ID: 1175921512

View in Genome Browser
Species Human (GRCh38)
Location 20:62452530-62452552
Sequence CTGAGGAGAAGGACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175921512_1175921521 10 Left 1175921512 20:62452530-62452552 CCCTCCTCAGTCCTTCTCCTCAG No data
Right 1175921521 20:62452563-62452585 GCCCAGGTTGTGTGCCTGGGAGG No data
1175921512_1175921520 7 Left 1175921512 20:62452530-62452552 CCCTCCTCAGTCCTTCTCCTCAG No data
Right 1175921520 20:62452560-62452582 TGTGCCCAGGTTGTGTGCCTGGG No data
1175921512_1175921519 6 Left 1175921512 20:62452530-62452552 CCCTCCTCAGTCCTTCTCCTCAG No data
Right 1175921519 20:62452559-62452581 CTGTGCCCAGGTTGTGTGCCTGG No data
1175921512_1175921517 -6 Left 1175921512 20:62452530-62452552 CCCTCCTCAGTCCTTCTCCTCAG No data
Right 1175921517 20:62452547-62452569 CCTCAGCCTTCGCTGTGCCCAGG No data
1175921512_1175921524 13 Left 1175921512 20:62452530-62452552 CCCTCCTCAGTCCTTCTCCTCAG No data
Right 1175921524 20:62452566-62452588 CAGGTTGTGTGCCTGGGAGGTGG No data
1175921512_1175921525 14 Left 1175921512 20:62452530-62452552 CCCTCCTCAGTCCTTCTCCTCAG No data
Right 1175921525 20:62452567-62452589 AGGTTGTGTGCCTGGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175921512 Original CRISPR CTGAGGAGAAGGACTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr