exonic
1173067671 20:39728776-39728798 GAGGACCCCTGGTACTGCTCTGG + Intergenic
1175218884 20:57405738-57405760 GAGGGTCCCTGGCTCTGGGGAGG + Intronic
1175218899 20:57405788-57405810 GAGGGTCCCTGGCTCTGGGGAGG + Intronic
1175218912 20:57405838-57405860 GAGGGTCCCTGGCTCTGGGGAGG + Intronic
1175913592 20:62415730-62415752 GAGGATCCCTGGTCCTGCGGGGG + Intronic
1176583438 21:8550968-8550990 AAGGATCCAGGGTCCTGTGGGGG + Intergenic
1179615147 21:42578917-42578939 GTGGATCACTGGTCCAGGGGAGG - Intronic
1181609413 22:24002414-24002436 AAGGAGCCCTTGTTCTGCGGAGG - Intergenic
1184542303 22:45134623-45134645 GATGAGCCCTGGTCCTGCAGCGG - Intergenic
1184731803 22:46374836-46374858 CAGGGTCGCTGCTCCTGCGGAGG - Intronic
1185083980 22:48726455-48726477 GAGAATCACTGGTCCAGTGGTGG + Intronic
1185083992 22:48726539-48726561 GAGAATCACTGGTCCAGTGGTGG + Intronic
1185084006 22:48726623-48726645 GAGAATCACTGGTCCAGTGGTGG + Intronic
1185084018 22:48726707-48726729 GAGAATCACTGGTCCAGTGGTGG + Intronic
950230265 3:11270075-11270097 GAGGATCCCTGGAGCTCAGGAGG + Intergenic
950444569 3:13028918-13028940 GAGGATCCCTTGGCCAGCGCAGG - Intronic
952816727 3:37452919-37452941 GAGGCTCGCTGGGCCAGCGGCGG - Intronic
953748961 3:45595261-45595283 CTGGATCTCTGCTCCTGCGGTGG - Exonic
954448745 3:50560486-50560508 GAGGGTCCGTGGTCCTGAGTGGG - Intronic
961868722 3:129973380-129973402 GAGGATCCCTTGAACTGGGGAGG + Intergenic
968488629 4:877529-877551 GAGGAACCCTGGCCTTGCCGGGG - Intronic
968619181 4:1596064-1596086 GAGGGTCCCTGCTCCTGCGCTGG + Intergenic
969091572 4:4697916-4697938 GAGGATCACTTGACCTGAGGAGG - Intergenic
969656412 4:8501256-8501278 GGGGACCCCTGGTCCATCGGGGG + Intergenic
980158235 4:129132294-129132316 GAGGATCCCTGGGCCCCAGGAGG - Intergenic
993717470 5:91289954-91289976 TAGGATGTCTGGTCCTGAGGTGG - Intergenic
1001845892 5:174921222-174921244 GAGGTTCCCTGGTCCAGCCTGGG - Intergenic
1007743729 6:44029480-44029502 GAGGATCGCTGGTTCTAGGGAGG + Intergenic
1012716183 6:102673872-102673894 GAGGATCTGTGGTCCTGTCGGGG - Intergenic
1012890923 6:104896385-104896407 GAGGATCACTTGACCTGAGGAGG - Intergenic
1018861571 6:167714020-167714042 GAGGATCCCTGTGCCTGAAGGGG - Intergenic
1019119961 6:169794556-169794578 GAGCCTGCCTGGTCCTGGGGTGG - Intergenic
1019187748 6:170230735-170230757 GAGGAGCCCAGGACCTGCGTGGG + Intergenic
1019306520 7:337910-337932 GAGGGCCCCTGGACCAGCGGAGG + Intergenic
1019306537 7:337976-337998 GAGGGCCCCTGGACCAGCGGAGG + Intergenic
1019514135 7:1432377-1432399 GAAGCTTCCTGGCCCTGCGGTGG + Intronic
1023018174 7:35986257-35986279 GAGGCTCCCAGGTGCTGCTGAGG - Intergenic
1025937786 7:66050985-66051007 GAGGCTCCATGGTCCTGAGGGGG + Intergenic
1030504456 7:110402828-110402850 GAGGATCCCTTGAGCTGGGGAGG - Intergenic
1032010906 7:128347209-128347231 GAGGATCGCTTGACCTGGGGAGG + Intergenic
1034703228 7:153115516-153115538 GAGGGTACCTGGACCTGCAGTGG + Intergenic
1035732412 8:1862280-1862302 CAGGATCCCCAGGCCTGCGGTGG + Intronic
1036094584 8:5709950-5709972 GAGGTCCCCTGGTGCTGCTGCGG + Intergenic
1038150562 8:24939636-24939658 GAGGATCACTGGAGCTGGGGAGG - Intergenic
1042444856 8:68871988-68872010 GAGGATCACTTGTGCTGTGGGGG - Intergenic
1042829418 8:73009949-73009971 GAGGATACCTGAGCCTGAGGAGG - Intronic
1045500937 8:102743884-102743906 AAGGATCCCTGGTCCTGGTGGGG + Intergenic
1045538891 8:103062258-103062280 GAGGATCACTGGAGCTGGGGAGG - Intronic
1047544757 8:125804794-125804816 GAGGAGCCTGGGTCCTGCTGAGG - Intergenic
1049095876 8:140547791-140547813 GAGGGTCCCTGGTCCCGAGGGGG + Intronic
1049754880 8:144306450-144306472 GAGGATCCCTTGAGCTCCGGAGG - Intronic
1052684579 9:31738917-31738939 GAGGATCCCTTGAACTGAGGTGG + Intergenic
1059322371 9:113479713-113479735 GAGCAGCCCTGGTCCTGCCTTGG + Intronic
1060000305 9:119952628-119952650 GAGGATCTCAGGTCCTGGGCCGG - Intergenic
1203613395 Un_KI270749v1:28738-28760 GAGGGTCCAGGGTCCTGTGGGGG + Intergenic
1191085523 X:56563702-56563724 GCGGTTCCCTGGTCCTCCGGTGG - Exonic
1201144009 Y:11052796-11052818 GAGGATGGCTGGTCCACCGGAGG - Intergenic
1201624758 Y:16002627-16002649 GAGGATCCCTTGAGCTGAGGAGG - Intergenic