ID: 1175922035

View in Genome Browser
Species Human (GRCh38)
Location 20:62454719-62454741
Sequence TCCGACCCGGCCCTGAGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175922032_1175922035 -7 Left 1175922032 20:62454703-62454725 CCTGGACTCAAGGGCCTCCGACC No data
Right 1175922035 20:62454719-62454741 TCCGACCCGGCCCTGAGTTTTGG No data
1175922031_1175922035 -1 Left 1175922031 20:62454697-62454719 CCTGGACCTGGACTCAAGGGCCT No data
Right 1175922035 20:62454719-62454741 TCCGACCCGGCCCTGAGTTTTGG No data
1175922024_1175922035 21 Left 1175922024 20:62454675-62454697 CCAGCGGACCTCCAGACTCTGTC No data
Right 1175922035 20:62454719-62454741 TCCGACCCGGCCCTGAGTTTTGG No data
1175922022_1175922035 30 Left 1175922022 20:62454666-62454688 CCTGGCCTGCCAGCGGACCTCCA No data
Right 1175922035 20:62454719-62454741 TCCGACCCGGCCCTGAGTTTTGG No data
1175922023_1175922035 25 Left 1175922023 20:62454671-62454693 CCTGCCAGCGGACCTCCAGACTC No data
Right 1175922035 20:62454719-62454741 TCCGACCCGGCCCTGAGTTTTGG No data
1175922026_1175922035 13 Left 1175922026 20:62454683-62454705 CCTCCAGACTCTGTCCTGGACCT No data
Right 1175922035 20:62454719-62454741 TCCGACCCGGCCCTGAGTTTTGG No data
1175922028_1175922035 10 Left 1175922028 20:62454686-62454708 CCAGACTCTGTCCTGGACCTGGA No data
Right 1175922035 20:62454719-62454741 TCCGACCCGGCCCTGAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175922035 Original CRISPR TCCGACCCGGCCCTGAGTTT TGG Intergenic
No off target data available for this crispr