ID: 1175915104

View in Genome Browser
Species Human (GRCh38)
Location 20:62422552-62422574
Sequence GTGGGGACGGGGACTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1684
Summary {0: 2, 1: 0, 2: 9, 3: 153, 4: 1520}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175915080_1175915104 21 Left 1175915080 20:62422508-62422530 CCGAGAGAGGCCTTGGGACCCCG 0: 1
1: 0
2: 0
3: 11
4: 157
Right 1175915104 20:62422552-62422574 GTGGGGACGGGGACTGGGGTGGG 0: 2
1: 0
2: 9
3: 153
4: 1520
1175915082_1175915104 11 Left 1175915082 20:62422518-62422540 CCTTGGGACCCCGAGAGAGGCCA 0: 1
1: 0
2: 2
3: 14
4: 176
Right 1175915104 20:62422552-62422574 GTGGGGACGGGGACTGGGGTGGG 0: 2
1: 0
2: 9
3: 153
4: 1520
1175915086_1175915104 3 Left 1175915086 20:62422526-62422548 CCCCGAGAGAGGCCATGGGGCCT 0: 1
1: 0
2: 2
3: 18
4: 214
Right 1175915104 20:62422552-62422574 GTGGGGACGGGGACTGGGGTGGG 0: 2
1: 0
2: 9
3: 153
4: 1520
1175915095_1175915104 -9 Left 1175915095 20:62422538-62422560 CCATGGGGCCTGGGGTGGGGACG No data
Right 1175915104 20:62422552-62422574 GTGGGGACGGGGACTGGGGTGGG 0: 2
1: 0
2: 9
3: 153
4: 1520
1175915075_1175915104 30 Left 1175915075 20:62422499-62422521 CCTTGGACCCCGAGAGAGGCCTT 0: 1
1: 0
2: 1
3: 14
4: 110
Right 1175915104 20:62422552-62422574 GTGGGGACGGGGACTGGGGTGGG 0: 2
1: 0
2: 9
3: 153
4: 1520
1175915088_1175915104 1 Left 1175915088 20:62422528-62422550 CCGAGAGAGGCCATGGGGCCTGG 0: 1
1: 0
2: 3
3: 46
4: 392
Right 1175915104 20:62422552-62422574 GTGGGGACGGGGACTGGGGTGGG 0: 2
1: 0
2: 9
3: 153
4: 1520
1175915079_1175915104 22 Left 1175915079 20:62422507-62422529 CCCGAGAGAGGCCTTGGGACCCC 0: 1
1: 0
2: 1
3: 30
4: 275
Right 1175915104 20:62422552-62422574 GTGGGGACGGGGACTGGGGTGGG 0: 2
1: 0
2: 9
3: 153
4: 1520
1175915078_1175915104 23 Left 1175915078 20:62422506-62422528 CCCCGAGAGAGGCCTTGGGACCC 0: 1
1: 0
2: 0
3: 15
4: 142
Right 1175915104 20:62422552-62422574 GTGGGGACGGGGACTGGGGTGGG 0: 2
1: 0
2: 9
3: 153
4: 1520
1175915087_1175915104 2 Left 1175915087 20:62422527-62422549 CCCGAGAGAGGCCATGGGGCCTG 0: 1
1: 0
2: 6
3: 36
4: 317
Right 1175915104 20:62422552-62422574 GTGGGGACGGGGACTGGGGTGGG 0: 2
1: 0
2: 9
3: 153
4: 1520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175915104 Original CRISPR GTGGGGACGGGGACTGGGGT GGG Intronic
900119697 1:1043234-1043256 ATGGGGACGGGGCCTGGTCTGGG - Exonic
900121154 1:1049187-1049209 GTGGGGACGGGGCCGGGCGATGG + Intronic
900140149 1:1136437-1136459 GTGAGGGTGGGGACTGGGGACGG + Intergenic
900141521 1:1141133-1141155 CTGGGGGCGGGGACGGGGGTGGG - Intergenic
900141552 1:1141200-1141222 GTGGGGACAGGGATGGGGATCGG - Intergenic
900141577 1:1141249-1141271 GATGGGATGGGGACGGGGGTGGG - Intergenic
900199687 1:1398898-1398920 GTCGGGGCAGGGGCTGGGGTCGG + Intronic
900279853 1:1859688-1859710 GTGGGGTGGGGGAGAGGGGTGGG + Intronic
900291680 1:1926399-1926421 GTGGGAGCGGGGACCGGGGAGGG - Intronic
900366954 1:2315268-2315290 GTGGGGGCGGGGGCGGGGGCGGG + Intergenic
900383770 1:2399813-2399835 GGTGGGACGGGGGCTGGAGTCGG - Intronic
900585317 1:3429825-3429847 GTGTGCACGGGAACTGGGCTTGG - Intronic
900621840 1:3591115-3591137 GTGGGGTCGGGGGCTTGTGTTGG - Intronic
900623129 1:3596493-3596515 GTGGAGACGGGGGCTGGGCAGGG - Intronic
900623148 1:3596537-3596559 GTGGAGACGGGGGCTGGGCAGGG - Intronic
900623167 1:3596581-3596603 GTGGAGACGGGGGCTGGGCAGGG - Intronic
900623185 1:3596625-3596647 GTGGAGACGGGGGCTGGGCAGGG - Intronic
900623220 1:3596713-3596735 GTGGAGACGGGGGCTGGGCAGGG - Intronic
900637651 1:3673877-3673899 GTGGGAACACGGACTGGGGAGGG + Intronic
900819451 1:4875008-4875030 GTGGGGTGGGGGTCTGGGGGAGG - Intergenic
900838607 1:5027958-5027980 ATGGGGACTGGGCTTGGGGTTGG - Intergenic
900918414 1:5654642-5654664 GTGGGGTGGGGGAGTGGGGGAGG + Intergenic
901021916 1:6260329-6260351 GTAGGGGCGGGGGCTGGGGGGGG - Intronic
901319405 1:8330414-8330436 GTGGGGACGGGGGCAGCGGGAGG - Exonic
901441350 1:9280375-9280397 GGCGGGGCGGGGAGTGGGGTCGG - Intergenic
901511619 1:9720666-9720688 GTGGGGTGGGGGTGTGGGGTGGG + Intronic
901626184 1:10626498-10626520 GTGGGGTCGGGGGCTGCTGTGGG - Intronic
901724095 1:11226916-11226938 GCGGGGGCGGGGGCGGGGGTGGG - Intronic
901811145 1:11767281-11767303 GTGGGGACAGGGGTTGGAGTTGG + Intronic
901844085 1:11971186-11971208 GTGGGGCAGGGGGATGGGGTGGG + Intronic
902286388 1:15410771-15410793 GTGTCGAGGGGCACTGGGGTGGG - Intronic
902286831 1:15412588-15412610 GGAGAGACGGGGGCTGGGGTTGG - Intronic
902328974 1:15721244-15721266 GAGGGGAGGGGAAATGGGGTGGG - Intronic
902409789 1:16206129-16206151 GTGGGGACGGAGCCAGTGGTTGG - Intronic
902505977 1:16939208-16939230 GTGGGGGCGGGGGCGGGGGCAGG + Intronic
902625179 1:17672194-17672216 GTGGGGAAGGCGGCTGGGGCGGG - Intronic
902729221 1:18357515-18357537 GTGGAGAGGGGGAGTGGGGTGGG + Intronic
902827514 1:18987246-18987268 GGAGGGACAGGTACTGGGGTGGG - Intergenic
902960784 1:19961714-19961736 GTGGGGGTGGGGTGTGGGGTGGG - Intergenic
902973510 1:20072136-20072158 ATGGGGACGGGGACTGTTGATGG - Intronic
903072218 1:20732098-20732120 GGGGGCGCGGGGACCGGGGTCGG - Intronic
903172427 1:21562675-21562697 AGGGGGAAGGGGACTGGGGAAGG - Intronic
903181249 1:21606030-21606052 GAGGGGCCGGGGCCTGGGGAGGG + Intronic
903211676 1:21822542-21822564 GTGGGGATGTGGCCTGGGGTGGG + Exonic
903267005 1:22163587-22163609 GTGGGGGCAGGGGCTGGGGAGGG + Intergenic
903741473 1:25560908-25560930 GCAGGGACTGGGAGTGGGGTGGG - Intronic
903811561 1:26037617-26037639 GTGGGGGTGGGGAGTTGGGTAGG + Intronic
903829210 1:26164658-26164680 CTGGGAAAGGGGTCTGGGGTGGG + Intergenic
903996424 1:27307817-27307839 GTGGGAAGAGGGACTGGGGTGGG - Exonic
904008751 1:27378040-27378062 GTGAGGAGGTGGACTGTGGTTGG + Intergenic
904021583 1:27470663-27470685 GGGGGGCTGGGGAGTGGGGTGGG + Intronic
904254324 1:29244954-29244976 GTGGGGACGGGGGTGGTGGTTGG + Intronic
904369601 1:30040097-30040119 CCAGGGAGGGGGACTGGGGTGGG + Intergenic
904425181 1:30418176-30418198 GTGGGGTCAGGGAGTGGGGATGG + Intergenic
904500246 1:30908893-30908915 GTGGGGGCGGGGGCTGGGACTGG - Intergenic
904696421 1:32334310-32334332 GTGGGGACAGGGAAGGAGGTAGG + Exonic
904892837 1:33792371-33792393 GGTGGGACGGTGGCTGGGGTTGG - Intronic
905033338 1:34902150-34902172 GTGGGGGAGAGGACTGGGGGAGG + Intronic
905291469 1:36924489-36924511 GAGGGGAGGGGGAGTGGGTTGGG + Intronic
905429927 1:37914470-37914492 GTGGGGATGGGAAATGGGGCTGG - Intronic
905606392 1:39304174-39304196 GTGGGGTGGGGGGATGGGGTGGG - Intronic
905789159 1:40781300-40781322 GTGGAGACAGGGCCTGGGGGTGG + Intergenic
905869231 1:41393691-41393713 GTGGGGCTGAGCACTGGGGTGGG + Intergenic
905968061 1:42116048-42116070 GTGGGGAGTGGGACTGGGGCAGG + Intergenic
906017866 1:42598420-42598442 GTGGGGGTGGGGACTGGGAGTGG + Intronic
906033759 1:42738631-42738653 GTTGGGTCGGTGCCTGGGGTCGG + Intronic
906056714 1:42923897-42923919 GCGGGGACGAGGGCGGGGGTTGG - Intergenic
906082997 1:43106734-43106756 GTGTGGAAGGGGACTGGAGCTGG + Intergenic
906265280 1:44424308-44424330 ATGGGGACAGGGATGGGGGTGGG + Intronic
906289454 1:44610414-44610436 ATGGGGACAGGGACTGGGATGGG - Intronic
906329790 1:44875768-44875790 GTGGGGAGGGGGAGTGGGAGAGG - Intronic
906525931 1:46493227-46493249 GTAGGGAGGGGCGCTGGGGTGGG + Intergenic
906534228 1:46542997-46543019 GTGGGGAGGGGGGCAGGGCTGGG - Intergenic
906611704 1:47208480-47208502 GCGTGGACAGGGACTGGGGAGGG - Intergenic
906795578 1:48693963-48693985 GTGGGTCCAGAGACTGGGGTTGG - Intronic
906799368 1:48722474-48722496 ATGAGTAGGGGGACTGGGGTTGG + Intronic
907005082 1:50905028-50905050 GTGGGGTGGGGGGCTGGTGTTGG - Intronic
907085779 1:51672491-51672513 CTGGGGCCGGGGGCTGGGGCTGG - Intronic
907237606 1:53062602-53062624 TTGGGGGCGGGGGCTGGAGTGGG + Intronic
907276683 1:53320726-53320748 CTGGGGAGTGGGACTGGGGAGGG - Intronic
907296556 1:53459706-53459728 GCCGGGACGGGGACGGGGGCGGG - Exonic
907395981 1:54190141-54190163 GCAGGGGTGGGGACTGGGGTGGG + Intronic
907464070 1:54623578-54623600 GTGGGGAAGAGGATTGGGGCGGG - Intronic
907515961 1:54993646-54993668 GGGGGGAGGGGGAGTGCGGTGGG - Intergenic
907518245 1:55006987-55007009 CTGGGGACTGGGGCTGGAGTGGG - Exonic
907772322 1:57478044-57478066 GTGGGGTCGGGGGCGGGGGGAGG - Intronic
907979475 1:59467347-59467369 GTGGGGTGGGGGAATGGGGGAGG + Intronic
908541043 1:65122308-65122330 GTGGGGTGGGGGATTGGGGGAGG - Intergenic
909100872 1:71346105-71346127 GAGGGGTGGGGGACTGGGGGAGG + Intergenic
909230374 1:73081778-73081800 GGGGGGATGGGGGCTGGGGGAGG - Intergenic
909445213 1:75742139-75742161 GTGGGGAGGGGGGAAGGGGTGGG - Intronic
909445261 1:75742382-75742404 TGGAGGACGTGGACTGGGGTAGG - Intronic
909558905 1:76987017-76987039 GTGGAGTGGGGGACTGGGGGAGG + Intronic
909610970 1:77551530-77551552 ATGAGGAGGGGGATTGGGGTTGG + Intronic
910138340 1:83998881-83998903 GTGGGGACATGGAAGGGGGTCGG + Intronic
910321019 1:85944740-85944762 GTGGGGTCGGGGAATGGGGGAGG - Intronic
910786484 1:91003530-91003552 GTGGGGTGGGGGCCTGGGGGAGG + Intronic
911055191 1:93702548-93702570 GTGGGGGTGGGGATGGGGGTTGG + Intronic
911139599 1:94484635-94484657 GTGGGGTGGGGGCCTGGGGGAGG + Intronic
911710359 1:101064547-101064569 GTGGGGACGGGGAGGTGGGATGG + Intergenic
912319827 1:108702636-108702658 GTGGGGTGGGGGACTAGGGGAGG + Intergenic
912437139 1:109669581-109669603 GGGGAGACTGGGAGTGGGGTGGG - Intronic
912486480 1:110033221-110033243 GTGGGGCGGGGGGCAGGGGTTGG - Intronic
912494668 1:110083911-110083933 GTGGGTGCGGGGACTGCGGAGGG + Intergenic
912843514 1:113059723-113059745 CTGAGGATGGGGACTAGGGTGGG + Intergenic
913287649 1:117241424-117241446 GGGGGGAAGGGGAGTGGGGGTGG - Intergenic
913289821 1:117261841-117261863 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
913400255 1:118423660-118423682 GTGTGGAGGGTGGCTGGGGTGGG + Intergenic
913688701 1:121257958-121257980 GTGGGGTGGGGGGGTGGGGTAGG + Intronic
914148899 1:145022318-145022340 GTGGGGTTGGGGGGTGGGGTAGG - Intronic
914205201 1:145520743-145520765 GTGGGGTAGGGGGCTGGGGGAGG - Intergenic
914207805 1:145549493-145549515 GTGGGGTAGGGGGCTGGGGGAGG - Intergenic
914300668 1:146374693-146374715 GTGGGGAGGGGGCCAGGGTTTGG - Intergenic
914343683 1:146780560-146780582 CTGGGGTCGGGGGCTGGGGGTGG - Intergenic
914391561 1:147228151-147228173 GTGGGGTGGGGGGCTGGGGAAGG - Intronic
914847611 1:151291637-151291659 GCGGGGGCGGGGGCGGGGGTGGG - Exonic
914921053 1:151847698-151847720 GGTGGGACGGGGCCTGGGGCTGG + Intronic
915084244 1:153374357-153374379 GGTGGGACAAGGACTGGGGTGGG - Intronic
915119036 1:153617151-153617173 GTGAGGAGGGCCACTGGGGTTGG - Intergenic
915437288 1:155917582-155917604 GTGGGGGCTGGGGCTGGGGCTGG + Exonic
915572212 1:156750952-156750974 GTGGCGGCGGCGCCTGGGGTCGG + Intronic
916165717 1:161965525-161965547 GTGGGGGCGGGGTGGGGGGTTGG - Intergenic
916624854 1:166544417-166544439 CTGGGGACTGGGGCTGGGGTTGG - Intergenic
916730032 1:167557872-167557894 GTGGGGATGGGGACCAGTGTAGG - Intergenic
916951038 1:169780687-169780709 GGGGGGTGGGGGACTGGGGGAGG - Intronic
917024993 1:170631794-170631816 TGGGGGACGGGGACGGGGGCTGG - Intergenic
917965864 1:180178184-180178206 GTGGGGAGGGGGACTGGGAAGGG - Intronic
917971923 1:180214031-180214053 GTGGGGAGAGAGACGGGGGTGGG - Intergenic
918064318 1:181089257-181089279 GTGGCCACGGTGACTGGAGTCGG + Exonic
918419190 1:184345513-184345535 GTGAGGAGGGGGACAGGGGCTGG + Intergenic
918457107 1:184732323-184732345 GTGGGGATGGGGAATAGGGAGGG + Intronic
918789994 1:188813289-188813311 GTGGGGGCGGGGGTGGGGGTGGG - Intergenic
918810683 1:189115975-189115997 GTGGGGTCGGGGGATGGGGGAGG - Intergenic
918967627 1:191372630-191372652 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
919046992 1:192464930-192464952 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
919174603 1:194002634-194002656 GTGTGGAAGGGGACCGGAGTGGG - Intergenic
919712072 1:200738834-200738856 GCGGGGGCGGGGGCGGGGGTTGG + Intergenic
920029378 1:203027212-203027234 GTGGGGGTGGGGACAGGGGTGGG + Intronic
920172486 1:204080541-204080563 CAGGGGGCGGGGACTGGGGGAGG - Intronic
920181996 1:204137794-204137816 CTGGGGAACTGGACTGGGGTGGG - Intronic
920196441 1:204230422-204230444 GGCTGGCCGGGGACTGGGGTCGG + Exonic
920394073 1:205631509-205631531 GTGGGGGCGGGGGCCGGGGCCGG - Intronic
920498473 1:206471593-206471615 CTGGGGGCTGGGGCTGGGGTTGG - Intronic
920542036 1:206785998-206786020 GTGGTGACGGGGACTTGGGGTGG + Intergenic
920756817 1:208740510-208740532 GTGTGGAAGGGGACTCGAGTGGG - Intergenic
921915453 1:220605656-220605678 GTGGGGTGGGGGGCTGGGGGAGG - Intronic
921949026 1:220909836-220909858 TGGGGGAGGGGGACTTGGGTAGG - Intergenic
921957016 1:220995547-220995569 GTGGGGTCGGGGGATGGGGGAGG - Intergenic
921975955 1:221203521-221203543 ATGGGGTGGGGGGCTGGGGTGGG + Intergenic
921990851 1:221365005-221365027 GGGGTGAAGGGGAGTGGGGTGGG + Intergenic
922116322 1:222617951-222617973 GCGGGGACGGGGGCGGGGGCGGG - Intergenic
922644712 1:227275594-227275616 GTGGGGAGGGGGAGAGGGGGAGG - Intronic
922689440 1:227676663-227676685 GTGGGGAGGGGGAGGGGGGAGGG - Intronic
922726174 1:227924052-227924074 GTGGGGCGTGGGACTGGGGGCGG - Intronic
922770839 1:228182334-228182356 GTGGGGACGGGGTGTGTGGTGGG + Intergenic
922770852 1:228182374-228182396 GTGGGGACGAGGTGTGTGGTGGG + Intergenic
922770873 1:228182432-228182454 GTGGGGATGGGGTGTGCGGTGGG + Intergenic
922770892 1:228182492-228182514 GTGGGGACGAGGTGTGCGGTGGG + Intergenic
922770974 1:228182730-228182752 GTGGGGACGGGGTGTGTGGTGGG + Intergenic
922784635 1:228276850-228276872 ATGGGGACAGGGACAGGGGTGGG - Intronic
923035478 1:230282174-230282196 GTGGGTGTGGGGACTGGGATTGG + Intergenic
923146771 1:231203797-231203819 GTGGGGTGGGGGACCGGGCTGGG + Intronic
923433659 1:233948704-233948726 GTGGGGTCGGGGGAGGGGGTAGG - Intronic
924163869 1:241262123-241262145 GGGGGAATGGGGAATGGGGTAGG - Intronic
924243229 1:242059375-242059397 GGGGGGACTGGGTCTGGGATGGG + Intergenic
924383061 1:243480968-243480990 GTGGGGATGGTGACTAGGGGTGG + Intronic
924444655 1:244118015-244118037 GTGAGGAAGGGGATTTGGGTGGG + Intergenic
924733297 1:246731855-246731877 GTGGGGTGGGGGGCAGGGGTAGG - Intronic
924741205 1:246795112-246795134 GTGGCCACGGGGAGTGGGGTGGG + Intergenic
924831690 1:247602630-247602652 GTGGGATGGGGGACTGGGGGAGG + Intergenic
1062764030 10:47949-47971 GGGGGGACTGGGTCTGGGATGGG - Exonic
1063300255 10:4844430-4844452 GTGTGGAAGGGGACGGGAGTGGG + Intronic
1063452966 10:6163700-6163722 GCGGGGGCGGGGCCTGGGGGTGG + Intronic
1063676108 10:8141685-8141707 GTGGGGGTGGGGATGGGGGTGGG - Intergenic
1064248447 10:13688393-13688415 GTGGGGTGGGGGACAGGGGGAGG + Intronic
1064282483 10:13964259-13964281 GTGGGGAGGGGGATTGTGTTTGG - Intronic
1064501789 10:15981570-15981592 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1064975035 10:21105328-21105350 GGGGGGTAGGGGACTGGGGGAGG - Intronic
1064975712 10:21112588-21112610 GGGGGGTGGGGGACTGGGGGAGG + Intronic
1065025396 10:21535120-21535142 GTGGGGGCGGGGGCGGGGGCGGG + Intronic
1065277450 10:24099326-24099348 GTGGGGTAGGGGAATGGGGGAGG - Intronic
1065308282 10:24389400-24389422 GTGGGGTGGGGGAATGGGGGAGG + Intronic
1065367849 10:24952654-24952676 GTGGGGATGGGGACGGGGACGGG + Intergenic
1065367852 10:24952660-24952682 ATGGGGACGGGGACGGGGACGGG + Intergenic
1066164893 10:32776130-32776152 GTGGGGTGGGGGAATGGGGGAGG + Intronic
1066180605 10:32958004-32958026 GTGGGGGCGGGGGCGGGGGCGGG - Intronic
1066265347 10:33771366-33771388 GTGGGGAGGGGGTTGGGGGTGGG + Intergenic
1066464952 10:35642575-35642597 TTGGGGACAGGGACGGGGTTTGG + Intergenic
1066502551 10:36008253-36008275 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1067066251 10:43105711-43105733 GTGGGCGTGGGGACTGAGGTAGG + Intronic
1067083423 10:43226007-43226029 GTGTGGGCGGTGACAGGGGTGGG + Intronic
1067141016 10:43656683-43656705 GTGGGGTGGGGGACTGGGGGAGG + Intergenic
1067330862 10:45317704-45317726 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
1067381534 10:45778173-45778195 GTGTGGACCAGGACTGGGATAGG - Intronic
1067889233 10:50118807-50118829 GTGTGGACCAGGACTGGGATAGG - Intronic
1068057055 10:52024471-52024493 GTGGGGTGGGGGAATGGGGGAGG - Intronic
1068084657 10:52360338-52360360 GTGGGGAGGGGGCCGGGGGGAGG - Intergenic
1068318124 10:55373940-55373962 GTGGGGTGGGGGGCTGGGGGAGG + Intronic
1068405289 10:56580740-56580762 CTGGGGATGGGGATAGGGGTGGG + Intergenic
1069034214 10:63630520-63630542 GCGGGCACGGTGACGGGGGTGGG - Intergenic
1069232527 10:66029330-66029352 TTGGGGCTGGGGATTGGGGTGGG - Intronic
1069383342 10:67862365-67862387 GAGGGGGCGGGGATTGGGGGTGG - Intergenic
1069544822 10:69320335-69320357 GTGGGGACCGGGAGTGAGGTAGG + Intronic
1069713101 10:70502768-70502790 GTGGGCATGGGCACTGGGGACGG - Intronic
1069819340 10:71217838-71217860 GTGGAGATGGGGACTGGGGGTGG - Intronic
1070112784 10:73500700-73500722 CTGGGGACAGGAACTGTGGTTGG + Exonic
1070312600 10:75284410-75284432 GTGGGGAAGGGTACTGGGTTGGG + Intergenic
1070886572 10:79905055-79905077 GTGGTGCCGCGGGCTGGGGTAGG + Intergenic
1070968441 10:80544050-80544072 GTGTGGAAGGGGACAGGAGTGGG - Intronic
1071104628 10:82080141-82080163 ATGAGGATGGGGACTGGGATGGG - Intronic
1071606949 10:87000916-87000938 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1071614925 10:87066581-87066603 GTGTGGACATGGACTAGGGTAGG - Intronic
1071669115 10:87590686-87590708 GCGGGGAGGGGGCCTGGGGGAGG - Intergenic
1071965413 10:90846842-90846864 GGGAGGACGGAGATTGGGGTAGG + Intronic
1072407439 10:95168517-95168539 AAGGGGATGGGGACTGGGGGTGG + Intergenic
1072461249 10:95620789-95620811 GGGGGGTGGGGGACTGGGGGAGG + Intronic
1072654070 10:97318689-97318711 ATGGGGGCCTGGACTGGGGTTGG - Intergenic
1072775694 10:98190795-98190817 GGGGGGTGGGGGACTGGGGGAGG - Intronic
1073147789 10:101291996-101292018 GTGAGGACGGGGAGGGGGGAAGG - Intergenic
1073391019 10:103176343-103176365 GTGGGGACAGGGAGGGAGGTAGG - Intronic
1073399184 10:103242860-103242882 CTGGGGAAGGGGGTTGGGGTGGG + Intergenic
1073843811 10:107528975-107528997 GTGGGGAGGGGGAGGGGGGGAGG + Intergenic
1074187407 10:111108703-111108725 GTAGGGGCAGGGGCTGGGGTGGG + Intergenic
1074231935 10:111546213-111546235 GTGGGCATGGGAAATGGGGTGGG + Intergenic
1074285547 10:112094344-112094366 GTGAGGATGGGAAATGGGGTGGG - Intergenic
1074524666 10:114253241-114253263 GGGGAGACGGGGACGGGGGAGGG - Intronic
1074818549 10:117163039-117163061 GGGGGCACGGGGACTTGCGTGGG - Intergenic
1074973991 10:118565896-118565918 GTGAAGGCTGGGACTGGGGTAGG - Intergenic
1074991819 10:118715697-118715719 CTGGGGACGAGGATGGGGGTAGG - Intronic
1075013191 10:118892088-118892110 GGGGGGTCGGGGACAGGGGGAGG + Intergenic
1075016044 10:118910573-118910595 GTGGGGGGGGGGATGGGGGTGGG + Intergenic
1075085666 10:119412861-119412883 GCAGCGACGGGGTCTGGGGTGGG - Intronic
1075492125 10:122880144-122880166 GTGGAGGCGAGGACCGGGGTGGG + Intergenic
1075592896 10:123705364-123705386 GTGGGGAGGAGGATAGGGGTGGG - Intergenic
1075606240 10:123812821-123812843 GTGGGGATGGGGGATGGGGAAGG - Intronic
1076168645 10:128302317-128302339 TTGGGGACAGGGCCTGGGCTGGG + Intergenic
1076333316 10:129687839-129687861 GTGGGGTGGGGGGCTGGGGGAGG - Intronic
1076542640 10:131223922-131223944 GTGGGGATGTGGCCTGGGGAGGG - Intronic
1076613187 10:131738949-131738971 GTGGGGAGGGAGCATGGGGTGGG - Intergenic
1076623206 10:131806226-131806248 GTGGGGACAGGTGCTGGGGAGGG - Intergenic
1076733769 10:132450162-132450184 GTTGGGGTGGGGGCTGGGGTGGG - Intergenic
1076733831 10:132450290-132450312 GTTGGGGTGAGGACTGGGGTGGG - Intergenic
1076733858 10:132450349-132450371 GTTGGGGTGGGGATTGGGGTGGG - Intergenic
1076733864 10:132450361-132450383 GTGGGGGCTGGGGTTGGGGTGGG - Intergenic
1076793532 10:132788385-132788407 GAGGGGACGGGGCCCGGAGTGGG - Intergenic
1076802219 10:132835958-132835980 GCGGGGACGGGAAGTGGGGAGGG - Intronic
1076852450 10:133099727-133099749 GTGGCCACTGGGACTGGGCTGGG - Intronic
1076863883 10:133157985-133158007 GTGGGAAAGGGCAGTGGGGTGGG + Intergenic
1077052131 11:571645-571667 GTGGGGTGGGGGGCAGGGGTGGG + Intergenic
1077090718 11:777198-777220 GCGGGGACGGGGGCGGGGGTGGG - Intronic
1077258609 11:1602920-1602942 GTGGGGCCTGGCACTGGGGGTGG + Intergenic
1077485068 11:2834858-2834880 GTGGGGAGGGAGACTTGGGATGG - Intronic
1077555908 11:3225945-3225967 GTGGGGATGGGGCCAGGGTTGGG + Intergenic
1077934078 11:6764348-6764370 GTGGGGTGGGGAACTGGGGGAGG + Intergenic
1078059022 11:8031741-8031763 GAGGGGACAGGAGCTGGGGTAGG + Intronic
1078159417 11:8827964-8827986 GTGGGGAGGGGGAACGGGGGTGG + Intronic
1078278721 11:9877538-9877560 GGGGGGTTGGGGATTGGGGTAGG - Intronic
1078699839 11:13669276-13669298 GCGGGGCCGGGGAGTGTGGTTGG + Intronic
1078812635 11:14783608-14783630 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
1078917654 11:15795138-15795160 CTGGGGAGTGGGACTGGGGATGG + Intergenic
1079156506 11:17953060-17953082 GTGGGGGTGGGGGCTAGGGTGGG - Intronic
1079284179 11:19114675-19114697 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
1079363198 11:19786880-19786902 CTGGGGAGGTGGACGGGGGTGGG + Intronic
1079430901 11:20387695-20387717 CTGGGGGCGGGGACCGGGTTGGG - Exonic
1079746053 11:24131738-24131760 GAGTGGAAGGGGACTTGGGTGGG - Intergenic
1079990563 11:27242173-27242195 GTGGGGTGGGGGTTTGGGGTGGG - Intergenic
1080231917 11:30025911-30025933 GTAGAGACAGGGAGTGGGGTGGG - Intergenic
1080384385 11:31802571-31802593 GGGGGACTGGGGACTGGGGTGGG + Intronic
1080634086 11:34108118-34108140 GTGGGGCCTGGGACTGTGCTAGG - Intronic
1080637896 11:34139505-34139527 GTGGGGACAGGGAGGAGGGTTGG + Intronic
1080749067 11:35136095-35136117 GTTGGGATGGGGCCTGGGGAGGG + Intergenic
1080844550 11:36015328-36015350 GTGGGGACGGGGACAGGCAATGG - Intronic
1080881614 11:36326682-36326704 GTGGGGATGGGGGTGGGGGTGGG - Intronic
1080927865 11:36776963-36776985 GTGGGGTGGGGGGGTGGGGTGGG + Intergenic
1081207583 11:40293326-40293348 GTGGGGGCGGGGACAGAGGAAGG - Exonic
1081713068 11:45230412-45230434 GTGGGGAAGTGGAATGGGGCTGG - Intronic
1081739583 11:45429060-45429082 GTGGGGAGAGGGACAGGGGGTGG + Intergenic
1081772592 11:45659019-45659041 GTGGGGACGAGGACTGGGGGTGG + Intronic
1081804973 11:45885578-45885600 GTGGGGGCGGGGCCTGGGCGGGG + Intergenic
1081834471 11:46142877-46142899 GTGGGGGTGGGGACGGGGGCAGG - Intergenic
1081870678 11:46381403-46381425 GGCGGGACGGGGCCCGGGGTCGG + Intronic
1082170939 11:49004182-49004204 GTGGGGTCGGGGAAGGGGGGAGG + Intergenic
1082593410 11:55043874-55043896 GTGGGGTCGGGGGATGGGGGAGG - Intergenic
1082668540 11:56005622-56005644 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1082893074 11:58161093-58161115 CTGGGGTCGGGGGCTGGGGGAGG + Intronic
1083078746 11:60068845-60068867 GTGGGGTGGGGGGCTGGGGGAGG - Intronic
1083640383 11:64142122-64142144 GTGGGGTAGGGGGCTGGGCTAGG + Intronic
1083641628 11:64148826-64148848 GTGGGCACAGGGGCTGGGGTGGG + Intronic
1083652526 11:64211571-64211593 GTGGGGAGGGGGGCTGGGCTGGG - Intronic
1083738013 11:64692747-64692769 GAGGGGAAGGGGACAGGGGAAGG + Intronic
1083749536 11:64753726-64753748 GTGGGGCTGGGGACTGGGGATGG - Intronic
1083900508 11:65641118-65641140 GTGGGCACGGGCACGGGGGCTGG - Exonic
1083905111 11:65663872-65663894 TTGGGGATGAGGCCTGGGGTGGG - Intergenic
1084154063 11:67303980-67304002 GGTGGGGCGTGGACTGGGGTGGG + Intronic
1084171644 11:67403971-67403993 GTGGGGACAGGGGCAGGGCTTGG + Intronic
1084330327 11:68426192-68426214 GTGGGGGCTGGCAGTGGGGTGGG + Intronic
1084602806 11:70156176-70156198 GCGGTGGCGGGGACGGGGGTGGG + Intronic
1084991394 11:72928864-72928886 GTGGGGTGGGGGACGGGGGGAGG - Intronic
1085256231 11:75175120-75175142 CTGGGGATGGGGAGTGGGGAGGG + Intronic
1086189668 11:84063962-84063984 GTGGGGTGGGGGGCTGGGGGAGG + Intronic
1086631827 11:89028929-89028951 GGGGGGTGGGGGACTGGGGAAGG - Intronic
1087005233 11:93464043-93464065 GTGGGGTGGGAGGCTGGGGTAGG + Intergenic
1087165055 11:94994763-94994785 GTGGGGGCAGGACCTGGGGTTGG + Intronic
1087440717 11:98179752-98179774 GGGGGGACGGGGACAGAGTTTGG - Intergenic
1087946370 11:104164578-104164600 GTGGGGACAGGGACTGGAGTTGG + Intergenic
1087990665 11:104743111-104743133 GTGGGGATGGGGGGTGGGGAAGG + Intergenic
1088410595 11:109529878-109529900 GTGGGGTGGGGGGCTGGGGGAGG + Intergenic
1088471986 11:110196649-110196671 GTTGGGAAGGGGCCTGAGGTGGG - Intronic
1088543599 11:110937860-110937882 TTGGGGACAGGGCCTGGGGAAGG + Intergenic
1088797051 11:113273345-113273367 GTGGGGACTGGTGCAGGGGTGGG - Intronic
1088911784 11:114197669-114197691 GTGGGGGCAGGGGGTGGGGTGGG + Intronic
1088916342 11:114230819-114230841 GTGGGGAGGGGAGCAGGGGTTGG - Intronic
1089096426 11:115923483-115923505 GTGGGGATTGGGGCGGGGGTGGG + Intergenic
1089261289 11:117225599-117225621 GTGGGGTGGGGGATTGGTGTTGG + Intronic
1089299944 11:117492584-117492606 GGGGAGAAGGGGAGTGGGGTGGG - Intronic
1089339089 11:117745435-117745457 GTGGGGCGGGGGACAGGGATGGG + Intronic
1089626110 11:119752097-119752119 GTGGGGTTGGGGTCTAGGGTTGG + Intergenic
1090147107 11:124337306-124337328 GTGGGGTCGGGGGAGGGGGTAGG - Intergenic
1090562018 11:127942671-127942693 GTGGGGTGGGGGACTAGGGGAGG + Intergenic
1090562785 11:127950668-127950690 GTGGGGAAGAGGACAAGGGTTGG + Intergenic
1090601491 11:128377170-128377192 GTGGGGTGGGGGACAGGGGGAGG - Intergenic
1090636897 11:128694965-128694987 GTGCGGACGGGGGCTGGGGAAGG - Intronic
1090882523 11:130846488-130846510 GTGGGAGAGGGGACTGGGCTGGG + Intergenic
1091207712 11:133832915-133832937 GCGGGGACGGGCGCTGGGCTGGG + Intergenic
1091315550 11:134611576-134611598 GTGGGCACGGGGACTGAACTGGG - Intergenic
1091318109 11:134630069-134630091 GTGGGGTGGGGGACGGGGGGAGG + Intergenic
1091556060 12:1574378-1574400 GTGTGGATGGAGGCTGGGGTGGG + Intronic
1091556101 12:1574500-1574522 GTGTGGATGGAGGCTGGGGTGGG + Intronic
1091591011 12:1842939-1842961 GTGGTAACGGGGCCTGGGCTTGG + Intronic
1091638417 12:2215533-2215555 TGGGGGACAGGGACTGTGGTAGG - Intronic
1092097343 12:5853868-5853890 GTGGGGACGGGGACGGGGACGGG - Intronic
1092247932 12:6873583-6873605 GTGGGGGCGGGGCCTCGGGGAGG - Intronic
1092733602 12:11558175-11558197 GTGGGGAGGGGGTGGGGGGTAGG - Intergenic
1093202286 12:16202961-16202983 GTGGGGAAGGGGACTGGGTGGGG + Intronic
1094034809 12:26057270-26057292 GTGGGGCGGGGGGATGGGGTAGG - Intronic
1094313110 12:29107830-29107852 GTGGGGTGGGGGACAGGGGGAGG - Intergenic
1094481737 12:30888820-30888842 GTGGGGTAGGGGGCTGGGGGAGG - Intergenic
1095151934 12:38805510-38805532 GTGGGGTCGGGGGATGGGGGAGG + Intronic
1095348262 12:41179084-41179106 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1095734476 12:45541678-45541700 GTGGGGTCGGGGTCGGGGGAGGG - Intergenic
1095803135 12:46289491-46289513 GTAGGGTGGGGGACTGGGGGAGG + Intergenic
1096073795 12:48789575-48789597 GTGGGGGCTGGGGCTGGGGCAGG - Intergenic
1096244280 12:49975585-49975607 GTGGGGACAGGGGCAGGGGCAGG + Exonic
1096396442 12:51270017-51270039 GCGGGGGCGGGGACGGGGGCGGG - Intronic
1096487808 12:51995296-51995318 GTGGGGAGGGAGTCTGGGGTGGG + Intronic
1096716106 12:53492744-53492766 GTGGGGGCGGGGAGGGAGGTTGG - Intronic
1096789126 12:54034194-54034216 GTGGGGGCCTGGGCTGGGGTGGG + Intronic
1096848640 12:54421315-54421337 GTGGGGAGGAGGACTGGGGCAGG - Intergenic
1096919204 12:55065877-55065899 GTGTGGACAGGGATTGGGGAGGG + Intergenic
1096950647 12:55465301-55465323 GTGGGGTGGGGGGCTGGGGTAGG + Intergenic
1096971570 12:55670582-55670604 CTGGGGACTGGGACTGGGACTGG - Intergenic
1097007447 12:55929441-55929463 GTGGGAAGGGGGCCTAGGGTTGG - Intronic
1097034362 12:56113012-56113034 GTGGGTTGGGGAACTGGGGTGGG - Exonic
1097167633 12:57094126-57094148 GTGGGGGCGGGGACTGGAAGGGG + Intronic
1097203018 12:57295831-57295853 GCAGGGAAGGGGATTGGGGTTGG - Intronic
1097218292 12:57430879-57430901 GGGGGGACTGGGACGGGGGAGGG + Exonic
1097623544 12:61971722-61971744 GTGGGGTAGGGGGCTGGGGGAGG + Intronic
1097709635 12:62903725-62903747 ATGGGGTGGGGGAGTGGGGTGGG + Intronic
1097750126 12:63342849-63342871 GGGGGGTGGGGGACTGGGGGAGG + Intergenic
1098258907 12:68647372-68647394 GGGGGGGCGGGGAGTGGAGTGGG - Intronic
1098303392 12:69077572-69077594 GTGGTGACCGGGGCTGGGGATGG + Intergenic
1098374319 12:69797665-69797687 GTGGGGTGGGGGGATGGGGTAGG - Intronic
1099168764 12:79338812-79338834 GTGGGGTCGGGGGATGGGGGAGG - Intronic
1099406730 12:82273004-82273026 GTGGGGTGGGGGGCTGGGGGAGG - Intronic
1099459975 12:82910383-82910405 GTGGGGTTGGAGCCTGGGGTTGG - Intronic
1099467697 12:83006937-83006959 ATGGGGTCGGGGGCTGGGGGAGG + Intronic
1099504099 12:83450650-83450672 GTGGGGTCGGGGAAGGGGGGAGG + Intergenic
1099583008 12:84477179-84477201 GTGGGGAGGGGGCCAGGGGAAGG + Intergenic
1100158675 12:91832088-91832110 GTGGGGTGGGGGACTGAGGGAGG + Intergenic
1100452373 12:94719820-94719842 GTGGGGACGGGGAGAGGGATGGG + Intergenic
1100547805 12:95619980-95620002 GTGGGGAAGGGGAATGGTTTTGG + Intergenic
1101308641 12:103555878-103555900 GTGTGGAAGTGGAGTGGGGTGGG - Intergenic
1101408785 12:104452551-104452573 GTGAGGAGGGGTACTGGGGTGGG + Intergenic
1101686685 12:107030777-107030799 GTGGGGAAGGGGGCAGGGGAAGG + Intronic
1101948262 12:109154615-109154637 GTGGGGGCGGGGCCTGGGTGGGG + Intronic
1102151026 12:110689191-110689213 GTGGGGGCGGGGACGGGGGCGGG - Intronic
1102567061 12:113803641-113803663 GAGGGGCTGGGGGCTGGGGTTGG + Intergenic
1102796784 12:115695823-115695845 GTGGTGTCAGGGACTGGTGTAGG + Intergenic
1102856949 12:116302453-116302475 GTGGGGAGGTGGAGAGGGGTGGG + Intergenic
1102856956 12:116302471-116302493 GTGGGCACGGGGAGAGGGGCTGG + Intergenic
1102864993 12:116367336-116367358 GTGGGCATGGGGCCTGGGGATGG + Intergenic
1103292293 12:119856471-119856493 GTGGGGAGGGGGAAATGGGTGGG - Intronic
1103381497 12:120496966-120496988 GCGGGGCTGGGGGCTGGGGTAGG + Intronic
1103907200 12:124333758-124333780 GTGGGGGTGGGGGCGGGGGTGGG + Intronic
1103943542 12:124513758-124513780 GTAGGTACGGGGAGTGGGGGAGG - Intronic
1104517103 12:129437881-129437903 GGGGGGAGGGGGGCTGGGGGAGG - Intronic
1105734775 13:23256520-23256542 GTGGGGTGGGGGAATGGGGGAGG - Intronic
1105734864 13:23257402-23257424 ATGGGGTGGGGGAATGGGGTAGG - Intronic
1105806428 13:23954020-23954042 GTGGCGACGGAGGCTGCGGTTGG - Intergenic
1105894867 13:24709285-24709307 TAGGGGAGGGGGGCTGGGGTGGG - Intronic
1106208755 13:27621779-27621801 GTCGGGGCGGGGGCTGGGGGTGG + Exonic
1106340106 13:28819778-28819800 GCGGGGGCGGGGGCTGGGGCTGG + Intergenic
1106362574 13:29046016-29046038 GTAAGCACGGGGACTGGGATGGG - Intronic
1106480916 13:30136163-30136185 GTGGGGACGGGGCTCAGGGTGGG - Intergenic
1107087984 13:36446656-36446678 GTGGGGATGGGGCCCGAGGTGGG + Intergenic
1107196073 13:37653074-37653096 GAGGGGACCTTGACTGGGGTTGG - Intronic
1107214676 13:37902508-37902530 GTGGGGTGGGGGGCTGGGGAAGG + Intergenic
1107557487 13:41529891-41529913 ATGGGGCTGGGGAGTGGGGTGGG + Intergenic
1107664305 13:42673235-42673257 GAAGGGATGGGGAGTGGGGTGGG - Intergenic
1108140800 13:47419156-47419178 CTGGGGACCAGGACTTGGGTAGG - Intergenic
1108183210 13:47862877-47862899 GGGGGGTGGGGGACTAGGGTAGG - Intergenic
1108397737 13:50006581-50006603 GTGTGGAGCAGGACTGGGGTTGG + Intronic
1109515609 13:63439684-63439706 GTGGGGACTGGTAGTGGGGCGGG + Intergenic
1109846049 13:67992730-67992752 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1110695563 13:78484115-78484137 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
1112018493 13:95351165-95351187 GTGGGGTCGGGGGAGGGGGTAGG + Intergenic
1112294224 13:98172338-98172360 GTTGGCACGGGGGCTGGGGCTGG + Intronic
1112490740 13:99861087-99861109 GAGGTGGAGGGGACTGGGGTAGG - Intronic
1112521109 13:100095914-100095936 GTAGGATTGGGGACTGGGGTGGG + Intronic
1112881908 13:104118004-104118026 GTGGGGTGGGGGACGGGGGAGGG + Intergenic
1113079054 13:106497682-106497704 GTGAGGTGGGGGACTGGGGGAGG - Intronic
1113574020 13:111381986-111382008 GTGGTGACTGGGGGTGGGGTGGG + Intergenic
1113738306 13:112693458-112693480 GTGGGTACGGGGAGAGGGGACGG + Intronic
1113797290 13:113065937-113065959 GAGGGGGCGGGGACTGAGGAAGG - Intronic
1113804813 13:113106630-113106652 GTGGGGATGGCGAGTGGGGCTGG + Intronic
1114126783 14:19737212-19737234 GTGGGGTCGGGGGATGGGGGAGG - Intronic
1114259344 14:21025751-21025773 GTGGGGGCGGGGAATGCGGGGGG + Intronic
1114266538 14:21075555-21075577 GTGGGCTTGGGGACTGGGGGAGG + Intronic
1114343127 14:21766127-21766149 GTGGGGTGGGGGTCTGGGGGAGG + Intergenic
1114554754 14:23555687-23555709 GTGGCGAGGGGGGTTGGGGTGGG - Intronic
1114727161 14:24950884-24950906 GTCGGGAAGGGGACTGGGGGAGG - Intronic
1115034922 14:28845712-28845734 GTGGGAAGGGGGTCTGGGATGGG - Intergenic
1115295576 14:31822030-31822052 GTAGGGAAGGGTAGTGGGGTCGG + Intronic
1115334837 14:32234737-32234759 GTGGGGTCGGGGGATGGGGGAGG - Intergenic
1115528741 14:34306285-34306307 GTGGGGGCGGGGGCGGGGGCAGG + Intronic
1115755764 14:36524956-36524978 GGCGGGAAGGGGCCTGGGGTAGG + Intergenic
1115761497 14:36581916-36581938 GAGGGGGCGGGGGGTGGGGTGGG + Intronic
1116384602 14:44314905-44314927 GTGGGGTGGGGGACGGGGGAAGG + Intergenic
1116386312 14:44334663-44334685 GTGGGGTGGGGGACGGGGGAGGG + Intergenic
1116513015 14:45770063-45770085 GTGGGGTGGGGGACGGGGGAGGG - Intergenic
1116641463 14:47469297-47469319 GTGGGGTCGGGGAGTGGGGAGGG - Intronic
1116724371 14:48544074-48544096 GTGGGGAGGGGGATGGGGGGAGG - Intergenic
1117140950 14:52791134-52791156 GCTGGAACTGGGACTGGGGTCGG - Intronic
1117322177 14:54634477-54634499 GTGGGGACAGGGATGGGGGTTGG + Intronic
1117437101 14:55726766-55726788 GTAGGGTCGGGGGCTGGGGGAGG - Intergenic
1117547578 14:56805715-56805737 GTGGGGGTGGGGATGGGGGTGGG - Intronic
1117888194 14:60387623-60387645 GTGGGGCGGGGGCCTGGGGGAGG + Intergenic
1118116932 14:62789086-62789108 GTGGGGATGTGGAGTAGGGTGGG - Intronic
1118148263 14:63163956-63163978 GTGGGGGTGGGGGGTGGGGTGGG - Intergenic
1118508703 14:66445818-66445840 GTGGGGATGGGGGGTGGGGGAGG - Intergenic
1118569049 14:67174214-67174236 GTGGGGTGGGGGGCTGGGGGAGG - Intronic
1118715035 14:68553515-68553537 GTGGGGCTGGGGACTTGGGGAGG + Intronic
1118895214 14:69940196-69940218 GTGGGGAAGATGGCTGGGGTTGG - Intronic
1119107036 14:71934041-71934063 GTGGGAACTGGGACTATGGTGGG + Intronic
1119323967 14:73747686-73747708 GTGGGGTGGGGGTCGGGGGTGGG + Intronic
1119471562 14:74903361-74903383 TGGAGGACGTGGACTGGGGTAGG + Exonic
1119483395 14:74973670-74973692 GTGGGGCTGGGGTGTGGGGTGGG + Intergenic
1119548901 14:75493668-75493690 GTGGGGAGGGGGACTGGGGAGGG + Intergenic
1119613825 14:76085330-76085352 GTGGGGACGGGGAGGGGTGGTGG - Intergenic
1119667999 14:76498627-76498649 GTGGGGTGGGGGACGGGGATGGG + Intronic
1120726181 14:87944075-87944097 GTGGGGACGAGGGATGGGGAAGG - Intronic
1120881717 14:89418915-89418937 GTGGGGTTGGGGGCTGGGGATGG - Intronic
1122130394 14:99601911-99601933 GTTGGGGTGGGGGCTGGGGTGGG - Intronic
1122267112 14:100551862-100551884 GTGGGGAAGGGGAAGTGGGTCGG + Intronic
1122299655 14:100724567-100724589 GTGGGGCTGGGGGCGGGGGTGGG + Intergenic
1122300405 14:100728063-100728085 GCGGGGACGGGGACCGTGGAGGG - Intronic
1122302016 14:100736847-100736869 GTGGGGACGGGAGCTGGAGAAGG - Exonic
1122329759 14:100904355-100904377 GTGTGGACGGGGAGAGGGGAGGG + Intergenic
1122486705 14:102086929-102086951 CTGGGGACCGGGACTGGGGGCGG - Intronic
1122515400 14:102304935-102304957 GTGGGGCCGGGGAAAGGGGCAGG - Intronic
1122813941 14:104303132-104303154 GTGGGGTCGAGGATTGGGGGAGG + Intergenic
1122901323 14:104783500-104783522 GTTGGGGGGGTGACTGGGGTGGG - Intronic
1122922075 14:104884400-104884422 GTGGGGGCGGGCGGTGGGGTCGG - Exonic
1122972779 14:105159123-105159145 GTGGGGCGGGGGACTGGGTGGGG - Intronic
1123000756 14:105292892-105292914 CTGGGGAAGGGGCCTGGGCTTGG - Intronic
1123078517 14:105680874-105680896 GTGAGGCCAGGGACTGGGGATGG - Intergenic
1123490230 15:20774889-20774911 GTGGGGTGGGGGAGTGGGGGGGG - Intergenic
1123546731 15:21343976-21343998 GTGGGGTGGGGGAGTGGGGGGGG - Intergenic
1123739875 15:23226163-23226185 GCGGGGACGGGGACTGGGTCGGG - Intergenic
1123758832 15:23417101-23417123 CTGGGGACGGGGCCTCGGGCCGG + Intergenic
1124203397 15:27697662-27697684 GTGGGGAAGTGGAGTGGGGGAGG - Intergenic
1124291098 15:28455131-28455153 GCGGGGACGGGGACTGGGTCGGG - Intergenic
1124426787 15:29570043-29570065 GTGGGGGTGGGGGGTGGGGTGGG - Intronic
1124497514 15:30195660-30195682 GGGGCGACGGGGACGGGGGCGGG + Intergenic
1124508288 15:30298019-30298041 GCTGGGAAGGGGAGTGGGGTGGG + Intergenic
1124628699 15:31325682-31325704 CTGGGGCCGCGGGCTGGGGTAGG + Intergenic
1124712944 15:32030399-32030421 GGGGGGGCGGGGACGGGGGCGGG + Intergenic
1124712948 15:32030405-32030427 GCGGGGACGGGGGCGGGGGCGGG + Intergenic
1124735268 15:32240637-32240659 GCTGGGAAGGGGAGTGGGGTGGG - Intergenic
1125379449 15:39071809-39071831 GTTGGGAAAGGGACTTGGGTTGG + Intergenic
1125590926 15:40854100-40854122 GTGGGGATGGGGGATGGGGAGGG - Intronic
1125728849 15:41881913-41881935 GTGAGGACGGGGACAGGGAAGGG - Intronic
1125832395 15:42726148-42726170 GTGGGCACAGGAACTGCGGTTGG + Exonic
1126051483 15:44689710-44689732 GTGGGGTGGGGGACTAGGGGAGG + Intronic
1126214734 15:46142297-46142319 GTGGGGTGGGGGACTGAGGGAGG - Intergenic
1126732859 15:51701934-51701956 GTGGGGTCGGGGGATGGGGGAGG + Intronic
1127062825 15:55204852-55204874 GGTGGGAAGGGGATTGGGGTGGG - Exonic
1127134606 15:55906631-55906653 GTGGGGTGGGGGGCTGGGGGAGG + Intronic
1127340098 15:58032354-58032376 GTGGGGTGGGGGAAGGGGGTAGG + Intronic
1127571170 15:60243150-60243172 GTGGGGTGGGGGGCTGGGGGAGG + Intergenic
1127854213 15:62941487-62941509 GTGTGGACGGGGCCAGGGCTAGG - Intergenic
1127893767 15:63277433-63277455 GTGGGGGCGGGGGCGGGGCTCGG - Intronic
1127995553 15:64151646-64151668 CTGGGGGCGGGGCCTGGGGTGGG + Intergenic
1128101058 15:65000322-65000344 GTGGGGATGGGGATGGGGGGAGG - Intergenic
1128116783 15:65112509-65112531 ATGGGGATGGGGAGTGGGATGGG + Intronic
1128211021 15:65902612-65902634 GCTGGGACTGGGACAGGGGTGGG - Intronic
1128514469 15:68333804-68333826 GTGGGGACAGAGGCTGGGGAGGG - Intronic
1128608291 15:69054677-69054699 GAAGGGATGGGGACTGGGTTAGG - Intronic
1128744640 15:70104734-70104756 GTTGGGATGGGGAATGGGGAGGG + Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129281901 15:74491940-74491962 GTGGAGAGGGGGACTGGTGGTGG + Intergenic
1129325975 15:74800516-74800538 GTGGGCAAGAGGTCTGGGGTGGG - Intronic
1129375316 15:75126502-75126524 GTGGGTACGGGGACTAGGGGAGG + Intergenic
1129411358 15:75352245-75352267 ATGGGCATGGGGACTGCGGTGGG + Intronic
1129558402 15:76538565-76538587 GTGGGGTCGGGGAGAGGGGAGGG + Intronic
1129759969 15:78123657-78123679 GTTGGGACTGGGACTGGGGCCGG - Intronic
1130324664 15:82870295-82870317 GTGGGGTAGGGGAATGGGCTAGG + Intronic
1130326298 15:82883036-82883058 GTGGGGTCGGGGGATGGGGGAGG - Intronic
1130701358 15:86185755-86185777 GTGGGGTGGGGGGCTGGGGGAGG + Intronic
1130800406 15:87256908-87256930 GTGGGGTGGGGGACTGGGGGAGG - Intergenic
1131071623 15:89469984-89470006 GTGGTGCCTGGGATTGGGGTGGG + Intergenic
1131412570 15:92222675-92222697 GGGGGGAGGGGGGCAGGGGTGGG - Intergenic
1131553109 15:93374769-93374791 TTGGGGGCTGAGACTGGGGTAGG + Intergenic
1131715249 15:95102659-95102681 GTGGGGTCGGGGGCTAGGGGAGG + Intergenic
1131731656 15:95287893-95287915 GTGGGGCGGCGGACTGGGGGAGG + Intergenic
1132150871 15:99457406-99457428 CTGGGGAGGGGGGCGGGGGTGGG - Intergenic
1132291031 15:100704062-100704084 GTGGGGACAGGCCCTGGCGTGGG - Intergenic
1132296176 15:100736387-100736409 CTGGGGACGGGGAATGGGGATGG - Intergenic
1202955063 15_KI270727v1_random:71192-71214 GTGGGGTGGGGGAGTGGGGGGGG - Intergenic
1132615383 16:838948-838970 GAGGGCACGGGGACTGGGCGCGG + Intergenic
1132672524 16:1107683-1107705 GTGGGGCGGGGGACTGTGGGGGG - Intergenic
1132761254 16:1509574-1509596 ATGGGAAAGGGGCCTGGGGTGGG - Intronic
1132885900 16:2181760-2181782 CTGGGGACGAGGGCTGGGGCTGG + Intronic
1132978285 16:2721218-2721240 GTGGGGCCGGGCCGTGGGGTCGG + Intergenic
1133033090 16:3020938-3020960 GCGGGGGGAGGGACTGGGGTCGG + Intronic
1133086269 16:3366035-3366057 TTGGGGATGGGGAGTGGGGTGGG - Intronic
1133273855 16:4625110-4625132 GCGGGGGCGGGGACTCGGGGCGG + Intronic
1133350533 16:5097917-5097939 ATGAGGGCGGGGCCTGGGGTGGG + Intergenic
1133744090 16:8674419-8674441 GGGGAGACGGGGGCTGGGGCGGG - Intergenic
1133749384 16:8712947-8712969 ATGGGGAGGGGGTATGGGGTTGG - Exonic
1133988029 16:10683315-10683337 GTGGGGTCAGGGACTGGGCGGGG + Intronic
1134107357 16:11494096-11494118 GTGGGGAGGGGCAGTGGCGTGGG + Intronic
1134121385 16:11586959-11586981 GCGGGGACGGGGGCGGGGGCTGG + Intronic
1134293166 16:12920171-12920193 GTGGGTACGGGGAGGGGGGAGGG + Intronic
1134441475 16:14302008-14302030 GTGGGGGCGGGGGCCGGGGTGGG - Intergenic
1134493358 16:14712368-14712390 AAGGGGACGGGGACCGGGGCCGG - Intronic
1134498739 16:14751492-14751514 AAGGGGACGGGGACCGGGGCCGG - Intronic
1134581834 16:15377593-15377615 AAGGGGACGGGGACCGGGGCCGG + Intronic
1134757983 16:16686081-16686103 GGGGGGTGGGGGACTGGGGGAGG - Intergenic
1134821660 16:17251926-17251948 GTGGGGACAGGGAGGGGGCTGGG + Intronic
1134925284 16:18153732-18153754 GTGGGGTGGGGGGCTGGGGAGGG + Intergenic
1134988088 16:18673099-18673121 GGGGGGTGGGGGACTGGGGGAGG + Intergenic
1135057238 16:19241320-19241342 GTGGGGTGGGGGATTGGGGCTGG + Intronic
1135312763 16:21418955-21418977 AAGGGGACGGGGACCGGGGCCGG + Intronic
1135365680 16:21851225-21851247 AAGGGGACGGGGACCGGGGCCGG + Intronic
1135390541 16:22089615-22089637 GTGGTGGCGGGGGGTGGGGTGGG - Intergenic
1135446128 16:22519927-22519949 AAGGGGACGGGGACCGGGGCCGG - Intronic
1135565879 16:23510543-23510565 GTGGAGGGGGGGCCTGGGGTGGG - Intronic
1135611181 16:23868755-23868777 GTGGGGATGGAGACTGGGGCCGG + Intronic
1135751960 16:25065394-25065416 GTGGGGACAGGGGCGGGGGCAGG + Intergenic
1135895901 16:26402276-26402298 GTGGGGTGGGGGCCTGGGGGAGG - Intergenic
1136010973 16:27363285-27363307 AAGGGGACAGGGACTGGGGCAGG - Exonic
1136062150 16:27734019-27734041 GTGGAGGTGGGGGCTGGGGTGGG + Intronic
1136073862 16:27804995-27805017 GTGAGGACTGGGATTGGGGGTGG + Intronic
1136073923 16:27805154-27805176 GTGGGCACTGGGATTGGGGGTGG + Intronic
1136073936 16:27805187-27805209 GTGGGCACTGGGATTGGGGGTGG + Intronic
1136073951 16:27805220-27805242 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136073965 16:27805252-27805274 GTGGGCACTGGGATTGGGGGTGG + Intronic
1136073980 16:27805285-27805307 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136073994 16:27805317-27805339 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074008 16:27805349-27805371 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074022 16:27805381-27805403 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074036 16:27805413-27805435 GTGGGCACTGGGATTGGGGGTGG + Intronic
1136074051 16:27805446-27805468 GTGGGCACTGGGATTGGGGGTGG + Intronic
1136074066 16:27805479-27805501 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074080 16:27805511-27805533 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074094 16:27805543-27805565 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074108 16:27805575-27805597 GTGGGCACTGGGATTGGGGGTGG + Intronic
1136074123 16:27805608-27805630 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074137 16:27805640-27805662 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074151 16:27805672-27805694 GTGGGCACTGGGATTGGGGGTGG + Intronic
1136074166 16:27805705-27805727 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074180 16:27805737-27805759 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074194 16:27805769-27805791 GTGGGCACTGGGATTGGGGGTGG + Intronic
1136168141 16:28470510-28470532 AAGGGGACGGGGACCGGGGCCGG + Intronic
1136211173 16:28758610-28758632 AAGGGGACGGGGACCGGGGCCGG - Intronic
1136284721 16:29234023-29234045 GTGGGGGCGGGGACGGGGCGGGG + Intergenic
1136316005 16:29455049-29455071 GTGGGGACGGGGCCTGTCGCAGG + Intronic
1136430582 16:30194391-30194413 GTGGGGACGGGGCCTGTCGCAGG + Intronic
1136543503 16:30942306-30942328 GTGGGGACAGGGACAGGCCTGGG + Intronic
1137263123 16:46847066-46847088 GTTGGGGCGGGGGCTGAGGTGGG - Intergenic
1137549189 16:49425266-49425288 GTGGGGAAGGGGACAGTGGCTGG - Intergenic
1137557902 16:49484204-49484226 GTGGGGCCCGTGACTGGGCTTGG + Intergenic
1137619889 16:49869264-49869286 GTGGGGTGGTGGAGTGGGGTGGG + Intergenic
1137634776 16:49976285-49976307 CTGGAGACAGGGACGGGGGTTGG + Intergenic
1137706603 16:50539812-50539834 GTGGGGGGGGGGCCTGGGGAAGG + Intergenic
1137735234 16:50718918-50718940 GTGGGGAAGGGAGCTGGGGGAGG + Intronic
1137867695 16:51917754-51917776 GTAGGGACAGGGATTGGGCTGGG - Intergenic
1137894393 16:52195418-52195440 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1138094193 16:54199452-54199474 CTGGGCACGGGGCCTGGGGCTGG + Intergenic
1138117843 16:54374448-54374470 GTGGGAATGGGGGCTGGGGGAGG + Intergenic
1138178603 16:54928386-54928408 GCGGGGGCGGGGGCGGGGGTGGG + Intergenic
1138327899 16:56191146-56191168 GCGGGGGCGGGGAGTGGGGCCGG - Intergenic
1138360533 16:56424747-56424769 GCGCGGACGGGGCCTGGGGCAGG - Intronic
1138374203 16:56551549-56551571 GTGGGGGAGGGGATTGGGGCAGG - Intergenic
1138390888 16:56669293-56669315 GTGGGGACGGGGACAGGAACAGG + Intronic
1138392668 16:56682002-56682024 GTGGGGACGGGGACAGGGACCGG + Intronic
1138520318 16:57567363-57567385 GTGGGGAAGGGGACTTGGAGAGG + Intronic
1138549917 16:57741861-57741883 GAGGGGACGGGGACAGGGGTTGG + Intronic
1138658882 16:58506480-58506502 GTGGTGACCGGGGGTGGGGTGGG + Intronic
1138985244 16:62320619-62320641 GTGGGGAGGGGGGCGGGGGGAGG - Intergenic
1139329469 16:66176300-66176322 ATGGGCACTGGGAGTGGGGTAGG - Intergenic
1139492065 16:67291525-67291547 GTGAGGAGGGGGAGAGGGGTAGG + Intronic
1139512698 16:67436411-67436433 GTGGGGGTGGGGAATGGGGCTGG + Intronic
1139990309 16:70934774-70934796 CTGGGGTCGGGGGCTGGGGGTGG + Intronic
1140365582 16:74377880-74377902 AAGGGGACGGGGACCGGGGCCGG - Exonic
1140586590 16:76299994-76300016 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
1140974282 16:80044282-80044304 GTGGGGAAGGGAAAAGGGGTGGG + Intergenic
1141091940 16:81136322-81136344 GTGTTGGCAGGGACTGGGGTTGG + Intergenic
1141497419 16:84419658-84419680 ATGTGGATGGGGAGTGGGGTCGG - Intronic
1141701156 16:85642737-85642759 GCGGGGCCGGGCCCTGGGGTGGG + Intronic
1141788065 16:86214878-86214900 GTGGGGTCAGGGCCTGGGGCCGG - Intergenic
1141940698 16:87274169-87274191 GTGGGGAACGGGGGTGGGGTGGG - Intronic
1141972321 16:87492401-87492423 GCGGGGGCGGGGACCGGGGCCGG + Intergenic
1142074593 16:88110196-88110218 GTTCTGACGGGTACTGGGGTGGG - Intronic
1142089740 16:88203491-88203513 GTGGGGGCGGGGACGGGGCGGGG + Intergenic
1142217248 16:88835902-88835924 GTGGGGACGGGGACCGTGGGAGG - Intronic
1142281865 16:89153033-89153055 GTGGGCAGGGGGACTGTGCTGGG + Intronic
1142427082 16:90007000-90007022 GTGGGGCTGGGGATTCGGGTGGG + Intronic
1142434485 16:90047785-90047807 GTGGGGGCGGGGACGGGGGCGGG + Intergenic
1142440622 16:90095277-90095299 GGGGGGACTGGGTCTGGGATGGG + Intergenic
1203093192 16_KI270728v1_random:1229422-1229444 GTGGGGACGGGGGCTCAGGAAGG + Intergenic
1142582592 17:951557-951579 CTGGGGGCGGGGGCGGGGGTTGG + Intronic
1142811320 17:2396867-2396889 GTGGCGTGGGGGACTGGAGTCGG + Intronic
1142927690 17:3255386-3255408 GTGGGGTGGGGGACTAGGGGAGG + Intergenic
1142948253 17:3454441-3454463 GTGGGGTCGGGGGATGGGGGAGG - Intronic
1143096549 17:4481316-4481338 GTGGGGACAGGGTCTGTGGCAGG + Intronic
1143159100 17:4857383-4857405 GTGGGGAGGGGGACAAGGATGGG + Intronic
1143164305 17:4890198-4890220 TGGGGGACGGGGTGTGGGGTGGG - Intronic
1143204049 17:5130895-5130917 GTGGGAATGGAGACTGGGCTAGG + Intronic
1143333532 17:6155916-6155938 GTGGGGTGGGGGACTAGGGGAGG - Intergenic
1143390253 17:6555925-6555947 CTGGTGACGGGGGCTGGGGCGGG + Intronic
1143453516 17:7051087-7051109 GTGGGGACTGAGACTGCGGTAGG + Intergenic
1143499468 17:7330372-7330394 GTGGGGGCGGGGCCAGGGGCGGG + Intergenic
1143524884 17:7466218-7466240 GTGGCCATGGGGGCTGGGGTAGG + Exonic
1143627860 17:8121535-8121557 GTGGGGGCGGGGTCTAGGGGTGG - Exonic
1143632015 17:8144924-8144946 GTGGGGCTGGGGGCTGGGCTGGG + Exonic
1143651736 17:8267520-8267542 GTGGGGAGGGGGAGTGTGGGTGG - Intronic
1143701625 17:8664941-8664963 ATGGGGGCTGGGAGTGGGGTGGG + Intergenic
1143727646 17:8860445-8860467 GTGGGGAAGGGGGCTGGGGCTGG - Intronic
1143862074 17:9898360-9898382 GTGGGTATCTGGACTGGGGTGGG - Intronic
1143894803 17:10127718-10127740 AGGGGGACAGAGACTGGGGTCGG - Intronic
1143942149 17:10553615-10553637 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1144501897 17:15795452-15795474 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1144788298 17:17843930-17843952 CTGGTGACGGGCACTGGGGGAGG + Intronic
1144854579 17:18260886-18260908 GAGGGGAAGGGGGCTGGGCTAGG - Intronic
1145014573 17:19387845-19387867 CTGGGGAGGGGGACTGGAGAGGG - Intergenic
1145083904 17:19919068-19919090 GTGGGGTGGGGGGCTGGGGGAGG - Intronic
1145213000 17:21028972-21028994 GTGGGGATGGGAGCTGGGCTTGG - Intronic
1145733181 17:27209064-27209086 ATGGGGTCGGGGGCTGGGGTAGG + Intergenic
1145975677 17:28982764-28982786 GTGGGGACTGTGGCTGAGGTGGG - Intronic
1146054099 17:29572718-29572740 GTGGGGCGGGGGCCTCGGGTAGG - Intronic
1146078738 17:29757788-29757810 GTGGGGTGGGGGGCCGGGGTTGG + Intronic
1146429049 17:32773515-32773537 GTGGGGGTAGGGAGTGGGGTGGG - Intronic
1146784919 17:35711467-35711489 CTTGGGCCGGGGAGTGGGGTGGG - Intronic
1146844520 17:36174504-36174526 GTGGGAATGGAGACTGGGCTAGG - Intronic
1146856824 17:36262439-36262461 GTGGGAATGGAGACTGGGCTAGG - Intronic
1146863793 17:36325936-36325958 GTGGGAATGGAGACTGGGCTAGG + Intronic
1146872734 17:36386349-36386371 GTGGGAATGGAGACTGGGCTAGG - Intronic
1146880093 17:36437435-36437457 GTGGGAATGGAGACTGGGCTAGG - Intronic
1146943542 17:36859737-36859759 TCGGGGTCGGGGAGTGGGGTTGG + Intergenic
1147066654 17:37926524-37926546 GTGGGAATGGAGACTGGGCTAGG + Intronic
1147075617 17:37986974-37986996 GTGGGAATGGAGACTGGGCTAGG - Intronic
1147078186 17:38006085-38006107 GTGGGAATGGAGACTGGGCTAGG + Intronic
1147087142 17:38066520-38066542 GTGGGAATGGAGACTGGGCTAGG - Intronic
1147094122 17:38130020-38130042 GTGGGAATGGAGACTGGGCTAGG + Intergenic
1147103087 17:38190483-38190505 GTGGGAATGGAGACTGGGCTAGG - Intergenic
1147381713 17:40060201-40060223 GTGGGCAGGGTGAGTGGGGTGGG + Intronic
1147400385 17:40177414-40177436 GTAGGGGCGGGGACTGGGCGGGG + Intronic
1147422330 17:40328091-40328113 GAGGGGACAGGTACTGGGCTAGG - Intronic
1147723802 17:42554321-42554343 GTTGGGGCTGGGACTGGGGTTGG + Intronic
1147966333 17:44196224-44196246 GTGGGGAAGGGGGGTGGGGGAGG - Intronic
1147967099 17:44199456-44199478 ACGGGGACGGGGACGGGGGAGGG - Intronic
1148127642 17:45245139-45245161 GAGGGGCCGTGGGCTGGGGTAGG + Intronic
1148383876 17:47220830-47220852 GTTGGCACGGGGTTTGGGGTGGG + Intronic
1148440820 17:47710862-47710884 GTGGGGACTTGGGCTGGGATGGG + Exonic
1148558031 17:48590197-48590219 GTGGGGAAGGGGGCAGAGGTAGG - Intronic
1148574572 17:48700278-48700300 GTGGGGTGGGGGGCTGGGGGAGG + Intergenic
1148615018 17:48995685-48995707 ATGGGGTCGGGGACTGGGGAAGG + Intergenic
1148790381 17:50169298-50169320 GAGGGAAGGGGGACTGGGATGGG - Intronic
1148815813 17:50327193-50327215 AAGGCCACGGGGACTGGGGTAGG + Intergenic
1148854095 17:50569299-50569321 GTGAGGACCTGGGCTGGGGTGGG + Intronic
1149090647 17:52774290-52774312 GTGGGGTGGGGGACTGGGGGAGG - Intergenic
1149475878 17:56960646-56960668 ATGGGGAAGGGGACGAGGGTTGG - Intronic
1149847664 17:60016949-60016971 GTGGGAATGGAGACTGGGCTAGG - Intergenic
1150086022 17:62273566-62273588 GTGGGAATGGAGACTGGGCTAGG - Intronic
1150226606 17:63527909-63527931 GTGAGGTCTGGGGCTGGGGTGGG - Intronic
1150273684 17:63882491-63882513 GTGGGGATGGGGGTGGGGGTGGG + Intergenic
1150389956 17:64784396-64784418 GAGGGCACGGGGATTGGGGGTGG + Intergenic
1150392436 17:64797869-64797891 TGGGGGACAGGGACCGGGGTCGG + Intergenic
1150449880 17:65257856-65257878 GTGGGGATGGGGGCTGAAGTAGG + Intergenic
1150489476 17:65564369-65564391 GAGGGGACTGGGACTGGGACTGG + Intronic
1150739937 17:67771388-67771410 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
1150759263 17:67945551-67945573 CTGGGGACTGGGGCTGGGTTTGG - Exonic
1150770454 17:68036176-68036198 GTGGGGGCAGGGGCTGGGGGTGG + Exonic
1150790145 17:68196555-68196577 GTGGGGAAGGGGACAGGGTGGGG + Intergenic
1150995444 17:70312140-70312162 GGGGGGTCGGGGGCTGGGGGAGG - Intergenic
1151079336 17:71310600-71310622 GGGGGGTGGGGGACTGGGGGAGG + Intergenic
1151370481 17:73643984-73644006 GTGGGGACAGGGAGGGGGCTGGG - Intronic
1151371553 17:73649767-73649789 GTGGGGACGGAGCCTGGATTAGG - Intergenic
1151520977 17:74629318-74629340 GTGGGGAGGGGGAGGGGGGAGGG + Intergenic
1151522705 17:74641631-74641653 CTGGGTCCGGGGAGTGGGGTGGG - Intergenic
1151556536 17:74849687-74849709 GTGGGGATGGGGAGTTGGGTGGG - Intronic
1151765584 17:76131829-76131851 GTGGGGATGGGGACAGGGCTTGG + Intergenic
1151979072 17:77498395-77498417 GTCGGGATGGGGAGTGGGGGTGG + Intronic
1152132487 17:78485489-78485511 GAGGGAACGGGGACTGGCGGGGG + Intronic
1152192999 17:78899773-78899795 GTGGGAACGAGGCCTGGGCTGGG - Intronic
1152238388 17:79149977-79149999 GTGGGGATGGGGATGGGGGTGGG + Intronic
1152342547 17:79733372-79733394 GTGGGGAGTGGGCCTGGGGCAGG - Intronic
1152349687 17:79777920-79777942 GCGGGGGCGGGGGCGGGGGTGGG - Intergenic
1152413873 17:80146618-80146640 GTGAGGGCGAGGACGGGGGTGGG + Intronic
1152460799 17:80441409-80441431 GCTGGGACGAGGGCTGGGGTCGG - Intergenic
1152494833 17:80663736-80663758 GAGGGGACTGTGACTGGGGAGGG - Intronic
1152524315 17:80878965-80878987 CGGGGGACGGGGCCTGGGGAAGG - Intronic
1152659902 17:81537314-81537336 GGGAGGACGGGGACTGGGGGTGG + Intergenic
1152759555 17:82100823-82100845 GACAGGACGGTGACTGGGGTGGG - Intergenic
1152762963 17:82119090-82119112 GTGGGGGCGGGGGTGGGGGTGGG + Intronic
1152781869 17:82230341-82230363 GTGTGGACAGAGTCTGGGGTGGG + Intronic
1152870344 17:82750770-82750792 ACGGGGACGGGGACAGGGGAAGG - Exonic
1152870449 17:82751007-82751029 GGGGGGACGGGGACGGAGATGGG - Exonic
1152870489 17:82751100-82751122 GGGGGGACGGGGACGGGGGACGG - Exonic
1152956938 18:48282-48304 GGGGGGACTGGGTCTGGGATGGG - Exonic
1154177417 18:12094362-12094384 GTGGGGTGGGGGACTGTGGTGGG + Intronic
1154177442 18:12094434-12094456 GTTGGGTGGGGGACTGTGGTAGG + Intronic
1154177525 18:12094649-12094671 ATGGGGTGGGGGACTGTGGTGGG + Intronic
1154177575 18:12094791-12094813 GTGGGGTTGGGGACTGTGGTGGG + Intronic
1154326616 18:13395706-13395728 GTGGGGGCGGGAGCTGGCGTGGG + Intronic
1155102171 18:22622198-22622220 GTGGGGTGGGGGGCTGGGGGAGG + Intergenic
1155160875 18:23194580-23194602 GTGGAGACAGGGACTGGAGGAGG + Intronic
1155206030 18:23558864-23558886 GTGGGGTGGGGGCCTGGGGGAGG - Intronic
1155329462 18:24699874-24699896 ATGGGGATGGGGATGGGGGTAGG + Intergenic
1155530968 18:26765906-26765928 GTGGGGTGGGGGAAGGGGGTAGG + Intergenic
1155719052 18:28987463-28987485 GTGGGGTGGGGGGCTGGGGGAGG + Intergenic
1156043904 18:32856795-32856817 GTGGGGAGGGGGAAGGGGGGAGG - Intergenic
1156423921 18:36987334-36987356 GTGGGGTCGGGGGATGGGGGAGG + Intronic
1157124177 18:44939230-44939252 GTGGGGACCGGGGCTGGGAAGGG - Intronic
1157239662 18:45997608-45997630 GTGGGGCCGGGGGTTGGGGGAGG - Intronic
1157354823 18:46923224-46923246 CCGGGGACGGGGACTGTTGTGGG - Intronic
1157355910 18:46933801-46933823 CTGGGGACGGGGACTGTTATGGG - Intronic
1157973056 18:52293007-52293029 GTGGGGTCGGGGTCGGGGGTGGG + Intergenic
1158118584 18:54024186-54024208 GTGGGGACGGGGTTGGGGGGTGG + Intergenic
1158439127 18:57457971-57457993 GTGGGGTAGGGGGCTGGGGGAGG + Intronic
1158588200 18:58758811-58758833 GTGGGGGCGCAGAGTGGGGTGGG - Intergenic
1158721952 18:59933009-59933031 CTGGGGATGGGGACTGGGGAGGG - Intergenic
1159289157 18:66394179-66394201 ATGGGTATGGGGACTGGGATAGG - Intergenic
1159295589 18:66482740-66482762 GTGGGGTTGGGGAGTGGGGAGGG + Intergenic
1159705187 18:71677585-71677607 GAGGGGTGGGGGACTGGGGGAGG - Intergenic
1159731966 18:72038551-72038573 GTGGGGTCGGGGGAGGGGGTAGG + Intergenic
1159984102 18:74821412-74821434 GTGGGGTGGGGGACTAGGGGAGG - Intronic
1160260105 18:77285485-77285507 GTGGGGTCGGGGGCAGGGGGAGG - Intergenic
1160284829 18:77532283-77532305 GTGGGGTCGGGGAATGGGGGAGG - Intergenic
1160429041 18:78799025-78799047 GTGGGGAGGTGGTGTGGGGTAGG - Intergenic
1160711074 19:551149-551171 GAGGGCACCGGGGCTGGGGTGGG - Intergenic
1160739814 19:680573-680595 GCGGGGGCGGGGCCTGGGGCGGG + Intronic
1160785661 19:899314-899336 GTGGGGAAGGGGGCTGGAGTGGG - Intronic
1160786033 19:900645-900667 ATGGGGGCGAGGCCTGGGGTGGG - Intronic
1160786081 19:900762-900784 ATGGGGGCGTGGCCTGGGGTGGG - Intronic
1160809628 19:1007796-1007818 GCGGGGGCGGGGCGTGGGGTGGG + Intronic
1160855053 19:1213437-1213459 GTGGGTGCCGGGACTGGGGAGGG - Intronic
1160875867 19:1295943-1295965 GTGGGGCCGGGGAGTGGGCGGGG + Intronic
1160955307 19:1688554-1688576 GTGGAGACGGGGACAGGGCGGGG + Intergenic
1160974755 19:1787305-1787327 GTTGGGGCTGGGACTGGGGTGGG + Intronic
1160981776 19:1819520-1819542 GCGGGGACGGGGGCAGGGGCCGG + Intronic
1160990308 19:1857667-1857689 GTGGGGAGGGGGGCTGTGGCCGG + Intronic
1161041843 19:2114600-2114622 GTGAGGACGTGGTCTGGGGAAGG + Intronic
1161091368 19:2361366-2361388 GTGGGAGGGGGGGCTGGGGTGGG + Intergenic
1161161986 19:2766978-2767000 GTGGGGACGGGGACGGAAGGGGG - Intronic
1161211429 19:3068081-3068103 GTGGGGTCAGGGACGGGGGTGGG - Intergenic
1161237692 19:3206068-3206090 GTGGGGCCGGGGCCGGGGGCAGG - Intronic
1161237702 19:3206086-3206108 GTGGGGCTGGGGCCAGGGGTGGG - Intronic
1161255910 19:3309418-3309440 GGGGGGACAGGAACCGGGGTTGG + Intergenic
1161300121 19:3538450-3538472 GTGGGTGCCGGGACTGGGGAGGG - Intronic
1161364209 19:3868849-3868871 GTTGGGGCTGGGACTGGGGCCGG + Intronic
1161400836 19:4065763-4065785 GAGGGGAGGGGGGCTGGGGACGG + Intronic
1161448222 19:4329684-4329706 GTAGGGACAGGGTCTGGGGGTGG - Intronic
1161575067 19:5050522-5050544 GTGGGGTGGTGGCCTGGGGTCGG + Intronic
1161682648 19:5687711-5687733 GTGGGGACTGCGGCTGGGGCTGG - Intronic
1161744707 19:6048871-6048893 GAGGGGACGGGGGCGGGGGCCGG - Intronic
1161746901 19:6065980-6066002 GTGGGGGCGGGGGCTGGGGGCGG + Intronic
1161810564 19:6468769-6468791 GTCTGGATGGGGACTGGGATGGG + Intronic
1161846236 19:6713357-6713379 GAGGTGGCGGGGACTGGGGCAGG + Intronic
1161846348 19:6713743-6713765 GTGGGGGCTGGGAGTGGGGAAGG - Intronic
1161919418 19:7255017-7255039 GTGGGTGCGGGGACCGGGGAGGG - Intronic
1161978663 19:7619557-7619579 GTGGGGAGGGGGGATGGGGGAGG + Exonic
1161988394 19:7670097-7670119 GTGGGGACGGGGACGGCTGGAGG - Intronic
1162079274 19:8209080-8209102 GGGGGGGCGGGGACGGGGGCGGG + Intronic
1162079277 19:8209086-8209108 GCGGGGACGGGGGCGGGGATGGG + Intronic
1162079347 19:8209284-8209306 GTGGGGGCGGGGCCTGGGCGGGG - Intronic
1162184833 19:8896813-8896835 GTGGGGCTGGGGACGGGGGATGG + Exonic
1162237741 19:9321795-9321817 GTGGGGGTGGGGAGGGGGGTGGG - Intergenic
1162569813 19:11465500-11465522 GGGGGGTTGGGGATTGGGGTGGG - Intronic
1162731556 19:12721740-12721762 TTGGGGAAGGCGACTGGGATCGG - Intronic
1162789147 19:13054126-13054148 GTAGAGACGGGAACTGGGGGAGG - Intronic
1162931906 19:13961649-13961671 GTGGGCACGGGGACTGGGCAGGG + Exonic
1162973407 19:14194794-14194816 GTGGGGACGGACACAGGTGTGGG - Intronic
1163085974 19:14979850-14979872 GAAGGGAGGGGGACTGGGGGTGG + Intronic
1163420626 19:17211930-17211952 GTGGGGAGGGGGCTCGGGGTGGG - Exonic
1163442078 19:17327415-17327437 GTGGGGCCGGCGACAGGGGCGGG - Intronic
1163489061 19:17606404-17606426 GTGGGGACGGGGCCGTGGGCGGG - Intronic
1163503195 19:17688124-17688146 GTGTGGACGCGGGCTGGGGTCGG - Intronic
1163559338 19:18009716-18009738 GTTGGGACGGGGGCTGGTGTTGG + Intronic
1163700883 19:18785937-18785959 GCGGGGGCGGGGCCTGCGGTGGG - Intronic
1163714810 19:18867530-18867552 CTGGGGACGGGGACAGGGACAGG - Exonic
1163729410 19:18940767-18940789 CTGGGGTGGGGTACTGGGGTGGG - Intronic
1163729616 19:18941359-18941381 GCGGGGGCCGGGACTGGGGAAGG + Intergenic
1163755932 19:19106160-19106182 GCTGGGGCGGGGACAGGGGTGGG - Intronic
1164433873 19:28211414-28211436 GTCGGGGCGGGGGCTGGGGGAGG - Intergenic
1164869210 19:31629202-31629224 TTGGGGATGGGGACTTGGGAGGG - Intergenic
1164977608 19:32585304-32585326 CTGGTGATGGGGACTGGGGATGG + Intronic
1164998722 19:32743363-32743385 GTGGGGAGAGGGAGTGGGGGAGG - Intronic
1165104409 19:33460571-33460593 GTGGGTACGGGGACTGAGACAGG - Intronic
1165225637 19:34352850-34352872 GTGGGGGTGGGGGCTGGGGTGGG - Exonic
1165358473 19:35318843-35318865 GTGGAGATGGGGAGAGGGGTGGG + Intergenic
1165548929 19:36566604-36566626 GTGAGGGCTGGGGCTGGGGTAGG + Intronic
1165796507 19:38523123-38523145 GTGGGGAGGGCGGTTGGGGTGGG - Intronic
1165907713 19:39203812-39203834 CTGGGGCCTGGGCCTGGGGTGGG + Intronic
1165935395 19:39385550-39385572 GTGGGGCCGGGGACAGAAGTGGG - Intronic
1166002285 19:39884913-39884935 ATGGGGACGGGGAAAGGAGTGGG + Intronic
1166180688 19:41106018-41106040 GTGGGGTGGGGGCCTGGGGAAGG + Intergenic
1166364821 19:42273034-42273056 GTGGTGACAGGAGCTGGGGTGGG - Intronic
1166538749 19:43592331-43592353 GTGGCGACGGGGCCTGGGGCTGG - Exonic
1166546963 19:43639704-43639726 GTAGGGTCGGGGGCCGGGGTCGG - Intronic
1166666639 19:44684148-44684170 TTTGGGACGGGTGCTGGGGTGGG - Exonic
1166686708 19:44800705-44800727 GTGGGGACCAGGCCTGGGGACGG - Intergenic
1166689355 19:44813366-44813388 GGCGGGACGTGGGCTGGGGTGGG + Intronic
1166766083 19:45252518-45252540 GTGGGGAAGGGGTCTGAGTTTGG - Intronic
1166803399 19:45471302-45471324 GTGAGGACAGGCCCTGGGGTGGG + Intronic
1166975850 19:46604594-46604616 TTTGGGACGGGGATGGGGGTAGG + Intronic
1166994053 19:46710869-46710891 TTGGGGGCGGGGCCTGGGGCGGG - Intronic
1166994492 19:46713821-46713843 CTGGGGGCGGGGCCTCGGGTGGG - Intronic
1167080752 19:47274852-47274874 GTGGGGGCGGGGCCTGGTGGGGG + Exonic
1167321619 19:48800141-48800163 GTGGGGAGGAGGGCTGGGGCCGG - Intronic
1167384486 19:49155918-49155940 CTGGGGGCAGGGACTGGGCTAGG + Intergenic
1167423046 19:49415015-49415037 GAGTGGATGGGGACTGGGGAGGG - Intronic
1167461057 19:49624991-49625013 GTGGGCACTGGGGCTGGGGCTGG + Intronic
1167596682 19:50432013-50432035 GAGGGGGCGGGGCCTGGGGAGGG - Intergenic
1167742752 19:51334168-51334190 GTGAGCAAGGGGACTGGGGAAGG - Intronic
1167787975 19:51651419-51651441 ATGGGGGCGGAGAGTGGGGTTGG - Intergenic
1167888677 19:52522671-52522693 GTGGGGGCCGGGCCTGGGGTGGG + Intergenic
1167941138 19:52946618-52946640 GTGGGGGCGGGGCCTGGGGCGGG - Intronic
1168072940 19:53962876-53962898 GGGGGGGCGGGGACTGGGGGAGG + Intergenic
1168091400 19:54087713-54087735 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
1168259894 19:55187439-55187461 TAGGAGAAGGGGACTGGGGTGGG + Intronic
1168269322 19:55241158-55241180 GAGGGTTCGGGGGCTGGGGTGGG - Intronic
1168273926 19:55265848-55265870 GAGAGGACGGGGCCTGGGGTGGG - Intronic
1168327030 19:55543811-55543833 GTGGGGAGGGAGACAGGGTTGGG - Intronic
1168332356 19:55578070-55578092 GAGCCGGCGGGGACTGGGGTGGG + Exonic
1168400537 19:56083770-56083792 GTGGGGGTGGGGGGTGGGGTGGG + Intergenic
1168543432 19:57231343-57231365 CTGGGGACTGGGCCAGGGGTCGG + Intronic
1168712800 19:58511534-58511556 GTGTGGACGGGGCCTGGGGCCGG - Exonic
925315786 2:2922149-2922171 GTGGGGCTGGGGACAGGGATTGG - Intergenic
925786007 2:7431688-7431710 GTGGGGGCGGGGGCCGGGGGTGG + Intergenic
925923888 2:8657233-8657255 GTGGGGGCGGGGGTTGGGGTGGG - Intergenic
926092388 2:10059202-10059224 GGGAGGACGGGCTCTGGGGTGGG + Intronic
926125315 2:10268138-10268160 GCGGGGAGGGGGACGGGGGCAGG + Intergenic
926701874 2:15809427-15809449 ATGGGGAAGGGAGCTGGGGTTGG + Intergenic
926702610 2:15813758-15813780 GTGGGGGTGGGGATGGGGGTGGG + Intergenic
927200629 2:20575928-20575950 TGGGGGAAGGGGACTGGGGAGGG + Intronic
927430361 2:23022070-23022092 TTGGGGAGGGGCACTGGGCTAGG + Intergenic
927460309 2:23292966-23292988 GAGGGGACAGGGACAGGGGAAGG + Intergenic
927667415 2:25042205-25042227 GTCGGGGCGGGGACTGGCGGCGG - Exonic
927679270 2:25129342-25129364 GCGGGGGCGGGGCGTGGGGTGGG + Intronic
927966881 2:27275863-27275885 GCGGGGGCGGGGGCGGGGGTGGG - Intronic
927998746 2:27505582-27505604 GTGAGGAAGGGTGCTGGGGTGGG - Intronic
928140712 2:28726639-28726661 ATAGGGATGGGGACAGGGGTGGG - Intergenic
928755609 2:34521887-34521909 ATGGGGTCGGGGGCTGGGGGAGG + Intergenic
929007715 2:37411813-37411835 GGGGGGACAGGGTCTGGGGCAGG + Intergenic
929035991 2:37692241-37692263 GTGGGGTGGGGGAATGGGGGAGG + Intronic
929189316 2:39124491-39124513 GCGAGGACGGGGGCGGGGGTGGG + Intergenic
929254722 2:39797724-39797746 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
929948112 2:46385738-46385760 GTGGGGTCGGGGGGTGGGGCGGG + Exonic
930018763 2:46988189-46988211 GTGAGGCCGGGGATGGGGGTGGG - Intronic
930038147 2:47100569-47100591 GTGTGGAAGGGGACTCGAGTGGG - Intronic
930039365 2:47108274-47108296 GTGTGGAAGGGGACTCGAGTGGG - Intronic
930255535 2:49085963-49085985 GTGGGGGGGGGGAGTGGGGAGGG + Intronic
930286259 2:49431918-49431940 GTGGGGTGGGGAACTGGGGGAGG + Intergenic
930521884 2:52478089-52478111 GTGGGGTGGGGGACTGGGGGAGG - Intergenic
930826322 2:55700287-55700309 GAGGGGAGGGGGAGTGGGGAGGG - Intergenic
930870094 2:56161944-56161966 GTGGGGTTGGGGAGTGGGGAGGG - Intergenic
931220480 2:60284399-60284421 ATGGGGAAGGGGAGTGGGGCTGG - Intergenic
931517839 2:63059979-63060001 GTGGGGGTGGGGGTTGGGGTGGG - Intergenic
931706578 2:64951472-64951494 GTGGGGGAGGGGACAGAGGTAGG - Intergenic
932252737 2:70258504-70258526 GCGTGGACGGGGACAGGGGCGGG + Intronic
932342791 2:70977102-70977124 GTGGGGGCGGGGACAGGGGGAGG + Intronic
932487284 2:72091819-72091841 GTGGGAGCGGGGACTAGGGTGGG - Intergenic
932498512 2:72159805-72159827 GTGGTGGCAGGGACTGGGGAGGG + Intergenic
932646011 2:73503240-73503262 GTGGGGTCGGGGAAGGGGGGAGG - Intronic
932707529 2:74038188-74038210 GTGGGAAATGTGACTGGGGTTGG + Intronic
932899858 2:75685059-75685081 GGGGGTCAGGGGACTGGGGTGGG + Intronic
933475964 2:82790732-82790754 AAGGGGACGGGGATTGGGGCAGG + Intergenic
933877088 2:86630491-86630513 GTGTGGCCAGGGAGTGGGGTGGG + Intronic
934057461 2:88263707-88263729 GTGAAGATGGGGACAGGGGTTGG - Intergenic
934616775 2:95776215-95776237 GTGGGGATGGGGGCTGCGGGAGG - Intergenic
934644115 2:96048345-96048367 GTGGGGATGGGGGCTGCGGGAGG + Intergenic
934744948 2:96753228-96753250 ATGGGGGCGGGGGCGGGGGTGGG + Intergenic
934837532 2:97604436-97604458 GTGGGGATGGGGGCTGCGGGAGG + Intergenic
934992303 2:98930349-98930371 GTGGGGACGGGGATGGGGTAGGG - Intronic
934992318 2:98930387-98930409 GTGGGGACGGGGATGGGGTAGGG - Intronic
934992333 2:98930425-98930447 GTGGGGACGGGGATGGGGTAGGG - Intronic
934992348 2:98930463-98930485 GTGGGGACGGGGATGGGGTAGGG - Intronic
935242522 2:101190856-101190878 GTGGGGGCTGGGGCGGGGGTGGG - Intronic
935300121 2:101686560-101686582 GTGGGGAAGTGGGGTGGGGTGGG + Intergenic
936245274 2:110820899-110820921 GTAGGGAGGGAGACTGGGATTGG + Intronic
936343764 2:111659780-111659802 GTGGGGGCGGGGACAGCGGCAGG - Intergenic
936347234 2:111684396-111684418 GTGAGGGTGGGGAGTGGGGTAGG - Intergenic
936351188 2:111713747-111713769 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
936407838 2:112223108-112223130 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
936650601 2:114422042-114422064 CTGGGGGTGGGGACTGGGGCAGG + Intergenic
936742338 2:115528209-115528231 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
936838032 2:116731846-116731868 GTTGGGACGGGCCCTGAGGTAGG - Intergenic
937078940 2:119126688-119126710 GTGGGGGCTGGGATTGGGGGTGG - Intergenic
937083177 2:119154807-119154829 GTGGGGTGGGGAATTGGGGTTGG + Intergenic
937192856 2:120121345-120121367 GTCGGGAGGGGGAGTGGGGGAGG - Intronic
937212324 2:120282558-120282580 TTGGGGAGGGGGGCGGGGGTGGG + Intronic
937256643 2:120560666-120560688 GTGGCTACGGGGAGTGGGATGGG - Intergenic
937753805 2:125511730-125511752 GTTGGGAAGGGTAGTGGGGTGGG + Intergenic
937885915 2:126899864-126899886 ATGGGGACTGGGCCTGGGGGAGG + Intronic
937952231 2:127397609-127397631 GTGGGGAGGGGCTCTGGGATGGG - Intergenic
938558897 2:132452619-132452641 GGGGGGTGGGGGACTGGGGGAGG - Intronic
938706401 2:133931720-133931742 GTGGGTACGGTGATTGAGGTGGG - Intergenic
938779856 2:134575327-134575349 GTGGGCACTGGGGGTGGGGTAGG - Intronic
938864968 2:135408824-135408846 GTGGGGTCGGGGGATGGGGGAGG + Intronic
939030540 2:137070704-137070726 GTGGGGTGGGGGACAGGGGGAGG - Intronic
939175291 2:138740938-138740960 GTGGGGGCTGGGGGTGGGGTGGG + Intronic
939322955 2:140648288-140648310 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
939382615 2:141455556-141455578 ATGGAGATGGGGACAGGGGTAGG + Intronic
939630431 2:144521958-144521980 GCGGGGCGGGGGAGTGGGGTGGG + Intronic
939724364 2:145697867-145697889 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
940103151 2:150065405-150065427 GTGGGGGCGGGGGCAGGGGCAGG + Intergenic
940125424 2:150317456-150317478 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
940646056 2:156394015-156394037 GTGGGGACGCGGGCAGGGGCAGG + Intergenic
940650491 2:156436169-156436191 GTGGGGGCGGGAACCGGGGCCGG - Intronic
941524353 2:166587213-166587235 GTGGGGTGGGGGCCTGGGGGAGG + Intergenic
942108201 2:172654609-172654631 GTGGGGTGGGGGGCTGGGGGAGG + Intergenic
942313951 2:174682121-174682143 GTGGGGACGGGGGTTGAGGGGGG - Intronic
942887067 2:180938846-180938868 GTGGGGTGGGGGTGTGGGGTTGG - Intergenic
943009582 2:182430956-182430978 GTGGGGTCGGGGAGGGGGGAGGG + Intronic
943053173 2:182941538-182941560 CTGGGGCCAGAGACTGGGGTAGG + Intronic
943777351 2:191780944-191780966 GTGGGGTGGGGGTCTGGGGGAGG - Intergenic
944251513 2:197583769-197583791 GTGGGGTGGGGGAGTGGGGAGGG - Intronic
944462938 2:199970765-199970787 GTGGGGTGGGGGAGTGGGGATGG - Intronic
944465204 2:199993724-199993746 GTAGAGAAGGGGACTGGGGGTGG + Intronic
944984094 2:205154893-205154915 GTGGGGTGGGGGCCTGGGGGAGG + Intronic
945166349 2:206950929-206950951 GTGGGGTGGGGGCCTGGGGGAGG + Intronic
945839291 2:214868791-214868813 TTGGGGAGGTGAACTGGGGTGGG + Intergenic
945891517 2:215435939-215435961 GTGGGGAAGGGGACGGGTGGAGG + Exonic
945918118 2:215726144-215726166 GTGGGGACAGGGAGAGGGGAGGG + Intergenic
946172977 2:217906271-217906293 GTGGCCAGGGGGAATGGGGTGGG - Intronic
946177079 2:217928566-217928588 GTGGGGACAGGGAGTGGGCCTGG + Intronic
946301580 2:218827519-218827541 CTGGGGAAGGGGACTGTGGGAGG + Intronic
946338556 2:219054611-219054633 GTAGTGCCGGGGACTGGGGGAGG - Exonic
946747078 2:222856858-222856880 GAGAGGCTGGGGACTGGGGTTGG - Intergenic
947214088 2:227734511-227734533 GTGGGGTGGGGGGCTGGGGGAGG + Intergenic
947273574 2:228367065-228367087 GTGGGGTCGGGGAAGGGGGAGGG - Intergenic
947593369 2:231396875-231396897 GTGTGGACCGGGGTTGGGGTGGG + Intronic
947752524 2:232540321-232540343 GTGGGGACTGGCACTGAAGTCGG + Intronic
947902292 2:233731427-233731449 GTGGGGTGGGGGACTGGGGGAGG - Intronic
947944139 2:234085359-234085381 TTGGGGATGGGGAGTGGGGTTGG - Intergenic
948134315 2:235624888-235624910 GAGGGGTCGGGGAGTGGGGAAGG - Intronic
948440130 2:237981483-237981505 GTGGGGACTGTGACTGTGGTGGG + Intronic
948710964 2:239825304-239825326 GTGGGGAGGGGACCTGGGGGAGG + Intergenic
949025141 2:241764199-241764221 GGGGCGACGGGGACTGTGGGAGG + Intronic
1168769779 20:407992-408014 GGGGGGCCGGGGGCTGGGGGCGG - Intronic
1168908145 20:1423271-1423293 GTGGTGGGGGGGAGTGGGGTCGG + Intergenic
1168958336 20:1850077-1850099 GTGGGGAAGGAGGATGGGGTTGG + Intergenic
1169638581 20:7722566-7722588 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1170882377 20:20308430-20308452 ATGGGGAAGGGGGCTGGTGTGGG + Intronic
1170976319 20:21168062-21168084 GTGGGGTAGGGGAGTGGGGAGGG - Intronic
1171090680 20:22283415-22283437 GTGGGGACGTGGAGCTGGGTGGG + Intergenic
1171122213 20:22577501-22577523 GTGGGGGCAGGGATTGGGGGGGG + Intergenic
1171769399 20:29310959-29310981 GTGGGGAGGGGGTGTGGGGTGGG - Intergenic
1171846976 20:30283292-30283314 CTGGGGGCTGGGACTGGGGCTGG + Intergenic
1172114061 20:32563263-32563285 GTGGGGAGGGAGACTCGGGAGGG + Intronic
1172189535 20:33053733-33053755 GCGAGTAAGGGGACTGGGGTCGG - Intergenic
1172637768 20:36421547-36421569 GTGGGGACTCGGCCTGGGGCAGG + Intronic
1172944060 20:38674469-38674491 GCGGGGGCGGGGTCTGGTGTGGG - Intergenic
1173075901 20:39819025-39819047 CGGGGGATGGGGACTGGGATTGG - Intergenic
1173077558 20:39833981-39834003 GTGGAAACTGGGACTGTGGTAGG - Intergenic
1173821409 20:46022403-46022425 GTGGGGCCTGGGAGGGGGGTGGG + Intronic
1173870934 20:46341718-46341740 GTGGGGATGGGGGCTGAGGGAGG + Intergenic
1174353440 20:49983508-49983530 GTGAGGAGGGGGATTGGGGCAGG + Intronic
1174385025 20:50182833-50182855 GTGGGGTGGGGGAAGGGGGTAGG - Intergenic
1174565972 20:51464668-51464690 GGGGGGATGAGGAGTGGGGTGGG + Intronic
1175210466 20:57350899-57350921 GGGGGGACGGGGGCGGGGGGCGG + Intergenic
1175341057 20:58229027-58229049 GTGGGGACGTGGCCTGAGCTCGG - Intergenic
1175391180 20:58628443-58628465 GCGGGGGAGGGGAATGGGGTTGG - Intergenic
1175400124 20:58695517-58695539 GTGGGCTCGGGGACTGGAGGTGG - Intronic
1175542235 20:59755051-59755073 GTGGTGAGGGGGAGAGGGGTGGG + Intronic
1175751626 20:61502078-61502100 GTGGAGTGGGGGACAGGGGTGGG + Intronic
1175913754 20:62416275-62416297 GGGGGGACAGGGGCAGGGGTGGG + Intronic
1175915104 20:62422552-62422574 GTGGGGACGGGGACTGGGGTGGG + Intronic
1175915111 20:62422570-62422592 GTGGGGATGGCGACTGGGGTGGG + Intronic
1175915120 20:62422588-62422610 GTGGGGACGGGGACTGGGGTGGG + Intronic
1175915127 20:62422606-62422628 GTGGGGATGGGGCCCGGAGTGGG + Intronic
1175915138 20:62422624-62422646 GTGGGGATGGGGCCCGGGGTGGG + Intronic
1175915149 20:62422642-62422664 GTGGGGATGGGGACCGGGGTGGG + Intronic
1175915159 20:62422660-62422682 GTGGGGATGGGGACCGGGGTGGG + Intronic
1175998635 20:62822224-62822246 CTGGGGAGGGGGAATGGGGAGGG - Intronic
1176163861 20:63662757-63662779 GTGGGGGTGGGGACTGGCTTCGG + Intronic
1176239159 20:64067923-64067945 CTGGGGGCGGGGGCTGGGGCTGG + Intronic
1176546201 21:8201307-8201329 GTGGGGAGGGGGTGTAGGGTGGG + Intergenic
1176551856 21:8226571-8226593 GTGGGGAGGGGGTGCGGGGTGGG + Intergenic
1176565152 21:8384353-8384375 GTGGGGAGGGGGTGTAGGGTGGG + Intergenic
1176570765 21:8409570-8409592 GTGGGGAGGGGGTGCGGGGTGGG + Intergenic
1176578674 21:8453717-8453739 GTGGGGAGGGGGTGCGGGGTGGG + Intergenic
1176916837 21:14635952-14635974 GTGGGGTGGGGGACTGGGGGAGG - Intronic
1178690616 21:34746704-34746726 GAGGGGACGGGGACTGGCGGGGG + Intergenic
1179603477 21:42496521-42496543 GAGGGGGCGGGGACTGGGCAGGG + Intronic
1179720391 21:43313233-43313255 GCGGGGGTGGGCACTGGGGTGGG - Intergenic
1179831871 21:44001900-44001922 GTGGGGTTCGGGACTGGGGCAGG - Intergenic
1179908054 21:44434345-44434367 ATGGTGACGGGGACTGTGGCGGG + Intronic
1179993224 21:44959455-44959477 GGGGGGACAGGGGCAGGGGTGGG - Intronic
1180094464 21:45549659-45549681 GTGGGGAGGGGGACAGGTGGTGG + Intergenic
1180158100 21:45987687-45987709 GTGGGGCCTGGGAGTGGGGGTGG + Intronic
1180650279 22:17370472-17370494 GTGGGGACCGGGCCTGGGCGCGG + Intronic
1180656634 22:17427002-17427024 GTGGGGTGGGGGGCTGGGGGAGG - Intronic
1180724548 22:17936424-17936446 GTGGGGTAGGGGACTAGGGGAGG + Intronic
1180732721 22:17994147-17994169 GATGGGACAGGGACAGGGGTGGG - Intronic
1180786303 22:18549678-18549700 GAGGGGATGGGTACTGGGGAGGG - Intergenic
1180914186 22:19473918-19473940 GTGAGGCAGGAGACTGGGGTTGG - Intronic
1181079116 22:20401965-20401987 AAGGGAAAGGGGACTGGGGTGGG + Intronic
1181175479 22:21032489-21032511 GCGGGGACGGGGACTGGGACGGG - Intronic
1181414183 22:22747482-22747504 GTGGGGACTGAGCCTGGGGAAGG - Intronic
1181438083 22:22921879-22921901 GTAGGGACGGTGACTGGGACGGG + Intergenic
1181439084 22:22926643-22926665 GTGGGGAAGGGGACTGGAGTGGG - Intergenic
1181631934 22:24156094-24156116 GCGGGGGCCGGGACTGGGGCCGG + Intronic
1181670791 22:24424651-24424673 GTGGTGGCGGGAACTGGGTTTGG + Intronic
1181860969 22:25817953-25817975 GTGAGGAAGGGAAATGGGGTAGG + Intronic
1182321803 22:29482504-29482526 GTGGAGAAAGGGACAGGGGTTGG + Intronic
1182345232 22:29658614-29658636 GTGGGGGTGGGGATGGGGGTGGG - Intronic
1182424957 22:30266919-30266941 GTGGGGATGGGGAGGGGGGAGGG + Intergenic
1182552460 22:31107585-31107607 GTGGGGGCGGGGGCGGGGGCGGG - Intronic
1182990807 22:34765649-34765671 GTGGGGCCGGGGAGGGGGGTGGG + Intergenic
1183028118 22:35081608-35081630 GTGGGGAAGGGAACTGGGCAGGG + Intronic
1183042292 22:35191286-35191308 GTGTGGATTGGGTCTGGGGTAGG + Intergenic
1183096213 22:35553847-35553869 GTGGGGAAGGGGACAGAGGCAGG - Exonic
1183441150 22:37823800-37823822 GTGGGGGCGGGGGTTGGGGGAGG + Intronic
1183456556 22:37926088-37926110 GTGGGGCCCGGGCCTGGGGAGGG + Intronic
1183714766 22:39527234-39527256 GTGGGGAAAAGGGCTGGGGTGGG - Intergenic
1183718427 22:39548011-39548033 CTGGGCAAGGGGAGTGGGGTGGG + Intergenic
1183897184 22:40978730-40978752 GTGGGTAAGGGGACAGGGCTTGG - Intergenic
1183951500 22:41355442-41355464 GGGGGGATGGGGAGGGGGGTTGG - Intronic
1184030975 22:41894579-41894601 GTGGGGAGGGGGTGTGGGGGAGG - Intronic
1184194293 22:42916407-42916429 GTGGGGATGGGGGGTGGGGAAGG + Intronic
1184233098 22:43168980-43169002 GTGGGGCCCGGGACTTGGGCAGG - Intronic
1184236886 22:43187387-43187409 GTGGGGAGGGGGGCAGGGGGCGG - Intergenic
1184606187 22:45576088-45576110 AGGGGGACTGGGACTGGGGACGG - Intronic
1184718076 22:46293260-46293282 GTGGGGACGGGGACAGGCAGTGG - Exonic
1184903527 22:47463376-47463398 GTGGGGGCCGGGGCTGTGGTGGG + Exonic
1184988548 22:48152726-48152748 CTGGGCACGGGGCTTGGGGTGGG - Intergenic
1185222076 22:49634164-49634186 CTGGGGACGGGGCCTGGGGTGGG + Intronic
1185271001 22:49929315-49929337 CGGGGGACGGGGACTGGGGGGGG + Intergenic
1185388674 22:50547837-50547859 GTTGGGACTGGGACTGGGGCTGG - Intergenic
1203251073 22_KI270733v1_random:117544-117566 GTGGGGAGGGGGTGTAGGGTGGG + Intergenic
1203256877 22_KI270733v1_random:143493-143515 GTGGGGAGGGGGTGCGGGGTGGG + Intergenic
949864960 3:8539964-8539986 GTGGGGTGGGGGCCTGGGGGAGG - Intronic
949887787 3:8710079-8710101 GTGGGAGAGGGGCCTGGGGTGGG + Intronic
950008205 3:9704686-9704708 GTGGAGTCGGGGCCAGGGGTGGG + Intronic
950262359 3:11552496-11552518 ATAGGGACAGGGACTGGAGTGGG - Intronic
950345293 3:12287801-12287823 GTGGGGGCGGGGGCGGGGGCGGG - Intronic
950438623 3:12994620-12994642 CTGGGGACGGCGGCGGGGGTGGG - Intronic
950545656 3:13636578-13636600 CCTGGGACTGGGACTGGGGTGGG - Intronic
950612906 3:14137512-14137534 GTGGGGGTGGGGGCTGGGCTGGG - Intronic
950701545 3:14753337-14753359 GTGGGGTCAGGGGCTGGGGGAGG + Intronic
950702805 3:14761731-14761753 GTGGGGAGGGGGGCTGGAGGTGG + Intronic
950798224 3:15528590-15528612 TTGGGGACTGGGATTGGGGTAGG - Intergenic
950798227 3:15528596-15528618 GTGTGGTTGGGGACTGGGATTGG - Intergenic
951123558 3:18957946-18957968 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
951189836 3:19755404-19755426 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
951217537 3:20039918-20039940 GTGGGGACGAGGGTGGGGGTAGG - Intergenic
951217672 3:20040331-20040353 GCGGGGGCGGGGAGGGGGGTGGG + Exonic
951311476 3:21130950-21130972 GTGGGGTTGGGGACAGGGGTAGG + Intergenic
951471061 3:23056797-23056819 GTGGGGTGGGGGCCTGGGGGAGG - Intergenic
951496876 3:23338596-23338618 TTGGGGACTGGGACTGGGACTGG + Intronic
951497516 3:23347552-23347574 GTGGGGTGGGGGCCTGGGGGAGG + Intronic
951604155 3:24413708-24413730 GTGGGGTCGGGGATGGGGGAGGG - Intronic
951721149 3:25699599-25699621 GTGGGGTCGGGGGATGGGGGAGG - Intergenic
952048692 3:29357190-29357212 GTGGGGTTGGGGGCTGGGGGAGG - Intronic
952386684 3:32846651-32846673 GGGGGGCTGGGGACAGGGGTGGG - Intronic
952837152 3:37613105-37613127 GTGGGGTGGGGGGCTGGGGGAGG - Intronic
953261727 3:41345930-41345952 GTGAGGACAGGGGCTGGTGTTGG + Intronic
953417959 3:42733820-42733842 GTGAGGACGGTGACTGGGCCAGG + Intronic
953483182 3:43270082-43270104 GTGAGAACTGGGGCTGGGGTGGG + Intergenic
953907341 3:46874929-46874951 ATGGTGGCGGGGAGTGGGGTAGG - Intronic
953976923 3:47389022-47389044 GTGGGGTGGGGGAGTGGAGTGGG - Intronic
953979656 3:47407284-47407306 GTGGGGTTAGGGACAGGGGTGGG - Intronic
953996777 3:47525842-47525864 GTGGTGATCGGGATTGGGGTGGG + Intergenic
954077302 3:48190328-48190350 GGAGGGGCGGGGACTGGGGAAGG + Intergenic
954138332 3:48592506-48592528 GTGGGAGGGGGTACTGGGGTCGG + Intronic
954361374 3:50124494-50124516 GTGGTGACTGGGGCTGGGGTGGG + Intergenic
954488993 3:50883116-50883138 GTGGGGTGGGGGAATGGGGGAGG + Intronic
954614791 3:51964135-51964157 GTGGGCACTGGGGCTGGGGAGGG - Intronic
954755342 3:52836199-52836221 GTCAGGAGGGGGATTGGGGTGGG - Intronic
954825044 3:53365443-53365465 GTGGGGTCGGGGGATGGGGGAGG - Intergenic
955013584 3:55046243-55046265 GTGGGGTGGGGGACGGGGGGAGG - Intronic
955108852 3:55927746-55927768 GCTGGGAAGGGTACTGGGGTTGG - Intronic
955492439 3:59496820-59496842 GTGGTGGCGGGGATGGGGGTGGG - Intergenic
956051848 3:65256665-65256687 CTGGGGAAGGGGGGTGGGGTGGG - Intergenic
956638451 3:71390576-71390598 GTGGGGAGGGGGGTTGGGGGGGG + Intronic
957250265 3:77763820-77763842 GTGGGGTCGGGGGATGGGGGAGG - Intergenic
957500503 3:81051536-81051558 GTGGGGTCGGGGGATGGGGGAGG - Intergenic
957812689 3:85246295-85246317 GTGGGGTGGGGGAAGGGGGTAGG + Intronic
959487280 3:106941355-106941377 GTGGGGTCGGAGGCTGGGGGAGG + Intergenic
959571477 3:107888957-107888979 GTGGGGTCGGGGGATGGGGGAGG + Intergenic
959651473 3:108755261-108755283 GTGGGGTCGGGGGATGGGGGAGG + Intronic
959668806 3:108951114-108951136 GTGGTTACGAGGAGTGGGGTGGG + Intronic
960480248 3:118179149-118179171 GTGGGGCGGGGGACGGGGGGAGG + Intergenic
960755075 3:121002697-121002719 GTGGGGTGGGGGGCTGGGGGAGG - Intronic
960964417 3:123094871-123094893 ATGGGGACAGGGCTTGGGGTTGG + Intronic
961008253 3:123419418-123419440 GTGGGTATGGGGCCTGAGGTGGG - Intronic
961441069 3:126953507-126953529 GTGGGGCCAGGGTCTGGAGTGGG - Intronic
961602680 3:128073336-128073358 CTGGGGGCGGGGTATGGGGTAGG - Intronic
961622146 3:128232567-128232589 GGGGGGAAGGGGACTGAGGCGGG + Intronic
961652645 3:128424839-128424861 GTGGGGGAGGAGATTGGGGTGGG - Intergenic
961740777 3:129032005-129032027 ACGGGGATGGGGACTGAGGTTGG + Intronic
961981514 3:131084136-131084158 GAGGGGATTGGGATTGGGGTGGG - Intronic
962012937 3:131410826-131410848 GTGGGGTCGGGGGAGGGGGTAGG + Intergenic
962070974 3:132033914-132033936 AGGGGGACGGGGACAGGGGACGG - Intronic
962146183 3:132842538-132842560 GTGGGATGGGGGACTGGGGGAGG - Intergenic
962223019 3:133580112-133580134 GGGGGGTGGGGGACTGGGGGAGG - Intronic
962656527 3:137549626-137549648 GTGGGGTGGGGGACTGGGGGAGG + Intergenic
962709017 3:138070123-138070145 GAGGGGACAGGGACTTGGGGAGG - Intronic
962837561 3:139202705-139202727 GTGAGGACAGGGACTGGGGCTGG - Intronic
963074668 3:141334690-141334712 GTGGTGCCGGGGGCTGGGGAAGG - Intronic
963173391 3:142274058-142274080 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
963181577 3:142362584-142362606 GTGGGGGTGGGGGCGGGGGTAGG - Intronic
963766147 3:149337858-149337880 GTGGGGTGGGGGACAGGGGGAGG + Intergenic
963955389 3:151247611-151247633 GTGGGGTCGGGGAGGGGGGAGGG + Intronic
964450610 3:156809403-156809425 GTGGGTTGGGGAACTGGGGTGGG + Intergenic
964515582 3:157504280-157504302 GTGGGGGCGGGGGCTGCAGTGGG + Intronic
964998873 3:162926285-162926307 GTGGGGTGGGGGACAGGGGAGGG + Intergenic
965057572 3:163742221-163742243 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
965735432 3:171814652-171814674 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
965800695 3:172490963-172490985 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
966090078 3:176123177-176123199 GTGGAGGTGGGGATTGGGGTGGG - Intergenic
966246050 3:177809017-177809039 GTGGGGGCGGGGGCGGGGGGAGG + Intergenic
966594726 3:181715382-181715404 GTGGGGGAGGGGAAAGGGGTGGG + Intergenic
966885724 3:184377173-184377195 GTGGGGAGTGGGGCTGGGGAGGG + Intronic
967452771 3:189645647-189645669 GTGGGGTGGGGGAGTGGGGAGGG - Intronic
967565440 3:190965830-190965852 GTGGGGTGGGGGACGGGGGAGGG + Intergenic
967709205 3:192686410-192686432 GTGGTGATGGGGAGTGGTGTGGG - Intronic
967757453 3:193185724-193185746 GTGGGGTGGGGGGCTGGGGAGGG + Intergenic
967793721 3:193575958-193575980 ACTGGGACGGGGACTGGGATGGG + Intronic
967847929 3:194058565-194058587 GTGGGGAGGGGGACGGGGGCAGG + Intergenic
968337748 3:197927956-197927978 GTGGGGTGGGGGGCTGGGGGAGG + Intronic
968357374 3:198119865-198119887 GGGGGGACTGGGTCTGGGATGGG + Intergenic
968519553 4:1029378-1029400 GTGGGGACGGGAACAGGGCTGGG + Intergenic
968562981 4:1294801-1294823 GTGGGGCCGGGGGCAGGGGCAGG + Intronic
968631375 4:1653894-1653916 GTGGGGACAGTGACTGGAGAAGG - Intronic
968645771 4:1739877-1739899 GTGGGGATGGGGACGGGGACAGG - Intronic
968761674 4:2445452-2445474 GTGGGGAGTGGGGGTGGGGTGGG - Intronic
968818221 4:2832622-2832644 GTGGGGGCCAGGACTCGGGTGGG + Intronic
968878294 4:3285748-3285770 CTCTGGAAGGGGACTGGGGTGGG - Intergenic
968896897 4:3409607-3409629 GTGGGCCCGGGGGCTGGTGTGGG + Intronic
968907692 4:3462278-3462300 GTGAGGATGGGGTCTAGGGTAGG + Intergenic
968985843 4:3873876-3873898 GTGGGGCCGGGCAGTGGGGCAGG + Intergenic
969111950 4:4849746-4849768 GTGGGGACAGCCACTGGGCTTGG + Intergenic
969139393 4:5055450-5055472 GAGGGGACAGTGACGGGGGTAGG - Intronic
969333407 4:6492963-6492985 GTGAGGAGGGAGACTGGGGAGGG - Intronic
969584790 4:8085429-8085451 GTGGGGGCGGGGAATGGGAATGG - Intronic
970317645 4:14845041-14845063 GTGGGGATGGGGATGGGAGTGGG + Intergenic
970317654 4:14845059-14845081 GTGGGGATGGGGATGGGGATGGG + Intergenic
970317665 4:14845083-14845105 GTGGGGATGGGGATGGGGATGGG + Intergenic
970441331 4:16083338-16083360 CTGGGGATGGGGGCGGGGGTGGG - Intronic
972925634 4:44003003-44003025 GTGGGAAGGTGGACTGGGGGTGG - Intergenic
973668107 4:53183502-53183524 GTGGGGTGGGGGAGTGGGGAGGG + Intronic
974992731 4:69114686-69114708 GTGTGGAAGGGGACTGGAGCGGG + Intronic
975756024 4:77571738-77571760 GTGTGGAAGGGGACTGGAGCGGG - Intronic
975836754 4:78430604-78430626 GTGGGGCCGGGGGCAGGTGTGGG - Intronic
975946382 4:79710417-79710439 GTGGGGTCGGGGGATGGGGAAGG + Intergenic
976151026 4:82091989-82092011 GTGGGAACCAGAACTGGGGTTGG + Intergenic
976369037 4:84265841-84265863 GTGGGGTGGGGGACTAGGGGAGG + Intergenic
976450829 4:85189156-85189178 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
976519247 4:86007105-86007127 GTGGGGAGGGTGAGTGGGTTAGG - Intergenic
977221954 4:94348048-94348070 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
978075345 4:104522290-104522312 GTGGGGTGGGGGTCTGGGGGAGG - Intergenic
978142311 4:105331797-105331819 GTGGGGTGGGGGTCTGGGGGAGG + Intergenic
978149149 4:105413318-105413340 GGGGGGTGGGGGACTGGGGGAGG + Intronic
978285597 4:107073444-107073466 GTGGGGAGGGGGATTGGTGGGGG - Intronic
978465085 4:108999965-108999987 GTGGGGTGGGGGCCTGGGGGAGG + Intronic
978596711 4:110385864-110385886 GTGGGGTGGGGGAATGGGGGAGG - Intronic
978756031 4:112303891-112303913 GTGGGGTTGGGGAATGGGGGAGG - Intronic
979510163 4:121544836-121544858 GTGGGGTGGGGAACTGGGGGAGG - Intergenic
979563514 4:122127578-122127600 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
979785669 4:124712773-124712795 GCGGGGGCGGGGTCTGGGCTGGG - Intergenic
979827333 4:125255803-125255825 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
979858577 4:125665005-125665027 CTGGTGATGGGGAGTGGGGTGGG + Intergenic
980561581 4:134483906-134483928 GTGGGATGGGGGACTGGGGGAGG + Intergenic
980973386 4:139587782-139587804 GTGGGGAGGGGGACAGGTGGTGG + Intronic
981159758 4:141483949-141483971 GTGGGGAAGGGGACTGCAGAGGG - Intergenic
981618732 4:146670014-146670036 GTGTGGATTGGGAGTGGGGTGGG + Intergenic
981688559 4:147481397-147481419 TCGGGGACTGGGACTGGGGCGGG + Intronic
981851301 4:149233362-149233384 GTGGGGTGGGGGGCTGGGGGAGG + Intergenic
982280677 4:153681008-153681030 GTGGGGTGGGGGGCTGGGGGAGG + Intergenic
982826826 4:160012504-160012526 GTGGGGTGGGGGAGTGGGGATGG + Intergenic
983010186 4:162537364-162537386 GTTGGGAGGGGGACTGAGGAAGG + Intergenic
983210584 4:164954017-164954039 TTGGTGAAGGGGACAGGGGTAGG - Intergenic
983352124 4:166603062-166603084 GTGGGAACTGGTACTAGGGTAGG + Intergenic
983553951 4:169043445-169043467 GTGGGGACAGAGGGTGGGGTGGG - Intergenic
983614422 4:169686172-169686194 GTGGGGTCGGGGAGTGGGGAGGG + Intronic
984806789 4:183758540-183758562 CTGGGGACGGGGCGTGGGGAAGG + Intergenic
985034976 4:185829546-185829568 GTGGGAACGGGGATGGGGATGGG - Intronic
985441161 4:189983385-189983407 GGGGGGACTGGGTCTGGGATGGG - Intergenic
985478388 5:92283-92305 GGGGGCACGGGGACTGCGGCGGG + Intergenic
985478496 5:92524-92546 GCGGGCGCGGGGACTGGGGTGGG + Intergenic
985490127 5:174273-174295 ATGGGGGCTGGGGCTGGGGTGGG + Intronic
985604553 5:851333-851355 GTGGGGAGGGCGGCAGGGGTGGG + Intronic
987475508 5:18387599-18387621 GTGGGTAGGGGGAGTGGGGATGG - Intergenic
987698229 5:21359467-21359489 GTGGGGTGGGGGGATGGGGTAGG + Intergenic
988781857 5:34529586-34529608 GTGGGGCCGTGGCCTGGGCTGGG - Intergenic
989408061 5:41083702-41083724 GTGGGGTGGGGGGCGGGGGTTGG + Intergenic
989508309 5:42254379-42254401 GTGGGGTCGGGGGATGGGGGAGG - Intergenic
989973019 5:50547066-50547088 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
989978591 5:50614392-50614414 GTGGGGTCGGAGGCTGGGGGAGG - Intergenic
990966784 5:61457047-61457069 GTGGGGTCGGGGGATGGGGGAGG - Intronic
991107706 5:62862398-62862420 GTGGGCACTGGGAGTGGGGATGG + Intergenic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
991363742 5:65847029-65847051 GTGGGGCGGGGGCCTGGGGGAGG - Intronic
991639450 5:68738609-68738631 GTGGGGAAGTGGAAAGGGGTGGG - Intergenic
991936984 5:71811596-71811618 GTGGGGATGAGGACTGGACTGGG - Intergenic
992315285 5:75546614-75546636 GTGGGGGTGGGGGGTGGGGTGGG - Intronic
992484419 5:77181074-77181096 GTGGGGGTGGGGGTTGGGGTAGG - Intergenic
992619593 5:78579484-78579506 GTGGGGTCGGGGAAGGGGGGAGG - Intronic
992627258 5:78647640-78647662 GTGGAGGCGAGGACGGGGGTGGG + Intronic
992638403 5:78747479-78747501 GTGGGGAGGGGGTGTGTGGTGGG - Intronic
992652412 5:78872665-78872687 GTGGGGAGGGGGAGGGGGGAGGG + Intronic
992880580 5:81105393-81105415 GTGGGGACGGGCGCTGGAGGTGG - Intronic
992972741 5:82079507-82079529 GTGGGGTGGGGGATTGGGGAGGG - Intronic
993399523 5:87431644-87431666 GAGGGGAAGGGGAATGGGATAGG + Intergenic
993545230 5:89203516-89203538 GTGGGGACGTGGGGTGGGGCGGG + Intergenic
993655765 5:90576255-90576277 GTGGGGCGGGGGGCTGGGGGAGG - Intronic
993804602 5:92388710-92388732 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
994096506 5:95852237-95852259 GTGCAGAAGGGGACTGGAGTGGG - Exonic
994232637 5:97325379-97325401 GTGGGGACAGGGACAGCAGTTGG + Intergenic
994308246 5:98234836-98234858 GTGGGGTGGGGGCCTGGGGGAGG - Intergenic
994399459 5:99260952-99260974 GTTGGGAAGGGTACTGGGGTTGG + Intergenic
994601645 5:101912989-101913011 GTGGGGTCGGGGGAGGGGGTAGG - Intergenic
994623923 5:102194643-102194665 GTGGGGTCGGGGGAGGGGGTAGG + Intergenic
994948349 5:106425524-106425546 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
995700530 5:114929833-114929855 GTGTGGAAGGGGACCGGAGTCGG - Intergenic
995795980 5:115941883-115941905 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
995838481 5:116421435-116421457 TTGGGGAGGGTGACTGGGGAAGG + Intergenic
995841332 5:116446284-116446306 GTGGGGGTGGGGGATGGGGTAGG + Exonic
995948362 5:117679247-117679269 GTGGGGACGGGGAGTGGTGGTGG - Intergenic
996274200 5:121644815-121644837 GTGGGGTGGGGGACTGGGGGAGG - Intergenic
997094570 5:130896244-130896266 ATGGGGTGGGGGACTGGGGGAGG + Intergenic
997269019 5:132519832-132519854 GTGGGGTCGGGGGATGGGGGAGG + Intergenic
997554358 5:134782608-134782630 GTGGGAACGGGGGGTGTGGTAGG - Intronic
997584420 5:135035885-135035907 ATGGGGATGGGGATGGGGGTAGG - Intronic
997657551 5:135566658-135566680 GTGGGGACTGAGGCTGGGGCTGG + Intergenic
997672755 5:135689950-135689972 TTGGGGACGAGGACTGGGTAAGG + Intergenic
997693345 5:135842867-135842889 CTGGGGACGGGTGCAGGGGTGGG - Intronic
997908386 5:137843395-137843417 GTGGGGTCGGGGGCTAGGGGAGG + Intergenic
998129778 5:139645860-139645882 TTGGGGAAGGGGGCTGTGGTGGG + Intergenic
998377722 5:141702383-141702405 GTGGGGGCGGGGAGTGGGGGCGG - Intergenic
998712868 5:144847099-144847121 GTGTGGAAGGGGACTGGAGTGGG + Intergenic
999113196 5:149139968-149139990 GTGGGATAGGGGACTGGGGGAGG - Intergenic
999203880 5:149834800-149834822 GTGGGGCCGGGGCCAGGGGTGGG - Intronic
999324742 5:150636807-150636829 GTTGGGAAGGGGGATGGGGTTGG + Intronic
999437055 5:151571214-151571236 GTGGGGGCTGGGTCAGGGGTAGG - Intergenic
999799491 5:155019783-155019805 GCAGGGACTGGGAGTGGGGTGGG + Intergenic
1000102379 5:158028699-158028721 GGGGGGGCAGGGGCTGGGGTGGG - Intergenic
1000260824 5:159586970-159586992 CTGGGGCAGGTGACTGGGGTTGG - Intergenic
1000598445 5:163243473-163243495 GTGGGGTCGGGGGATGGGGGAGG + Intergenic
1000699208 5:164427454-164427476 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1000829814 5:166088760-166088782 GTGGGGATGGGGATGGGGATGGG - Intergenic
1000903433 5:166935749-166935771 GTGTGGAAGGGGACTGGAGCTGG + Intergenic
1001135466 5:169099093-169099115 CTGGGGAGAGGGGCTGGGGTAGG - Intronic
1001260660 5:170225632-170225654 GTGGGGACGGTGACACGGCTGGG - Intergenic
1001261194 5:170230843-170230865 GTGATGATGGGCACTGGGGTTGG - Intergenic
1001548639 5:172586528-172586550 GTGGGGGCTGGGGATGGGGTGGG + Intergenic
1001593526 5:172882774-172882796 CTGGGCATGGGGACAGGGGTAGG - Intronic
1001827945 5:174761357-174761379 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
1001840910 5:174875923-174875945 GAGGTCACGGGGGCTGGGGTGGG + Intergenic
1001959763 5:175872692-175872714 GTGGGGACGGGGCGGGGGGAGGG + Intronic
1002028697 5:176412970-176412992 GTGGGGTCTGAGACTGGGGTTGG - Intronic
1002173373 5:177387664-177387686 CTGGGGACTGGGACGTGGGTGGG + Intronic
1002183039 5:177441353-177441375 GTGGGCAGGGGGAGTGGGGCGGG - Intronic
1002297587 5:178240073-178240095 GTTGGGGCTGGGCCTGGGGTAGG + Intronic
1002446708 5:179294615-179294637 GTGGGGGCGGGGGCAGGGCTTGG - Intronic
1002520954 5:179793098-179793120 GTGGGGAGGGGGACTACGGCGGG - Intronic
1002593571 5:180307145-180307167 GTGGGGGTGGGGGCTGGGGGTGG + Intronic
1002928680 6:1619456-1619478 GGGGGGAGGGGGATGGGGGTGGG - Intergenic
1003529966 6:6929011-6929033 GTGAACACGGGGGCTGGGGTTGG - Intergenic
1003772814 6:9325903-9325925 GTAGTGCCGGGGGCTGGGGTGGG - Intergenic
1003854988 6:10264372-10264394 GTGGGGTAGGGGGCTGGGGGAGG - Intergenic
1004033763 6:11901136-11901158 GTGGGGACCGGTGCTGGGGCAGG - Intergenic
1004591744 6:17058661-17058683 GTTGGGAAGGGTAGTGGGGTGGG + Intergenic
1004833324 6:19501088-19501110 GTGGGGTGGGGGGATGGGGTAGG + Intergenic
1005389729 6:25321044-25321066 GTGGGGGTGGGGGCTGGGGGAGG - Intronic
1005552615 6:26938921-26938943 GTGGGGTGGGGGGATGGGGTAGG - Intergenic
1005585655 6:27273918-27273940 ATGGGGAGGGGGAGTGGTGTGGG + Intergenic
1005682998 6:28225378-28225400 GTGGGGACCGGGAATGGAGGCGG + Intronic
1005931838 6:30490187-30490209 GTGGCGACGGGGGCGGGGCTTGG + Intronic
1006097702 6:31666179-31666201 ACGGGGACCAGGACTGGGGTGGG - Exonic
1006133883 6:31884247-31884269 GTGGGGAGGGGGCCTGTGGGTGG + Intronic
1006296330 6:33171675-33171697 TTGGGGAGGGGTACTGGGGAGGG - Intronic
1006337536 6:33428210-33428232 GTGGGCGCGGGGAGGGGGGTGGG + Intronic
1006514714 6:34539472-34539494 GTGGAGGCGGGGGCTCGGGTGGG - Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006644013 6:35503896-35503918 GTGTGGAAGGGGCCTGGGGCAGG - Intronic
1006795995 6:36732772-36732794 GTGGGGAAAGGGAGTGAGGTTGG - Exonic
1006820596 6:36891135-36891157 GTGGGGTAGGGGAGTGGGGAGGG - Intronic
1006973919 6:38078703-38078725 GTGTTGACCGGGACTGAGGTTGG - Intronic
1007372076 6:41432537-41432559 GTGGGGCAGGAGGCTGGGGTGGG - Intergenic
1007659854 6:43477489-43477511 ATGGGGGCGGGGCCTCGGGTTGG - Intergenic
1007666581 6:43516972-43516994 CTGGGGACGTGGACGGGGGCGGG + Exonic
1007962115 6:45969432-45969454 GTGGGGGCGGGGACATGGGGTGG - Intronic
1008186906 6:48404385-48404407 GTGGGGAAGCGTACTAGGGTAGG - Intergenic
1008787124 6:55182225-55182247 GTGGGGCCGGGGCCCGGGGGCGG - Intronic
1009211040 6:60863456-60863478 GTGGGGAGGGGGGAGGGGGTAGG + Intergenic
1009414140 6:63396808-63396830 GTCTGGATGGGGACTGGGGTGGG + Intergenic
1010307094 6:74337886-74337908 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
1010467489 6:76186255-76186277 GTGGGGTGGGGGGCTGGGGAGGG - Intergenic
1010505555 6:76654151-76654173 GTGGGGTCGGGGGATGGGGGAGG - Intergenic
1010513450 6:76745791-76745813 GTGGGGTGGGGGACGGGGGAGGG - Intergenic
1010621259 6:78078655-78078677 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1010696273 6:78977375-78977397 GTGGGGTGGGGGACGGGGGAGGG + Intronic
1010954454 6:82074063-82074085 GTGGGGTGGGGGACTGGGGGAGG + Intergenic
1011131917 6:84060342-84060364 GAGGGAAGGGGGACTGGGCTGGG + Intronic
1011193676 6:84762491-84762513 GTGAAGACAGGGTCTGGGGTAGG + Intronic
1011380525 6:86737869-86737891 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
1011720960 6:90156157-90156179 GTGGGGAGGGAAACTGAGGTAGG + Intronic
1012068000 6:94574924-94574946 GTGGGGTGGGGGATGGGGGTGGG + Intergenic
1012117546 6:95322401-95322423 GTGGGGTGGGGGTGTGGGGTGGG - Intergenic
1013385217 6:109621741-109621763 GTGGGGAGGGGGGATGGGGGAGG + Intronic
1013484664 6:110585189-110585211 GTGGGGTGGGGGGCTGGGGGAGG + Intergenic
1013726725 6:113106870-113106892 GTGGGGTCGGGGGATGGGGGAGG + Intergenic
1013756827 6:113471802-113471824 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
1013869784 6:114743156-114743178 GTGTGGAGGGGGAGTGGGGAGGG - Intergenic
1013933830 6:115569680-115569702 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1014403928 6:121024856-121024878 GTGGGGTGGGGGAATGGGGAAGG + Intergenic
1014851381 6:126343528-126343550 TTGGGGACTGGGACTGGGACTGG - Intronic
1014948015 6:127519031-127519053 GCGGGGAGGGGGACGGGGGACGG + Exonic
1015074148 6:129134553-129134575 GGGGGGATGGGGAGTGGGGATGG + Intronic
1015108088 6:129560166-129560188 GTGGGGTCGGGGGATGGGGGAGG + Intergenic
1015194032 6:130505619-130505641 GTAGGGAGGAGGGCTGGGGTGGG + Intergenic
1015270568 6:131333854-131333876 GTGGAGAAGAGGACTGTGGTTGG + Intergenic
1015290434 6:131532407-131532429 GTGGGGTGGGGGACAGGGGGAGG + Intergenic
1015732483 6:136362627-136362649 GTGGGGACCGGGGCTGGAGCTGG + Exonic
1016593387 6:145770720-145770742 GTGGGGTCGGGGGATGGGGGAGG + Intergenic
1016691530 6:146943445-146943467 GTAGGGGCGGGGAGTGGGGGCGG - Intergenic
1016734526 6:147462156-147462178 GTGGGGTCGGGGCCTAGGGGAGG + Intergenic
1016813498 6:148282851-148282873 TTGGGGAGGGGGACTAGGGTTGG - Intronic
1017443894 6:154489977-154489999 GAGAGGAGGGAGACTGGGGTGGG - Intronic
1017614224 6:156227661-156227683 GTGGGGAGGGGAAGTGGGGATGG + Intergenic
1017720419 6:157239773-157239795 GTGGGGTTGGGGGCTGGGGGAGG + Intergenic
1018787194 6:167117215-167117237 GCGGGGACGGGGACGGTGGTAGG - Intergenic
1018890191 6:167977297-167977319 GGGGGGAGGGGGAAGGGGGTAGG - Intergenic
1018902490 6:168058545-168058567 GTGGAGCCGGGGGCGGGGGTTGG + Intronic
1019057785 6:169235661-169235683 GTGTGGACGGGGAGTGAGTTTGG - Intronic
1019202128 6:170326592-170326614 GTTGTGACGGGGACTGTGGAAGG - Intronic
1019341627 7:511316-511338 GTGGGGCCAGAGACTGGGGGTGG + Intronic
1019341644 7:511360-511382 GTGGGGCCAGAGACTGGGGGTGG + Intronic
1019587980 7:1815133-1815155 GTGGGGGCGGGGGCAGGGGGAGG - Intergenic
1019795309 7:3044039-3044061 GTGGGGACAGGGCCGGGGGTGGG + Intergenic
1019811337 7:3167368-3167390 GTGGGGATGGGGATGGGGATGGG - Intronic
1019833506 7:3357640-3357662 GTGAGGAAGGGGAGTGGGCTGGG - Intronic
1020049521 7:5072528-5072550 GCGAGGAAGGGGACTGGGGGCGG + Intronic
1020406930 7:7846905-7846927 GTGGGGTCGGGGGAGGGGGTAGG + Intronic
1020558782 7:9702491-9702513 GTGGGGTGGGGGGCTGGGGAGGG + Intergenic
1020570133 7:9850536-9850558 GTAGAGACAGGGGCTGGGGTGGG - Intergenic
1021159319 7:17252477-17252499 GGGGGGTGGGGGACTGGGGGAGG - Intergenic
1021290229 7:18834546-18834568 GTGGGAAAGAGGACTGGTGTAGG + Intronic
1021940776 7:25677151-25677173 GTGGAGTCTGGGACTGGGGACGG + Intergenic
1022522462 7:31016918-31016940 GTGTGGGCAGGGGCTGGGGTTGG + Intergenic
1022550219 7:31231577-31231599 GTGGGGAGGGGGTTTGGGGGTGG + Intergenic
1023012932 7:35939529-35939551 GTGGGGACTGGGGATGGGGTAGG + Intergenic
1023083787 7:36550021-36550043 GTGGTAACGGGGATTGGGGCAGG - Intronic
1023177582 7:37448592-37448614 GAGGGGGCCGGGACTGGGGCCGG - Intronic
1023389340 7:39693417-39693439 GTGGGGTGGGGGACTGGGGGAGG + Intronic
1023763162 7:43486000-43486022 GTGGGGTTGGGGGCTGGGGGAGG - Intronic
1024033756 7:45488671-45488693 GTGGGGAGGGGAAAGGGGGTTGG + Intergenic
1024078200 7:45834324-45834346 GTGGGGACTGGGGATGGGGTAGG - Intergenic
1024583141 7:50817029-50817051 GTGGTTACGGGGCCTGGGGGTGG + Intergenic
1025314455 7:58002205-58002227 GTGGGGTCGGGGGAGGGGGTAGG - Intergenic
1025932939 7:66010887-66010909 GTGGGGATGGGCAGTGGGGTGGG + Intergenic
1026409070 7:70100570-70100592 GTGGGGTGGGGGGCTGGGGGAGG - Intronic
1026853432 7:73738500-73738522 GCGGAGACGGGGAAAGGGGTAGG + Intronic
1026945724 7:74314802-74314824 GTGGGGAAGAGGCCTGGGGGTGG + Intronic
1027351622 7:77317376-77317398 GTGGGGTTGGGGGCTGGGGGAGG + Intronic
1027372186 7:77518095-77518117 GAGGGGACGGGGGTCGGGGTCGG - Intergenic
1027435129 7:78156295-78156317 GTGGGGAAGGGGACAGGGAGGGG + Intronic
1027564141 7:79768537-79768559 GTGGGGTGGGGGACAGGGGGAGG + Intergenic
1027698774 7:81442951-81442973 GTGGGGCCGGGGAGAGGGGAGGG - Intergenic
1027964409 7:84987579-84987601 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1028211852 7:88083337-88083359 GTGGGGTGGGGGACTGGGGGAGG + Intronic
1028940433 7:96515875-96515897 GCGGGGTCGGGGACTGGGGGAGG + Intronic
1028963288 7:96773951-96773973 CTGGGGATGGGGAGTGGGGGTGG + Intergenic
1029274542 7:99396493-99396515 ATGGGGGGGGGGACTGGGGGAGG - Exonic
1029536852 7:101162416-101162438 GAGGAGACGGGGACTGTGGCTGG + Intergenic
1029851805 7:103469381-103469403 CTGGGGATGGGGATGGGGGTGGG - Intergenic
1029967604 7:104756059-104756081 GTTGGGATGGGGAGTGGGGATGG + Intronic
1030019673 7:105260882-105260904 GGGGGGTGGGGGACTGGGGGAGG + Intronic
1030596362 7:111544246-111544268 GTGGGGTGGGGGGATGGGGTGGG + Intronic
1030616651 7:111744375-111744397 GTGGGGAGGTGGACTGGAGAGGG - Intronic
1030883436 7:114910415-114910437 GTGGGGAGAGGGACTGGGAGAGG + Intergenic
1030963790 7:115962993-115963015 GGGGAGAGGGGGACTGGGGGAGG - Intronic
1031379412 7:121067256-121067278 GTGGGGTGGGGGAATGGGGGAGG - Intronic
1031836249 7:126685106-126685128 GCGGGGCCGGGGCCTGGAGTGGG - Intronic
1032283872 7:130526830-130526852 GTGGGGATGGGGTTCGGGGTGGG + Intronic
1032284601 7:130531062-130531084 GTGGGGATGGGGTTCGGGGTGGG + Intronic
1032285427 7:130535645-130535667 GAGGGGATGGGGTTTGGGGTGGG + Intronic
1032600127 7:133284903-133284925 GTTGGAACTGGGACCGGGGTAGG - Intronic
1032716004 7:134509987-134510009 ATGGGGACTGGGTCTGGGCTTGG + Intergenic
1033099725 7:138460191-138460213 GCGGGGGCGGGGCCTGAGGTGGG + Intergenic
1033411965 7:141126293-141126315 GTGGGGATGGGGCCTGGAGGAGG + Intronic
1033498164 7:141920824-141920846 GTGGGGTCGGGGAAGGGGGGAGG - Intronic
1033675279 7:143535084-143535106 GAGAGGACGGGGCCTGGAGTGGG + Intergenic
1033696558 7:143794354-143794376 GAGAGGACGGGGCCTGGAGTGGG - Intergenic
1034274405 7:149817761-149817783 GTGAGGGTGGGGACTGGGCTGGG + Intergenic
1034308632 7:150067799-150067821 GGGGGGATGGGGGATGGGGTCGG + Intergenic
1034318917 7:150161356-150161378 GTGGGGTGGGGGACTGGCGGAGG - Intergenic
1034415762 7:150963575-150963597 GTCGGGGCTGGGGCTGGGGTGGG - Intronic
1034481463 7:151323066-151323088 GTGGTGCCAGGGACTGGGGGAGG - Intergenic
1034673489 7:152874506-152874528 GGGGGGTGGGGGGCTGGGGTAGG - Intergenic
1034773842 7:153805851-153805873 GTGGGGTGGGGGACTGGCGGAGG + Intergenic
1034798219 7:154032844-154032866 GGGGGGATGGGGGATGGGGTCGG - Intronic
1034911606 7:155002772-155002794 GCGGGGACGGGGACGGGGACGGG + Intronic
1034973037 7:155430995-155431017 GTGGGGTGGGGGGCTGGGGGAGG + Intergenic
1034994785 7:155570885-155570907 GTGGGGGCGGGGGCGGGGGCGGG - Intergenic
1035456654 7:159013470-159013492 GTTGGGATGGGGTCTGGGTTGGG + Intergenic
1035538055 8:407241-407263 GTGGGGACGGGGCCTGTGGGAGG + Intronic
1035567200 8:649598-649620 CGGGGGAGGGGGATTGGGGTGGG + Intronic
1035646693 8:1228077-1228099 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
1035919765 8:3664174-3664196 GTGGGGTGGGGGTCTAGGGTAGG - Intronic
1036216564 8:6884469-6884491 GAGGGGAGGGGGTCTGGGGTGGG + Intergenic
1036217119 8:6889907-6889929 GAGGGGACGGGGAGGGGGGATGG - Intergenic
1036263320 8:7257060-7257082 GTGGGGGTGGGGACGGGGGGAGG + Intergenic
1036264623 8:7264682-7264704 GTGGGGGTGGGGACGGGGGGAGG + Intergenic
1036265922 8:7272304-7272326 GTGGGGGTGGGGACGGGGGGAGG + Intergenic
1036267224 8:7279926-7279948 GTGGGGGTGGGGACGGGGGGAGG + Intergenic
1036268527 8:7287548-7287570 GTGGGGGTGGGGACGGGGGGAGG + Intergenic
1036269831 8:7295170-7295192 GTGGGGGTGGGGACGGGGGGAGG + Intergenic
1036298060 8:7551884-7551906 GTGGGGGTGGGGACGGGGGGAGG - Intergenic
1036300670 8:7567182-7567204 GTGGGGGTGGGGACGGGGGGAGG - Intergenic
1036303272 8:7582475-7582497 GTGGGGGTGGGGACGGGGGGAGG - Intergenic
1036315364 8:7715599-7715621 GTGGGGGTGGGGACGGGGGGAGG + Intergenic
1036316668 8:7723247-7723269 GTGGGGGTGGGGACGGGGGGAGG + Intergenic
1036317975 8:7730895-7730917 GTGGGGGTGGGGACGGGGGGAGG + Intergenic
1036319282 8:7738543-7738565 GTGGGGGTGGGGACGGGGGGAGG + Intergenic
1036320591 8:7746190-7746212 GTGGGGGTGGGGACGGGGGGAGG + Intergenic
1036321901 8:7753838-7753860 GTGGGGGTGGGGACGGGGGGAGG + Intergenic
1036323210 8:7761486-7761508 GTGGGGGTGGGGACGGGGGGAGG + Intergenic
1036324511 8:7769133-7769155 GTGGGGGTGGGGACGGGGGGAGG + Intergenic
1036351523 8:8015174-8015196 GTGGGGGTGGGGACGGGGGGAGG - Intergenic
1036354122 8:8030468-8030490 GTGGGGGTGGGGACGGGGGGAGG - Intergenic
1036846781 8:12175593-12175615 GTGGGGGTGGGGACGGGGGGAGG - Intergenic
1036868146 8:12417912-12417934 GTGGGGGTGGGGACGGGGGGAGG - Intergenic
1036930531 8:12951710-12951732 GCGGGGACGGTGACGGGGGCGGG + Intronic
1037028701 8:14073859-14073881 GTGGGGTGGGGGACTAGGGGAGG - Intergenic
1038912023 8:31975364-31975386 GTGAGGATGGGAACTGGGGAAGG + Intronic
1039045568 8:33446129-33446151 GTGGGGAAGGGGTCTGAGCTGGG + Intronic
1039063642 8:33591833-33591855 GAGGGGACGGGGAGTGAGGTTGG - Exonic
1039317410 8:36388716-36388738 GTGGGGACGGGGGAGGGGGGAGG - Intergenic
1039633491 8:39138315-39138337 GGGGGGTGGGGGACTGGGGGAGG - Intronic
1039837080 8:41265128-41265150 GTGGGGAGGGAGCCTCGGGTGGG - Exonic
1039901147 8:41753415-41753437 GAGGGGAAGGGGTCTGGGGGAGG - Intronic
1040043691 8:42940494-42940516 GTGGGGACAGGGACAGGGACAGG + Intronic
1040279546 8:46031974-46031996 GTGGGGGCGGGGGCGGGGGTGGG + Intergenic
1040428013 8:47308634-47308656 GTGGGGGTGGGGATGGGGGTGGG + Intronic
1040601778 8:48891924-48891946 ATGGGGATGGGGACTGGGACTGG - Intergenic
1040645230 8:49389410-49389432 GTGGGTGAGGGGTCTGGGGTGGG - Intergenic
1040771757 8:50986623-50986645 GTGGGGTGGGGGAAGGGGGTAGG - Intergenic
1040937449 8:52796201-52796223 ATGGGGATGGCCACTGGGGTGGG - Intergenic
1041216039 8:55601182-55601204 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
1041222101 8:55662142-55662164 TTGGGGTGGGGGGCTGGGGTAGG + Intergenic
1041495847 8:58484477-58484499 GTGGGGTCGGGGGATGGGGGAGG + Intergenic
1041723430 8:60996957-60996979 GTGGGGACGGGGGTGAGGGTGGG - Intergenic
1042174564 8:66026605-66026627 GTGGGCATGGGGGCTGGGCTGGG - Intronic
1042222079 8:66483892-66483914 GTGGGGACGGGGATGGTAGTAGG - Intronic
1042224375 8:66504125-66504147 GTGGGGAGGGAGAATGGGGAGGG - Intronic
1042228189 8:66531269-66531291 GTGGAGTAGGGGGCTGGGGTAGG + Intergenic
1042448181 8:68913953-68913975 GTGGGGACCGGGGCTGGGGGTGG - Intergenic
1042486453 8:69351523-69351545 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1042596993 8:70460369-70460391 GTGGGGTCGGGGGCTGGGGGAGG - Intergenic
1042611926 8:70608897-70608919 ATGGGGACGGGGATGGGGGTGGG - Intronic
1042611930 8:70608903-70608925 GTGGGGATGGGGACGGGGATGGG - Intronic
1042618051 8:70671475-70671497 GTGGGGTCGGGGAAGGGGGGAGG - Intronic
1044764014 8:95552375-95552397 GTGGGGTCGGGGGATGGGGGAGG - Intergenic
1045046192 8:98281336-98281358 GCTGGGAAGGGTACTGGGGTAGG + Intronic
1045345676 8:101291438-101291460 CTGGGGATGGGGAGAGGGGTAGG + Intergenic
1045572345 8:103381238-103381260 GTGGGGTGGGGGGCTGGGGGAGG - Intronic
1045581304 8:103483286-103483308 GTGGGGATGGGGAATGGGAAGGG + Intergenic
1046395943 8:113639713-113639735 GTGGGGTTGGGGGCTGGGGGAGG - Intergenic
1046584660 8:116135971-116135993 GTGGGGTGGGGGACTGGCGGAGG + Intergenic
1047915543 8:129580042-129580064 GTGGGGTGGGGGACTAGGGGAGG + Intergenic
1047962993 8:130024493-130024515 GGGGGGTGGGGGGCTGGGGTTGG - Intergenic
1049217780 8:141415702-141415724 GGTGGGGTGGGGACTGGGGTGGG + Intronic
1049217794 8:141415730-141415752 GTGGGGAGAGGGTGTGGGGTGGG + Intronic
1049217805 8:141415753-141415775 GTGGGGAGAGGGTGTGGGGTGGG + Intronic
1049432922 8:142573620-142573642 TTGCAGAGGGGGACTGGGGTAGG + Intergenic
1049514335 8:143045524-143045546 GGAGGAATGGGGACTGGGGTGGG - Intronic
1049620921 8:143597976-143597998 GCGGGGACGGGGGCTGGGGCGGG - Exonic
1049665570 8:143841190-143841212 GAGGGGACAGGGCCTGGGGAGGG - Intergenic
1049692784 8:143969887-143969909 GTGGGGCAGGGGCCAGGGGTGGG + Intronic
1049841733 8:144777583-144777605 AAGGAGACAGGGACTGGGGTTGG + Intronic
1049882928 9:10421-10443 GTGGGGGTGGGGGTTGGGGTTGG - Intergenic
1050053631 9:1629112-1629134 GTGGGGTGGGGGACTGGGGGAGG + Intergenic
1050146775 9:2576500-2576522 GTGGGGGTGGGGGATGGGGTAGG + Intergenic
1050368466 9:4896221-4896243 GTGGGGTGGGGGACTAGGGGAGG - Intergenic
1050552782 9:6762240-6762262 GTGGGGTGGGGGGCTGGGGGAGG - Intronic
1051079575 9:13279266-13279288 GTGGGGGCGGGGATGGGGGTGGG - Intronic
1051206343 9:14693172-14693194 GTGCGGATGGGGATGGGGGTGGG + Intronic
1051238924 9:15031190-15031212 GTGGGGTGGGGGGCTGGGGAGGG + Intergenic
1051295671 9:15593014-15593036 GTGGGGTGGGGGAGTGGGGAGGG - Intronic
1051425893 9:16931046-16931068 GCGGGGAGGGGGTCTGAGGTGGG + Intergenic
1051463934 9:17354773-17354795 GTGTGGAAGGGGACTGGAGCGGG - Intronic
1051846743 9:21459599-21459621 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
1051926099 9:22328635-22328657 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1052081790 9:24214934-24214956 GTGGGGAGGGGGAAGGGGGGAGG + Intergenic
1052212945 9:25929436-25929458 GTGGGGTGGGGGAGTGGGGAGGG - Intergenic
1052261533 9:26522195-26522217 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1052450900 9:28629914-28629936 GTGGGGTCGGGGGATGGGGGAGG - Intronic
1052568299 9:30186964-30186986 GTGGGGTAGGGGGCTGGGGGAGG + Intergenic
1052800600 9:32963805-32963827 GTGGGGTAGGGGGCTGGGGGAGG + Intergenic
1052807526 9:33025697-33025719 GTGGGGGGGGGGAGTGGGGTTGG + Intronic
1053086542 9:35228478-35228500 GTGGGGTGGGGGACGGGGGGAGG - Intronic
1053116216 9:35505364-35505386 GTGGGGTCGGGGACTAAGGAAGG - Intronic
1053161971 9:35819451-35819473 GTGGGGATGGAGGATGGGGTTGG - Intronic
1053409661 9:37907379-37907401 ATGGGGCCGGGGAGTGGGGCGGG - Intronic
1053866145 9:42438602-42438624 GTGGGGTTGGGGAATGGGGGAGG - Intergenic
1054377136 9:64457953-64457975 GATGGGAGGGGGACCGGGGTTGG + Intergenic
1054719674 9:68592466-68592488 GTGGGGTTGGGGAGTGGGGAGGG - Intergenic
1055006385 9:71512187-71512209 GGGGGGTGGGGGACTGGGGGAGG - Intergenic
1055282975 9:74696157-74696179 GTGGGGTGGGGGGCTGGGGGAGG + Intergenic
1055528198 9:77156401-77156423 GGGGGGTAGGGGACTGGGGAAGG + Intergenic
1056350124 9:85741520-85741542 GAGGGTCCGGGGACTGGGGAAGG + Intronic
1056668611 9:88603320-88603342 GTGGGGTGGGGGGCTGGGGGAGG + Intergenic
1056976642 9:91262700-91262722 GTGGGGTGGGGGCGTGGGGTGGG + Intronic
1057117709 9:92541401-92541423 GTGGGGAGGGGGAAGGGGGGTGG - Intronic
1057186166 9:93058667-93058689 GTGGGGGCGGGGCCTGGGCCTGG - Intronic
1057220134 9:93253101-93253123 ATGGGGATGGGGAAGGGGGTGGG - Intronic
1057274398 9:93668608-93668630 GTGGAGATGGGGACAGAGGTGGG + Intronic
1057455578 9:95207001-95207023 GTGGGGCTGGGGGCTGGGGGTGG - Intronic
1057697438 9:97335320-97335342 GTGGGGTGGGGGAATGGGGGAGG - Intronic
1057763792 9:97898441-97898463 GTGGGGTGGGGGGCTGAGGTAGG - Intergenic
1057875114 9:98747776-98747798 GTGTGGAGGTGGACAGGGGTTGG - Intronic
1057930314 9:99187340-99187362 CTGGGGAGGGGGACTAGGGATGG + Intergenic
1058107274 9:100986844-100986866 GTGGGGTCGGGGGATGGGGGAGG + Intergenic
1058117591 9:101102287-101102309 GTGGGGTCGGGGGATGGGGGAGG - Intronic
1058306928 9:103454916-103454938 GTGGGGTGGGGGGCTGGGGGAGG + Intergenic
1058644271 9:107116156-107116178 GTGGAGACGGTGAGGGGGGTGGG + Intergenic
1058645639 9:107129230-107129252 GTGGGGATGTGGAGTGGCGTTGG - Intergenic
1058912577 9:109534337-109534359 GTGGTGATGGTGACTGGGGCCGG + Intergenic
1058919867 9:109603324-109603346 GTGGGGAAGGGGGTCGGGGTTGG + Intergenic
1059496183 9:114711251-114711273 GTGGGGGCGGGAAGAGGGGTAGG - Intergenic
1059594922 9:115709226-115709248 GTGGGGTGGGGGAATGGGGGAGG + Intergenic
1059691209 9:116687500-116687522 GTGGGGACCGGATCTGGGGGGGG + Intronic
1059742839 9:117169737-117169759 GTGGGGCAGGGGGCTGGTGTGGG + Intronic
1060283272 9:122227961-122227983 GCGAGGAAGGGGAGTGGGGTGGG - Intronic
1060382516 9:123189697-123189719 GTGGGGTGGGGGGCTGGGGGAGG + Intronic
1060479127 9:124007830-124007852 ATGGTGCTGGGGACTGGGGTCGG - Intronic
1060549890 9:124479912-124479934 GTGGGGAAGGGGACAAAGGTGGG + Intergenic
1060551592 9:124488035-124488057 GTGGGGACGGGGTGGGGAGTAGG - Intronic
1060724730 9:125999352-125999374 GGGGGGAAGGGCACTGGGGCTGG + Intergenic
1060732021 9:126044710-126044732 GTGGGGATGGGGTCGGGGCTAGG + Intergenic
1060827157 9:126693851-126693873 CTGGGGCCGGGGCCAGGGGTGGG + Intronic
1060933565 9:127503547-127503569 GAGGGGACGAGGTCTGGGGATGG + Intergenic
1060986991 9:127825580-127825602 GCTGGGGCTGGGACTGGGGTGGG + Intronic
1061002173 9:127908589-127908611 GTGGGGAACAGGGCTGGGGTGGG + Intronic
1061065832 9:128276813-128276835 GTTGGGATGGGGAGTGGGGCCGG - Intronic
1061130655 9:128706084-128706106 GTTGGGACTGGGGCTGGGCTAGG - Intronic
1061187007 9:129060661-129060683 GTGGGGACCAAGCCTGGGGTGGG + Intronic
1061458883 9:130720279-130720301 AAGGGGACAGGGAATGGGGTAGG + Intronic
1061893133 9:133633294-133633316 GTGGGGATGGGAATGGGGGTGGG - Intergenic
1061919865 9:133776755-133776777 GACGGGACTGGGGCTGGGGTCGG + Intronic
1061921193 9:133783460-133783482 GCGTGGCCAGGGACTGGGGTGGG + Intronic
1062022657 9:134326680-134326702 GCGGGGACGGGGCCGGGGGCCGG + Intronic
1062040427 9:134401907-134401929 GAGGGGGTGGGGCCTGGGGTGGG + Intronic
1062126097 9:134863906-134863928 GTGGGGGCGGGGGAAGGGGTGGG - Intergenic
1062127556 9:134871671-134871693 GTGGGGAGGTGGACTGGGATGGG + Intergenic
1062170458 9:135132124-135132146 GTGGGCACGGGGCCTGGGGCCGG + Intergenic
1062263947 9:135678292-135678314 GCTGGGACTGGGGCTGGGGTTGG + Intergenic
1062263958 9:135678316-135678338 GTTGGGACTGGGGCTGGGGCTGG + Intergenic
1062294614 9:135817739-135817761 GTGGGGTGGGGGACAGGGGAGGG + Intronic
1062351563 9:136142194-136142216 GTGGGGACGGGGCCCAGGGCAGG + Intergenic
1062378297 9:136274860-136274882 GTGAGGTCGGGGGCTGGGGCTGG - Intergenic
1062444845 9:136589264-136589286 GTGGGGAGGGGGTCTGGTTTGGG + Intergenic
1062484893 9:136769870-136769892 GTGGGGGCGAGGCCTGGCGTGGG - Intergenic
1062530142 9:136996138-136996160 CTCAGGTCGGGGACTGGGGTGGG - Intronic
1062561938 9:137145596-137145618 ATGGGGGTGGGGACAGGGGTGGG + Intronic
1062572975 9:137194095-137194117 GGGGTGCCGGGGCCTGGGGTAGG - Intronic
1062579361 9:137222595-137222617 GGGGGGCCGGGGACGGGGGAAGG - Intergenic
1062584442 9:137242639-137242661 GGGGGGACTGGGTCTGGGATGGG + Exonic
1203467478 Un_GL000220v1:100811-100833 GTGGGGAGGGGGTGTAGGGTGGG + Intergenic
1203473035 Un_GL000220v1:125175-125197 GTGGGGAGGGGGTGCGGGGTGGG + Intergenic
1185459521 X:328298-328320 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459569 X:328388-328410 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459580 X:328408-328430 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459591 X:328428-328450 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459659 X:328560-328582 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459670 X:328580-328602 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459681 X:328600-328622 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459980 X:329183-329205 GGGGGGACGGGGAGAGGGGGAGG - Intergenic
1185459993 X:329205-329227 GGGGGGACGGGGAGAGGGGGAGG - Intergenic
1185460006 X:329227-329249 GGGGGGACGGGGAGAGGGGGAGG - Intergenic
1185460019 X:329249-329271 GGGGGGACGGGGAGAGGGGGAGG - Intergenic
1185460032 X:329271-329293 GGGGGGACGGGGAGAGGGGGAGG - Intergenic
1185460045 X:329293-329315 GGGGGGACGGGGAGAGGGGGAGG - Intergenic
1185460058 X:329315-329337 GGGGGGACGGGGAGAGGGGGAGG - Intergenic
1185460071 X:329337-329359 GGGGGGACGGGGAGAGGGGGAGG - Intergenic
1185460084 X:329359-329381 GGGGGGACGGGGAGAGGGGGAGG - Intergenic
1185519046 X:724676-724698 GTGGGGACGGTCACTGCAGTTGG - Intergenic
1185987221 X:4848392-4848414 GGGGGGTCGGGGGCTGGGGGAGG + Intergenic
1186141880 X:6584157-6584179 GTGGGGTCGGGGGATGGGGGAGG - Intergenic
1187045903 X:15647231-15647253 GTGGGGCCGGTGGCTGGTGTGGG - Intronic
1187051881 X:15703532-15703554 GTGGGGCCGGTGGCTGGTGTGGG - Intronic
1187314003 X:18174861-18174883 TTGGGGACGGGGGTTGGGGAGGG + Intronic
1187403660 X:18984147-18984169 GCGGGGGCGGGGACGGGGGCTGG + Exonic
1187776790 X:22769169-22769191 GTGGGTACGGGGACAGGGGACGG + Intergenic
1187807348 X:23135503-23135525 ATGGGGTAGGGGACTTGGGTGGG + Intergenic
1187856944 X:23646044-23646066 GTGGGGTGGGGGAATGGGGGAGG - Intergenic
1187966825 X:24620323-24620345 GAGGGGATGGGGACAGGGGAGGG - Intronic
1188022453 X:25173736-25173758 GTGGGGTAGGGGAGTGGGATGGG + Intergenic
1188297095 X:28462698-28462720 ATGGGGATGGGGACTAGGGGAGG + Intergenic
1188354800 X:29177736-29177758 ATGGGGTCGGGGGCTGGGGGAGG - Intronic
1188596591 X:31908567-31908589 GTGGGGTGGGGGGCTGGGGAGGG + Intronic
1189068941 X:37844338-37844360 CTGGGGAATGGGACTGGGGATGG - Intronic
1189241536 X:39528371-39528393 GTGGGGAGGGGTAATGGGTTAGG - Intergenic
1189260285 X:39673616-39673638 GTGGGGACGAGGGCTGGGCTGGG - Intergenic
1189369764 X:40418380-40418402 GTGGGGGCGGGGAAGGGGATGGG + Intergenic
1189777282 X:44481970-44481992 GGGGGGTCGGGGGCTGGGGGAGG - Intergenic
1189893066 X:45625780-45625802 GTGGGGAGGGGGGCTGGGGGAGG - Intergenic
1189992345 X:46607265-46607287 GTTGGGATTGGGATTGGGGTTGG - Intronic
1190083737 X:47377222-47377244 GTGGGGTGGGGGGCAGGGGTAGG - Intronic
1190910168 X:54764401-54764423 GTGGGGAGGGGGAAGGGGGGAGG - Intronic
1191065939 X:56348018-56348040 GGGGGGAGGGGGTCTGGGGGAGG - Intergenic
1191193544 X:57693952-57693974 GTGGGGTTGGGGTCTGGGGGAGG - Intergenic
1191657319 X:63612507-63612529 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
1191658383 X:63624381-63624403 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
1191669787 X:63738572-63738594 GTGGGGCAGGGAAGTGGGGTGGG - Intronic
1191857048 X:65635501-65635523 CAGGGGACGGAGACTGGGGTGGG + Intronic
1192028672 X:67485099-67485121 GTGGGGTAGGGGCCTGGGGGAGG + Intergenic
1192180264 X:68911952-68911974 ATGGGGAAAGGGTCTGGGGTTGG - Intergenic
1192264850 X:69531098-69531120 CTGGGGACGGGGACAGGGTGGGG - Exonic
1192384148 X:70648262-70648284 GTGGGATGGGGGACTGGGGAGGG + Intronic
1192435513 X:71141343-71141365 GCTGGGACTGGGGCTGGGGTTGG - Exonic
1192475803 X:71441809-71441831 GTGGGGTGGGGGGCTGGGGGAGG - Intronic
1192553230 X:72070160-72070182 GCGGGTATGGGGGCTGGGGTGGG - Intergenic
1192610071 X:72559049-72559071 GTGGGGAGGGGGAGGGGGGGAGG - Intronic
1192668390 X:73112010-73112032 GTGGGGTCGGGGAAGGGGGGAGG + Intergenic
1192693278 X:73386850-73386872 GTGGGGTCGGGGAAGGGGGGAGG + Intergenic
1192825084 X:74687472-74687494 GTGGGGTCGGGGGATGGGGGAGG - Intergenic
1192902081 X:75510718-75510740 GTGGGGTCGGGGGATGGGGGAGG - Intronic
1193008697 X:76650471-76650493 GTGGGGTGGGGGAGTGGGGAAGG - Intergenic
1193181713 X:78466365-78466387 GTGGGGTGGGGGAAGGGGGTAGG - Intergenic
1193253371 X:79319330-79319352 GTGTGGACAGGGACTGGTGGTGG + Intergenic
1193432941 X:81434327-81434349 GTGGGGAAGGGGGCTTGGGTTGG - Intergenic
1193612418 X:83648863-83648885 GTGGGGTAGGGGACAGGGGAGGG - Intergenic
1193815542 X:86101308-86101330 GTGGGGGAGGGGGCAGGGGTGGG - Intergenic
1193816684 X:86113460-86113482 GTGGGGTCGGGGGATGGGGGAGG - Intergenic
1195100625 X:101551359-101551381 CCGGGGGCGGGGACGGGGGTAGG + Intronic
1196011403 X:110891714-110891736 GGGGGGTCGGGGGCTGGGGGAGG + Intergenic
1196011992 X:110898536-110898558 GTGGGGTGGGGGGCTGGGGGAGG - Intergenic
1196350043 X:114718132-114718154 GTGGGCTTGGGGACTGAGGTGGG - Intronic
1196761827 X:119207762-119207784 GTGTGGAAGGGGACTGGAGGGGG + Intergenic
1196775358 X:119332949-119332971 GTGTGAAAGGGGACTGGAGTAGG - Intergenic
1197147319 X:123184744-123184766 CTGGGAACTGGGACTGGGGCCGG + Intronic
1197647981 X:129037998-129038020 GTGGGGGTGGGGACGGAGGTGGG + Intergenic
1197647985 X:129038004-129038026 GTGGGGACGGAGGTGGGGGTGGG + Intergenic
1197753689 X:129981348-129981370 GGGTGGACGGCGACGGGGGTGGG + Intronic
1197754264 X:129983575-129983597 GTGGCGGCGGGGCCTGGGTTCGG + Intronic
1197866364 X:131022943-131022965 AAGGGGACTGGGAGTGGGGTGGG - Intergenic
1198027361 X:132720149-132720171 GTGGGGACGGCCCCTGGAGTAGG + Intronic
1198233589 X:134716097-134716119 GGGGAGGAGGGGACTGGGGTAGG - Intronic
1198241964 X:134796337-134796359 TTGGGGACGGGGGCGGGGGCTGG + Intronic
1198278145 X:135116949-135116971 CTCGGGACGGGGAAGGGGGTGGG - Intergenic
1198292817 X:135255567-135255589 CTCGGGACGGGGAAGGGGGTGGG + Intronic
1198780708 X:140232699-140232721 GTTGGGAAGGGTACTGGGGAGGG - Intergenic
1199034267 X:143032462-143032484 GTTGGGAGGGGGACTGAGATAGG + Intronic
1199724763 X:150568926-150568948 GTCGGGACGGGGGTAGGGGTTGG + Intronic
1199832922 X:151562775-151562797 GGGGGGGCGGGGAGTGGGGCTGG + Intergenic
1199834271 X:151573093-151573115 GTGGGGGTGGGGGCTGGGGGTGG + Intronic
1200084033 X:153594177-153594199 CTGGGGACGGGGACTCTGGCCGG + Intronic
1200204841 X:154308395-154308417 GAGGTGATGGGGGCTGGGGTGGG + Intronic
1200774102 Y:7154245-7154267 GTGGGGACGGGGGAGGGGGGAGG - Intergenic
1200829955 Y:7679990-7680012 GTGGGCAGGGGGTCAGGGGTAGG - Intergenic
1201075198 Y:10181445-10181467 GTGGGAAGGGGGTATGGGGTGGG + Intergenic
1201147376 Y:11072630-11072652 GTGGGAGCGTGGGCTGGGGTAGG - Intergenic
1201305669 Y:12548352-12548374 GTGGGGTGGGGGGCTAGGGTAGG - Intergenic
1201740901 Y:17323939-17323961 GTGGGGTGGGGGAGTGGGGAGGG + Intergenic
1202041447 Y:20689623-20689645 GTGGGGTAGGGGACAGGGGGAGG - Intergenic
1202063637 Y:20914445-20914467 GTGGGGTCGGGGGAGGGGGTGGG - Intergenic