ID: 1175914007

View in Genome Browser
Species Human (GRCh38)
Location 20:62417303-62417325
Sequence CGATCCTCTGGGCGTCCCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175914003_1175914007 9 Left 1175914003 20:62417271-62417293 CCGGAGCTGGTGGTTCTTGGAGA 0: 1
1: 0
2: 1
3: 15
4: 178
Right 1175914007 20:62417303-62417325 CGATCCTCTGGGCGTCCCTGTGG 0: 1
1: 0
2: 2
3: 11
4: 96
1175914002_1175914007 10 Left 1175914002 20:62417270-62417292 CCCGGAGCTGGTGGTTCTTGGAG 0: 1
1: 0
2: 2
3: 26
4: 275
Right 1175914007 20:62417303-62417325 CGATCCTCTGGGCGTCCCTGTGG 0: 1
1: 0
2: 2
3: 11
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175914007 Original CRISPR CGATCCTCTGGGCGTCCCTG TGG Exonic
900117231 1:1033899-1033921 CGATCCTCTGGAACTCCCCGCGG + Intronic
900687016 1:3955018-3955040 GGATCATCTGGGCTTCCCCGGGG - Intergenic
903033667 1:20480867-20480889 CGATCCTTTTGGCCTCTCTGGGG + Intergenic
903168955 1:21540399-21540421 AGCTTCTCTGGGGGTCCCTGAGG - Intronic
903215146 1:21839591-21839613 CCACCCTCTGCGGGTCCCTGAGG - Intronic
903810004 1:26029851-26029873 AGATCCTCTGGGAGCCCCAGAGG - Intronic
905340200 1:37272833-37272855 CGGTCCTCTGGGAGGCCCTTAGG - Intergenic
905412204 1:37778458-37778480 TGATCCTCTGGGCTTCCTTGTGG - Intergenic
905902760 1:41592637-41592659 CCATCCTCTTGGCTTCTCTGGGG + Intronic
907869555 1:58430990-58431012 CTATTCTCTGGGGATCCCTGAGG + Intronic
910680023 1:89853444-89853466 TGATCCTTTGGCCATCCCTGTGG - Intronic
912480717 1:109980521-109980543 CCACCCTCTGGGGGTCCCTAAGG + Intergenic
920058169 1:203207761-203207783 GGATCCTCTGGAGATCCCTGGGG + Intergenic
922223944 1:223628981-223629003 GGATCCTCTGCTCCTCCCTGTGG + Intronic
923049560 1:230381328-230381350 CTACTCTCTGGGTGTCCCTGGGG + Intronic
1069863664 10:71486885-71486907 CGACCCTCTGGGGAGCCCTGGGG + Intronic
1076826948 10:132973920-132973942 TGATCCCTTGGGCGTCCCTGTGG - Intergenic
1076853406 10:133103887-133103909 CCATCCTCTGGGGTTCCCTGGGG + Intronic
1084608565 11:70186588-70186610 CGCTCCACTGGGAGTCCCTCTGG - Intronic
1084968785 11:72758223-72758245 GGGTCCTCTGGTCCTCCCTGAGG - Intronic
1089128092 11:116191439-116191461 CCAGCCACTGGGCTTCCCTGGGG - Intergenic
1090182833 11:124716112-124716134 GTATCCTCTGGGCCTTCCTGGGG - Intergenic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1096786904 12:54022032-54022054 TAAACCTCTGGGTGTCCCTGTGG + Intronic
1097941245 12:65308634-65308656 CGAGCCTGTGGGCTTCCCTCAGG + Intronic
1103740343 12:123086891-123086913 CCATTCTGTGGGCTTCCCTGAGG - Intronic
1105406980 13:20141565-20141587 AGAGCCTCTGGGCGGCCCAGAGG - Exonic
1110344778 13:74432954-74432976 CGAGCCTCAGGGCTTCCCTAGGG - Intergenic
1110817320 13:79876392-79876414 CTCTCCTCTGAGCCTCCCTGAGG + Intergenic
1115411805 14:33083789-33083811 AGAGCCTCTGGGGGTCCCAGTGG - Intronic
1115770289 14:36659655-36659677 GGATCCCCTGGGCGTGCCAGGGG - Intronic
1119954488 14:78782070-78782092 CGCTCTTCTGGGCTTCCCCGGGG + Intronic
1127874965 15:63104137-63104159 CCTTCCTCTGGGAATCCCTGAGG + Intergenic
1129239926 15:74245149-74245171 CACTCCTCTGGGGCTCCCTGAGG + Intronic
1134226381 16:12394278-12394300 TGATCTTCTGGGCATCCCAGAGG + Intronic
1135970274 16:27067175-27067197 CGCTGCTCTGGGTGTCACTGAGG - Intergenic
1136775797 16:32871151-32871173 CGCTCCTCTGGACTTCCCTGCGG - Intergenic
1136894820 16:33990361-33990383 CGCTCCTCTGGACTTCCCTGCGG + Intergenic
1138478165 16:57284225-57284247 CGATCTTGGGGGCGTCCGTGCGG + Intronic
1142040161 16:87888321-87888343 CCAGCCTCTGGGTGTCCCTCAGG + Intronic
1203078213 16_KI270728v1_random:1133260-1133282 CGCTCCTCTGGACTTCCCTGCGG - Intergenic
1144162039 17:12569124-12569146 AGATCCTCTGAGAGGCCCTGTGG + Intergenic
1146283561 17:31559896-31559918 CGAAGCTCTGGGTGTCCCTCAGG - Intergenic
1147669423 17:42168185-42168207 CAATACTCTGGGTCTCCCTGAGG + Intronic
1150624882 17:66835286-66835308 CCATCCTGGGGGGGTCCCTGGGG + Intronic
1152155326 17:78629196-78629218 CCATCCTCTCTGCGTGCCTGAGG + Intergenic
1152491861 17:80640493-80640515 CTATCCACTGGGAATCCCTGTGG - Intronic
1152935457 17:83134177-83134199 CGACGCTCAGGGCGGCCCTGCGG + Intergenic
1152935468 17:83134229-83134251 CGATGCTCAGGGCGGCCGTGCGG + Intergenic
1152935490 17:83134333-83134355 CGATGCTCAGGGCGGCCGTGCGG + Intergenic
1152935529 17:83134541-83134563 CGAAGCTCAGGGCGGCCCTGCGG + Intergenic
1152935557 17:83134697-83134719 CGATGCTCAGGGCGGCCGTGCGG + Intergenic
1152935593 17:83134905-83134927 CGACGCTCAGGGCGGCCCTGCGG + Intergenic
1152935603 17:83134957-83134979 CGAAGCTCAGGGCGGCCCTGCGG + Intergenic
1152935622 17:83135061-83135083 CGAAGCTCAGGGCGGCCCTGCGG + Intergenic
1155310810 18:24521183-24521205 CGTTTCTCTGGGCCTCCCTGGGG - Intergenic
1159729933 18:72013488-72013510 CCATACTCTGTGCATCCCTGGGG - Intergenic
1161706922 19:5826554-5826576 TGAGCCTCTGGGTGGCCCTGGGG - Intronic
1162034910 19:7933554-7933576 CGACCCCCAGGGCCTCCCTGGGG + Exonic
1162567108 19:11450690-11450712 CGCCCCTCTGGGCCTGCCTGTGG + Exonic
1163271716 19:16258554-16258576 CTGTCCCCTGGGTGTCCCTGAGG + Intergenic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
1165829680 19:38724234-38724256 CGATCCTCTGGGCCTCCTTGTGG - Exonic
925451433 2:3972975-3972997 TGCAGCTCTGGGCGTCCCTGTGG + Intergenic
926303187 2:11618484-11618506 CGCTCCTCTGGCCGGTCCTGAGG - Exonic
935729597 2:106054549-106054571 CGGTCCTCTGGGCATGCCGGTGG - Intergenic
937000430 2:118460920-118460942 GGAGCCTCTGGGGGTGCCTGTGG - Intergenic
944920014 2:204402936-204402958 ATATCCTCTGGGCCTTCCTGGGG + Intergenic
946976383 2:225156963-225156985 TGGGCCTCTGGGCGTCCCTTAGG - Intergenic
948301246 2:236909022-236909044 TGATCCTGGGGGCGTCCATGTGG - Intergenic
1175914007 20:62417303-62417325 CGATCCTCTGGGCGTCCCTGTGG + Exonic
1178493217 21:33067508-33067530 CTTTCCTGTGGGTGTCCCTGAGG - Intergenic
1179988729 21:44934829-44934851 TGATCCTCTGGACATCCCTGGGG - Exonic
1181946975 22:26525610-26525632 CGATCCTGGGGGTGGCCCTGGGG + Exonic
949829433 3:8198107-8198129 TAATCCCCTGGGGGTCCCTGAGG - Intergenic
950072601 3:10164774-10164796 CGATTCTCTGGCCGGCGCTGGGG + Intergenic
953435612 3:42874962-42874984 TGATGCTCTGGGCCTCCCAGGGG - Exonic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
975619157 4:76278152-76278174 CGAGCCTCTGGTTGACCCTGAGG + Exonic
978766641 4:112411816-112411838 TGTTCCTCCAGGCGTCCCTGAGG + Exonic
979099579 4:116598655-116598677 CGATCCTCTGGGCCTCCTTGTGG - Intergenic
986351307 5:6882227-6882249 CCTTTCTCTGGGCCTCCCTGTGG + Intergenic
987193248 5:15500372-15500394 TGAGCCTCTGGGCGGCCCCGGGG + Exonic
989565176 5:42894477-42894499 GGACCCTCTTGCCGTCCCTGCGG + Intergenic
992828270 5:80570210-80570232 CGACCCTCTGTGCGGCCCTAGGG + Exonic
998769522 5:145526059-145526081 TGGTGCTCTGGGCTTCCCTGCGG - Intronic
999197595 5:149793094-149793116 CCATCATCTGGGCCTCCCTGTGG + Intronic
1002593418 5:180306496-180306518 CCACCCTCTGGGCAGCCCTGTGG + Intronic
1002841724 6:912218-912240 ATGTGCTCTGGGCGTCCCTGTGG + Intergenic
1005491807 6:26354144-26354166 AGGTCCTCTGGTGGTCCCTGAGG - Intergenic
1006807557 6:36798385-36798407 CCATCCTCTGGGTGAGCCTGGGG - Intronic
1012780601 6:103552192-103552214 CCATCCTCTGGGTGTACCTAAGG + Intergenic
1020313865 7:6890462-6890484 GGCTCCTCTGGGCTTGCCTGTGG - Intergenic
1023851434 7:44152453-44152475 CCAGCCTGTGGGTGTCCCTGAGG - Intronic
1023870168 7:44259024-44259046 CGATCCTCTGGGCAGCCCTAGGG - Intronic
1029619218 7:101679437-101679459 CGATCCTGGGGGCTTCCCTTGGG - Intergenic
1031876330 7:127146024-127146046 GGATGCTCTGGGCCTCTCTGGGG + Intronic
1049424826 8:142533285-142533307 CCATCCCCAGGGCCTCCCTGTGG + Exonic
1051875918 9:21793511-21793533 CCATCCTCTGATCATCCCTGTGG + Intergenic
1056510009 9:87295627-87295649 CAATCATCTGGAGGTCCCTGGGG - Intergenic
1056767912 9:89456060-89456082 CGATGCTCTTGCAGTCCCTGGGG - Intronic
1057549224 9:96039792-96039814 CCATCCTCTGTGCAGCCCTGGGG - Intergenic
1057826994 9:98378963-98378985 CGCTCTTCTGAGCGTCCCTCAGG + Intronic
1061812109 9:133168131-133168153 TGTTCTTCTGGGCATCCCTGGGG - Intergenic
1062111593 9:134785069-134785091 CGGTCCTCTGGGACCCCCTGGGG + Exonic
1062117621 9:134817872-134817894 CCACCCTCTGGGCTCCCCTGGGG - Intronic
1062339207 9:136086446-136086468 CGAGCGGCTGGGCTTCCCTGAGG + Intronic
1062415712 9:136448538-136448560 CCATCCTCCTGGCGTCTCTGTGG - Intronic
1199157390 X:144566760-144566782 TGATCCTCTAGTCATCCCTGTGG - Intergenic
1200104097 X:153702887-153702909 GGCTCCTCTGGACTTCCCTGCGG + Intronic