ID: 1175913964

View in Genome Browser
Species Human (GRCh38)
Location 20:62417104-62417126
Sequence CAGGATAAACTGAACCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175913964_1175913968 3 Left 1175913964 20:62417104-62417126 CCTTCCTGGTTCAGTTTATCCTG 0: 1
1: 0
2: 1
3: 15
4: 283
Right 1175913968 20:62417130-62417152 TTTCCCAAACTCATTCTCCGAGG 0: 1
1: 0
2: 4
3: 49
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175913964 Original CRISPR CAGGATAAACTGAACCAGGA AGG (reversed) Intronic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
902722792 1:18315262-18315284 CAGGAAAAGCTGACCTAGGAAGG - Intronic
903879311 1:26498049-26498071 GAGGATCACTTGAACCAGGAAGG + Intergenic
903911611 1:26730981-26731003 CTGCCTAAACTGAGCCAGGAAGG - Intronic
904626464 1:31807972-31807994 CAAGATAAATTGAATCAGTAGGG + Intronic
906949131 1:50320004-50320026 CAAGATAAACTGGACAAGGAGGG - Intergenic
907050027 1:51323982-51324004 CAGGATACATTGCTCCAGGAAGG + Intronic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907667329 1:56444881-56444903 CAGTATAAATTGCAACAGGAAGG + Intergenic
908378489 1:63571578-63571600 CAGGAGAATCTGAACCTGGGAGG + Intronic
909176872 1:72371872-72371894 CAGGATAAATCAAAGCAGGAGGG - Intergenic
909629647 1:77758697-77758719 TAGGAAAAACGGAACTAGGACGG + Intronic
909738850 1:79002607-79002629 TAGAATAAACTGAATTAGGAAGG + Intronic
912400839 1:109390666-109390688 CAGGAGAAATTGAACTGGGAAGG - Intronic
913029392 1:114883780-114883802 GAGAATCACCTGAACCAGGAAGG - Intronic
914686045 1:149980620-149980642 AAGGATCACTTGAACCAGGAAGG + Intronic
915061910 1:153193149-153193171 CTGGATAAACTGCCACAGGATGG + Intergenic
915087429 1:153397938-153397960 CAGGGCAAACTGTACCAGGATGG - Intergenic
915166369 1:153950020-153950042 GAGGATCACTTGAACCAGGAAGG - Intronic
915742742 1:158131729-158131751 GAGGATCAACTGAACCTAGAAGG - Intergenic
916162385 1:161930980-161931002 CAGGAGAGACTGAACCTGGGAGG - Intronic
916617760 1:166460306-166460328 GAGGATCACCTGAACCTGGAAGG - Intergenic
917665915 1:177225504-177225526 AAGGAAAAACTGAAGCACGATGG + Intronic
917707111 1:177645815-177645837 GAAGAGAAACTGAAACAGGAAGG + Intergenic
918201941 1:182275881-182275903 CAGAAGAAACTAACCCAGGATGG + Intergenic
918434275 1:184495342-184495364 AAAGATAAACTGAACTGGGATGG - Intronic
919694416 1:200559842-200559864 GAGAATAACTTGAACCAGGAAGG - Intronic
920937752 1:210451421-210451443 CAGAACAAACTGAACGAGAAAGG + Intronic
922111773 1:222565770-222565792 CAGGATCACCTGAGCCAGGGAGG + Intronic
922160138 1:223073648-223073670 CAGGATGAATTGAATCAAGAGGG - Intergenic
922221727 1:223613499-223613521 CAGCAGAAACTGAGCCAGGCAGG + Intronic
1062948847 10:1480752-1480774 AGGGATAAACTTAACCAAGAAGG + Intronic
1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG + Intergenic
1064325205 10:14343910-14343932 CAGGAAAAACTGGAAGAGGAAGG - Intronic
1065018332 10:21481922-21481944 GAGGATAACCTGAGCCTGGAAGG - Intergenic
1066003373 10:31125269-31125291 CAGGATTATCTAAACCACGAAGG + Intergenic
1068801339 10:61144072-61144094 AAGGATCACCTGAACCTGGAAGG + Intergenic
1069070648 10:63987772-63987794 CAGGATTAAGGGAACAAGGAGGG + Intergenic
1072375767 10:94814079-94814101 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072389643 10:94969730-94969752 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1073255903 10:102151208-102151230 GAGGATCAACTGAGCCAGGGAGG - Intergenic
1074099709 10:110345189-110345211 CAGGAAAAACAAAACCACGAAGG + Intergenic
1074416017 10:113267364-113267386 CTGAATAAACTGAAACAGGAAGG - Intergenic
1074821038 10:117178643-117178665 CAGGAAGACCTGAAGCAGGAAGG - Intergenic
1076854618 10:133109693-133109715 CTGGAGAATATGAACCAGGAGGG - Intronic
1078458720 11:11496633-11496655 AAGGAAAGACTGCACCAGGAAGG + Intronic
1078603494 11:12754763-12754785 AAGGAAAACCTGAATCAGGATGG - Intronic
1078675435 11:13408218-13408240 AATGATGAACAGAACCAGGATGG - Intronic
1079215852 11:18510830-18510852 GAGGATCACCTGAGCCAGGAAGG + Intronic
1079676812 11:23238540-23238562 CAGGATCACTTGAACCTGGAAGG - Intergenic
1079845834 11:25466616-25466638 CAGCAAAAACAGAACCAAGAGGG + Intergenic
1082988401 11:59186862-59186884 CAGGATAAATCAAACCAGGATGG - Intronic
1084075558 11:66772678-66772700 CAGAATCAGCTGAACCTGGAAGG + Intronic
1085309792 11:75509399-75509421 CTGGATAAAATGTACCAGCAGGG + Intronic
1087749203 11:101988040-101988062 CAGAATAAACAGACCCAGAAAGG + Intronic
1089139358 11:116273729-116273751 CAGGAGAAATTCAACCAAGAAGG - Intergenic
1089744785 11:120609140-120609162 CAGGCCCAACTGAAGCAGGAGGG - Intronic
1090330132 11:125924859-125924881 TAGGATAAGGAGAACCAGGATGG - Intergenic
1091074917 11:132606525-132606547 CAGGAAGAGCTGACCCAGGAGGG + Intronic
1091348403 11:134871983-134872005 AAGGATGAACTGACTCAGGATGG - Intergenic
1091505027 12:1059053-1059075 AAGAATAAATTGAACCAAGAAGG - Intronic
1092392058 12:8089459-8089481 CAGAATCAACTGAACCTGGGAGG - Intronic
1093284175 12:17237158-17237180 GAGAATAAAGTGAACCTGGAAGG - Intergenic
1095541678 12:43316361-43316383 CAGGATAAACAAAACCAATATGG + Intergenic
1095572082 12:43694800-43694822 GAGAATCAACTGAACCTGGAAGG + Intergenic
1097066705 12:56325988-56326010 CAGGCTAAAGTGACCAAGGAAGG - Intronic
1101325877 12:103715650-103715672 CAGAAATAACTGAACTAGGAGGG - Intronic
1103818087 12:123674965-123674987 GAGGATCGCCTGAACCAGGAAGG - Intronic
1104523628 12:129498080-129498102 CATGAGAAAGTGAACCATGAGGG - Intronic
1106261218 13:28068653-28068675 GAGGATCATCTGAACCAGGGAGG - Intronic
1106407700 13:29488118-29488140 CAGGAAAAAATGCACCAGGAGGG - Intronic
1109318805 13:60784166-60784188 AAGAATAAACTTAACCAAGAAGG - Intergenic
1109512388 13:63396543-63396565 CAGAATATACCTAACCAGGAAGG - Intergenic
1110130059 13:71997299-71997321 AAGTATAAACTTAACCAAGAAGG - Intergenic
1110785214 13:79516341-79516363 GAGGATAACCTGAGCCCGGAAGG - Intronic
1112132217 13:96536711-96536733 CAGGATAATCTGAAACAGCCAGG + Intronic
1113887494 13:113668487-113668509 CAGGAGGAACTGAGGCAGGACGG + Intronic
1114158904 14:20140455-20140477 CAAGATAAAGTGAATGAGGAAGG + Intergenic
1114176362 14:20323963-20323985 AAGGATCAACTGATCCAGCAAGG + Intronic
1114546869 14:23509407-23509429 GAAGAGAAAGTGAACCAGGATGG + Intronic
1115075543 14:29385393-29385415 CAAGAGAATATGAACCAGGATGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118251392 14:64164975-64164997 GAGGATCAACTGAACCTGGGAGG - Intronic
1118510877 14:66471800-66471822 CAGGATAACTTGAAGCAGGGAGG - Intergenic
1118974969 14:70668759-70668781 AAGGATCACCTGAACCTGGAAGG + Intronic
1119143211 14:72286721-72286743 TAGGATAAACTTAACCAAGAAGG - Intronic
1119940408 14:78634687-78634709 GAGAATAAATGGAACCAGGAAGG - Intronic
1122555319 14:102576037-102576059 GAGGATCACCTGAACCAGGGAGG - Intergenic
1125924178 15:43548640-43548662 GAGGATCACCTGAACCTGGAAGG - Intronic
1126171158 15:45696447-45696469 GAGGATCAATTGAACCTGGAGGG - Intergenic
1129028095 15:72598044-72598066 GAGGATCAACTGAGCCAGGAAGG - Exonic
1129686297 15:77687935-77687957 AAGGATAAACTGAAGCCCGATGG - Intronic
1132006845 15:98235082-98235104 ATGGGAAAACTGAACCAGGAAGG - Intergenic
1133117480 16:3585911-3585933 GAGGATCACCTGAGCCAGGAAGG + Intronic
1133592871 16:7263218-7263240 CAGGATATTCAGCACCAGGAAGG + Intronic
1133962667 16:10508242-10508264 CAGGATCACCTGAACCTGGGAGG - Intergenic
1134095034 16:11413406-11413428 CTGGGTAATCTGAAACAGGAGGG + Intronic
1135544395 16:23356032-23356054 GAGCATAAACTGAACCAGAGTGG + Intronic
1135713126 16:24735187-24735209 CAGGAGAATCTGAACCTGGGAGG + Intronic
1138472912 16:57252422-57252444 CAGGATAAATAGGTCCAGGAGGG - Exonic
1138587564 16:57980782-57980804 CAGGATCACCTGAACCTGGGAGG - Intronic
1139309826 16:66018926-66018948 GAGGATCACTTGAACCAGGAAGG + Intergenic
1139699858 16:68701508-68701530 CAGGAGAAACAGATCCTGGAAGG - Intronic
1140134465 16:72193323-72193345 GAGGCTAAAGTGAACCATGATGG + Intergenic
1140882481 16:79211493-79211515 CAGCTGAAACTGAACCAGGTGGG + Intronic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1143414898 17:6739471-6739493 CAGGATATACTCTATCAGGAAGG - Intergenic
1143638322 17:8179837-8179859 CAGGATCACCTGAGCCAGGGAGG - Intergenic
1144535812 17:16090120-16090142 CTGAAGAAACTGAACCAGGCTGG - Intronic
1145722417 17:27086318-27086340 AGGGATAAACTTAACCAAGAAGG + Intergenic
1145961977 17:28892168-28892190 CAGGATCAAGTGAAACTGGAAGG + Intronic
1145976944 17:28989225-28989247 CAGGATCTAGTGAACCATGAAGG + Intronic
1145982492 17:29021372-29021394 CAGGATAAGCTGATAAAGGAAGG - Intronic
1146547967 17:33755449-33755471 AAAGATAAACCAAACCAGGAAGG - Intronic
1147305044 17:39557357-39557379 TAGGAGAAAATGACCCAGGAAGG - Intronic
1147541262 17:41361949-41361971 CGGGATAAATTGAACAAGGGCGG + Intergenic
1147802243 17:43100819-43100841 GAGAATCAACTGAACCAGGGAGG - Intronic
1148951595 17:51318137-51318159 CAGGATAACTTGAAGCAGGGAGG - Intergenic
1149005618 17:51802274-51802296 GATGAAAAACAGAACCAGGATGG - Intronic
1152513007 17:80803082-80803104 CAGGATAAACAGATCCAAGGAGG - Intronic
1154471587 18:14708146-14708168 GAGGATCACCTGAGCCAGGAAGG - Intergenic
1159426916 18:68301127-68301149 CATGATATACTGAACCTAGAGGG - Intergenic
1161654510 19:5505896-5505918 GAGAATCACCTGAACCAGGAAGG - Intergenic
1162202359 19:9029839-9029861 GAGGATCACCTGAACCAGGGAGG + Intergenic
1162516418 19:11150691-11150713 GAGGATCACCTGAACCAGGGAGG + Intronic
1162615577 19:11798175-11798197 CAGGCAAGACTGCACCAGGAGGG - Intronic
1162862012 19:13513165-13513187 GAGGATCACCTGAACCTGGAAGG + Intronic
1165090026 19:33381410-33381432 CAGGAGAAGCTGTCCCAGGAGGG + Exonic
1166101360 19:40573220-40573242 AAGGATCACCTGAACCAGGGAGG + Intronic
1166542648 19:43615614-43615636 GAGGATAAATTGAGCCTGGAAGG + Intronic
1167947529 19:53001001-53001023 GAGGATCACCTGAACCAGAAAGG - Intergenic
924960984 2:34421-34443 AAACATAAACTGAACCATGATGG + Intergenic
924965735 2:74849-74871 CAGGACAAATTGAAGCAGGCAGG - Intergenic
927503819 2:23600331-23600353 CAGAATAAAGTTATCCAGGATGG + Intronic
928063194 2:28135883-28135905 ATGGATAAACTGAAATAGGAAGG - Intronic
928222493 2:29416143-29416165 CCAGAGAAACAGAACCAGGAGGG - Intronic
928358700 2:30645447-30645469 CAGGATGAACTGACGCTGGATGG + Intergenic
929002610 2:37362947-37362969 CTGGAGAAATTGAACCAGGGAGG + Intronic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
931669775 2:64636633-64636655 CAGGAGGAACTCAAACAGGAAGG - Exonic
932705783 2:74023949-74023971 TAGGAAAAACTGAATCAGGAGGG - Intronic
934757511 2:96834432-96834454 CAGGATGGCCTGAACCAGGGAGG - Intronic
934999493 2:98999836-98999858 GAGGATCAACTGAGCCTGGAAGG - Intronic
936675371 2:114708319-114708341 CAGGATATCCTGTTCCAGGAGGG + Intronic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
943723529 2:191229880-191229902 AAGGATAACTTGAACCAGGGAGG - Intergenic
944246225 2:197533007-197533029 CAGGATCACTTGAACCCGGAAGG + Intronic
944495595 2:200305115-200305137 GAGGATTACCTGAACCAGGTAGG - Intergenic
945427398 2:209723524-209723546 CTGGATAAAGGGAACCAGAATGG - Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946523985 2:220497801-220497823 CAGGATTGAAAGAACCAGGAAGG + Intergenic
947436849 2:230080306-230080328 CTGGAGAAACTGAACCAGAGAGG + Intergenic
947537414 2:230948977-230948999 GAGGATAATCTGAGCCAGGGGGG + Intronic
947567283 2:231202410-231202432 GAGGATCACTTGAACCAGGAAGG - Intronic
1170105829 20:12753716-12753738 CAGGAAACACTGAAGCATGAGGG - Intergenic
1170683759 20:18550242-18550264 GAGGATCACCTGAACCTGGAAGG - Intronic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1173447289 20:43130345-43130367 CAGAATAAAGTGCACCAGGTAGG + Intronic
1174208374 20:48857681-48857703 CAGGATCACTTGAACCAAGAAGG + Intergenic
1175374708 20:58516043-58516065 CAGAAAAAAGAGAACCAGGAAGG + Intergenic
1175913964 20:62417104-62417126 CAGGATAAACTGAACCAGGAAGG - Intronic
1176802899 21:13449770-13449792 GAGGATCACCTGAGCCAGGAAGG + Intergenic
1177363871 21:20108525-20108547 CAGGATTGAGTGAACAAGGATGG + Intergenic
1177465339 21:21471180-21471202 CAAGAGAAACTGTGCCAGGATGG - Intronic
1177733642 21:25061241-25061263 CAGAATTAATTGAACCCGGAAGG - Intergenic
1178597081 21:33963863-33963885 CAGCATAAAATGAAAGAGGAGGG - Intergenic
1179424110 21:41259919-41259941 GAGGATCACCTGAACCAGGGAGG - Intronic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1180135432 21:45859239-45859261 CAGGAACAGCTGAGCCAGGAGGG + Intronic
1180248173 21:46562319-46562341 CAGCATCCTCTGAACCAGGAAGG + Intronic
1180847492 22:18991906-18991928 CAGGGTGAACTCCACCAGGACGG - Intergenic
1182029974 22:27151014-27151036 CAGGAGAAACTGGAGCAGGTGGG + Intergenic
1182384983 22:29930600-29930622 GAGGATAACTTGAGCCAGGAAGG + Intronic
1182388633 22:29970421-29970443 GAGGATCAACTGAGCCTGGAAGG - Intronic
949134273 3:543750-543772 CAAGATAAACAGAAACAGAATGG - Intergenic
949777198 3:7646512-7646534 CAGGACTAACTGCACCATGATGG - Intronic
949971295 3:9407448-9407470 CATGATAAACTGTAAGAGGAAGG - Intronic
950052362 3:10002376-10002398 GAGGATCACCTGAACCTGGAAGG - Intronic
951888452 3:27547203-27547225 GAGGATCACCTGAGCCAGGAAGG + Intergenic
953722394 3:45367967-45367989 CAGGATTAGCTGAAACAAGAAGG + Intergenic
959098956 3:101988872-101988894 CAGGAAAATGTGAGCCAGGAAGG + Intergenic
959364513 3:105440245-105440267 CAAGAGAACATGAACCAGGAAGG + Intronic
959934107 3:112012093-112012115 CAGGAGAAACAGAACCTGGGTGG - Intronic
961249199 3:125485385-125485407 GAGAATAACTTGAACCAGGAAGG - Intronic
961517866 3:127449653-127449675 CAGGAGAAACTGGTCCAGCACGG + Intergenic
962494117 3:135922392-135922414 GAGGATCAACTGAGCCAGGGAGG + Intergenic
963476904 3:145818147-145818169 CAGTCTCAACTGAACCAGAAAGG - Intergenic
963887582 3:150599265-150599287 GAGGATCACCTGAGCCAGGAAGG - Intronic
965501652 3:169463488-169463510 AAGGATAAAATGAACAAGGGAGG + Intronic
965737441 3:171836401-171836423 CAGGATCACCTGAACCTGGGAGG + Intergenic
966674607 3:182571989-182572011 CAGGAAAATCTGATCCAGGCAGG - Intergenic
967562741 3:190935318-190935340 GAGGATGAACTGAAGCAGGTGGG - Intergenic
967992884 3:195144687-195144709 CAGGGGAAACTGAAACAGAAAGG - Intronic
970802529 4:19990989-19991011 GACGATGACCTGAACCAGGATGG - Intergenic
972821877 4:42711250-42711272 GAGGTTACAGTGAACCAGGATGG - Intergenic
976169771 4:82291146-82291168 GAGGATCAACTGAGCCAGGGAGG + Intergenic
977249342 4:94672099-94672121 CACAATAAACTAAACCATGAAGG + Intergenic
977912600 4:102555276-102555298 CAGGCTACACTGAAAAAGGAGGG - Intronic
978689347 4:111487414-111487436 GAGAATCAACTGAACCCGGAAGG + Intergenic
981245458 4:142532004-142532026 GATGATTATCTGAACCAGGATGG - Intronic
981697201 4:147570816-147570838 CTGCATAATCTGACCCAGGAGGG - Intergenic
982549632 4:156781593-156781615 CAGGATAAAATGTACCTGGGAGG - Intronic
984199768 4:176703889-176703911 CATGAGAAACTGAATCAGAAAGG - Intronic
984450098 4:179888686-179888708 GAGAATAAATTGAACCAGGGAGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
986306243 5:6519106-6519128 CAGGATCAACCCAACCTGGAAGG - Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
990406680 5:55498016-55498038 GAAGATAAGCAGAACCAGGAGGG + Intronic
992678719 5:79131763-79131785 AAGAATAAACTTAAACAGGATGG - Exonic
993281449 5:85929789-85929811 GAGGTTAAAGTGAACCAAGATGG + Intergenic
994776268 5:104038715-104038737 CAGGACAACTTGAAGCAGGAAGG - Intergenic
999837736 5:155392602-155392624 CAGGACAGAGTGATCCAGGACGG + Intergenic
1001371028 5:171202067-171202089 CAGGATAAACTTAAACATTAAGG + Intronic
1002715989 5:181227871-181227893 CAGGATCACCTGAACCCAGAAGG - Intronic
1004169966 6:13288240-13288262 CTGGATCAACTGGAGCAGGAAGG - Exonic
1004621831 6:17337395-17337417 GAGGATCACCTGAACCAGGGAGG + Intergenic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007405344 6:41632434-41632456 CAGGAAAAGCTTAACCAGTAGGG + Intergenic
1007508944 6:42360733-42360755 GAGGATGAACTGACCCAGGGAGG + Intronic
1009262695 6:61514782-61514804 CAGGATAAAAAGTACAAGGAAGG + Intergenic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1012024152 6:93966911-93966933 CTTGAAAAACTGAACCAGTAGGG + Intergenic
1012382636 6:98638662-98638684 CAGGAAAAGAAGAACCAGGAGGG - Intergenic
1013215187 6:108020725-108020747 CAGGATAAACTGAATCTGGTTGG + Intergenic
1013289097 6:108705611-108705633 CTGGGTAGACTGGACCAGGATGG - Intergenic
1015753174 6:136581745-136581767 CAGGACAAACTCAGCCTGGATGG - Intronic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016418731 6:143861343-143861365 CAGGATCACTTGAACCTGGAAGG + Intronic
1019988905 7:4678915-4678937 CATGTTCAGCTGAACCAGGAGGG - Intergenic
1021790251 7:24197441-24197463 CAGGATAAACGGAAACAAGGAGG - Intergenic
1022136374 7:27453228-27453250 CTGGCTTAACTGAATCAGGAAGG + Intergenic
1023045063 7:36203433-36203455 AAGGATAAACTAAACCGGGCAGG - Intronic
1024424575 7:49211076-49211098 CAGGATCACCTGAACCTGGGAGG + Intergenic
1025226085 7:57164740-57164762 GAGAATCAATTGAACCAGGAAGG + Intergenic
1026285826 7:68962043-68962065 GACGATCACCTGAACCAGGAAGG + Intergenic
1026398309 7:69982441-69982463 CAGGATAGCCTGGAGCAGGAGGG - Intronic
1027359327 7:77392130-77392152 CAGGAGAATCTGAACCTGGGAGG + Intronic
1027385817 7:77658876-77658898 CAGGATCACCTGAGCCAGGGAGG + Intergenic
1027838546 7:83278387-83278409 CATGAAAACCTGAACCTGGAAGG + Intergenic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1028233895 7:88337345-88337367 AAGGAGAAACTGAACTATGATGG + Intergenic
1029286137 7:99467413-99467435 CAGAATGAACTGAACGAGGGTGG - Intergenic
1029893603 7:103958108-103958130 AAGGATTAACTAAAGCAGGATGG + Intronic
1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG + Intronic
1032594099 7:133222276-133222298 CTGGAGAAACTGAACCAGAGAGG - Intergenic
1032813237 7:135444048-135444070 GAGGATCACCTGAGCCAGGAGGG + Intronic
1033357904 7:140615625-140615647 CAGGATTGCTTGAACCAGGAAGG - Intronic
1034015882 7:147586033-147586055 AAGGTGAAACTGAAGCAGGAAGG + Intronic
1036927056 8:12917219-12917241 CAGAATAAACTGATTCATGAAGG + Intergenic
1038048661 8:23789109-23789131 CAGGAGAACCTGAACAAGGCTGG + Intergenic
1038188675 8:25298930-25298952 CAGGATTGACTGAACAAAGAGGG - Exonic
1038405949 8:27323102-27323124 AAAGAGAACCTGAACCAGGATGG + Intronic
1039525910 8:38216279-38216301 GATGATCAACTGAACCAGGAAGG - Intergenic
1040481325 8:47830814-47830836 CAGGATCCCCTGAACCATGAGGG + Intronic
1041083473 8:54235298-54235320 AAGGAGAAATTGAACAAGGAGGG + Intergenic
1041988962 8:63961894-63961916 CATGATAACATGAACCATGATGG - Intergenic
1042233556 8:66584814-66584836 TAGGATAAATTAAACCAAGAAGG + Intronic
1042578550 8:70250300-70250322 GAGGATCATCTGAACCTGGAAGG + Intronic
1043478167 8:80625642-80625664 GAGGATCACCTGAGCCAGGAAGG - Intergenic
1046706386 8:117457112-117457134 AAGGATAAACTTAACCAAGGAGG + Intergenic
1047209104 8:122826355-122826377 CAGGAGACACTGTACCAGGCGGG + Intronic
1049039836 8:140104264-140104286 CAGCCTGAACGGAACCAGGAGGG + Intronic
1049445965 8:142631705-142631727 CAGGAGAAGCAGAACCGGGAGGG + Intergenic
1049832507 8:144711002-144711024 TAGGATATTTTGAACCAGGAGGG + Intergenic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1050625072 9:7494753-7494775 CAGAATCACTTGAACCAGGAAGG - Intergenic
1050951621 9:11602765-11602787 TAGAATATACTTAACCAGGAAGG + Intergenic
1051229587 9:14941903-14941925 CAGGAGAATCTGCACCTGGAAGG + Intergenic
1053415634 9:37945327-37945349 CAGGATATGCAGTACCAGGACGG + Intronic
1056062665 9:82900155-82900177 CTGAATAAACTGAGCCAGCAAGG - Intergenic
1057575852 9:96241843-96241865 GAGGATCCACTGAACCTGGAAGG + Intronic
1058123996 9:101170848-101170870 GAGGATGACTTGAACCAGGAAGG + Intronic
1058391898 9:104504837-104504859 CATGATTAACTGCACCAGGGAGG - Exonic
1058905603 9:109480236-109480258 CAGGTTACACTGAGCCAAGATGG - Intronic
1060615231 9:125007027-125007049 GAGAATCAACTGAACCAGGGAGG + Intronic
1061764614 9:132873956-132873978 CAGAGTAAACTGCACCAGGAAGG + Intronic
1062671840 9:137715518-137715540 CAGGAAGAACAGAGCCAGGAAGG + Intronic
1185595760 X:1305743-1305765 CAGGAGAAACTGAGGCAGGGTGG + Intronic
1187649559 X:21387390-21387412 GAGGATCACCAGAACCAGGAAGG + Intronic
1187899890 X:24017689-24017711 GAGGATAAACTGAGCCCGGGAGG + Intronic
1188751468 X:33910552-33910574 CAGGACAAACTGTACCTGGCAGG - Intergenic
1189021490 X:37346469-37346491 CAGAATTAACTGGATCAGGATGG - Intergenic
1189104066 X:38219386-38219408 CAGGTTAAAATGAACCTGTAGGG - Intronic
1189706153 X:43760779-43760801 GAGAATAAAGTGAACCAGAATGG + Intergenic
1190262365 X:48805472-48805494 AAGGAGCAACTGATCCAGGAGGG + Exonic
1190932441 X:54960725-54960747 CAGAATAATCTGGACCAGAAAGG - Intronic
1191704135 X:64075740-64075762 CAGGATTGCTTGAACCAGGAAGG + Intergenic
1192382454 X:70632517-70632539 GAGGATAAACTGAGCCTGGGAGG + Intronic
1195393638 X:104388404-104388426 CAGGATAACCTGAGTCAGAAAGG - Intergenic
1196298273 X:114024413-114024435 CAGGAAAAAGGGAGCCAGGAAGG + Intergenic
1196835701 X:119811860-119811882 GAGGATCAACTGAACCCAGAAGG + Intergenic
1197228653 X:123979260-123979282 CAAAATAAACTGAAAAAGGAGGG - Intronic
1197373399 X:125652614-125652636 AAGAATAAACTTAACCAAGAAGG - Intergenic
1197588586 X:128381213-128381235 CAGAGTAAACTTAACCAAGAAGG + Intergenic
1197654013 X:129096549-129096571 CAGAATAAACTAAACTATGATGG - Intergenic
1197698751 X:129580162-129580184 AAGAATAAAGTGAACTAGGAAGG + Intronic
1197838676 X:130722183-130722205 AAGGTTAAAGGGAACCAGGATGG + Intronic
1198263918 X:134991757-134991779 AAAGATAAACTGAACAAGAATGG + Exonic
1200770348 Y:7119282-7119304 GAGGATAACCTGAACCTGGGAGG + Intergenic
1201424570 Y:13833996-13834018 CAGGATGAAATGAACGAGGTGGG + Intergenic