ID: 1175916734

View in Genome Browser
Species Human (GRCh38)
Location 20:62429507-62429529
Sequence GGTCCCTGGCCAATGAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175916734_1175916750 30 Left 1175916734 20:62429507-62429529 CCCTGGCTCATTGGCCAGGGACC No data
Right 1175916750 20:62429560-62429582 CAGGACAGAGGTGCCCGTGCAGG No data
1175916734_1175916746 11 Left 1175916734 20:62429507-62429529 CCCTGGCTCATTGGCCAGGGACC No data
Right 1175916746 20:62429541-62429563 TGTCCAGGCCTTGGTGATACAGG No data
1175916734_1175916737 -4 Left 1175916734 20:62429507-62429529 CCCTGGCTCATTGGCCAGGGACC No data
Right 1175916737 20:62429526-62429548 GACCCCACCCCGCCATGTCCAGG No data
1175916734_1175916748 18 Left 1175916734 20:62429507-62429529 CCCTGGCTCATTGGCCAGGGACC No data
Right 1175916748 20:62429548-62429570 GCCTTGGTGATACAGGACAGAGG No data
1175916734_1175916741 2 Left 1175916734 20:62429507-62429529 CCCTGGCTCATTGGCCAGGGACC No data
Right 1175916741 20:62429532-62429554 ACCCCGCCATGTCCAGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175916734 Original CRISPR GGTCCCTGGCCAATGAGCCA GGG (reversed) Intergenic
No off target data available for this crispr