ID: 1175924354

View in Genome Browser
Species Human (GRCh38)
Location 20:62464748-62464770
Sequence CTGCTGTGCTGGAGCAAAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 284}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175924349_1175924354 9 Left 1175924349 20:62464716-62464738 CCCAGTCTCTGGGTTGGGGGGCC 0: 1
1: 0
2: 2
3: 12
4: 170
Right 1175924354 20:62464748-62464770 CTGCTGTGCTGGAGCAAAGCAGG 0: 1
1: 0
2: 2
3: 26
4: 284
1175924350_1175924354 8 Left 1175924350 20:62464717-62464739 CCAGTCTCTGGGTTGGGGGGCCT 0: 1
1: 0
2: 0
3: 8
4: 206
Right 1175924354 20:62464748-62464770 CTGCTGTGCTGGAGCAAAGCAGG 0: 1
1: 0
2: 2
3: 26
4: 284
1175924343_1175924354 17 Left 1175924343 20:62464708-62464730 CCAGCAGACCCAGTCTCTGGGTT 0: 1
1: 0
2: 3
3: 33
4: 283
Right 1175924354 20:62464748-62464770 CTGCTGTGCTGGAGCAAAGCAGG 0: 1
1: 0
2: 2
3: 26
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175924354 Original CRISPR CTGCTGTGCTGGAGCAAAGC AGG Exonic
900013465 1:134411-134433 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
900043533 1:490394-490416 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
900064971 1:725397-725419 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901044061 1:6385170-6385192 CAGCTGTGCTGGCTCACAGCTGG - Intronic
902268143 1:15283644-15283666 CTGCTGTGCCAGAGGAGAGCTGG - Intronic
903192629 1:21665498-21665520 CCATTGTGCTGGTGCAAAGCAGG + Intronic
906778735 1:48553221-48553243 CTGCTGAGCTGGGGCCCAGCTGG - Intronic
907334102 1:53689224-53689246 GTGCTGTGATGGAGCGAAGCAGG + Intronic
907342649 1:53747925-53747947 CTGCTGTGGTGGTGGAGAGCAGG - Intergenic
908787859 1:67753063-67753085 CTGCTGTTGTGGAGCTAAGTAGG - Intronic
912202431 1:107473242-107473264 CTGCTATGCTTGAGCAATGCTGG - Intronic
913347417 1:117821977-117821999 TGGCTGTGCTGCAGCCAAGCAGG - Intergenic
914286790 1:146234225-146234247 CTGCTATGCTTGAGATAAGCAGG + Intergenic
914547821 1:148684965-148684987 CTGCTATGCTTGAGATAAGCAGG + Intergenic
914676802 1:149912341-149912363 CTGCTTTGAGGGATCAAAGCAGG - Intronic
916931902 1:169587051-169587073 CTGCTATGCTGCAGCTTAGCTGG - Intergenic
917732256 1:177886482-177886504 CTGCTGTTCTGGGGCAAACTTGG - Intergenic
920278262 1:204824584-204824606 ATGCTGAGCTCTAGCAAAGCAGG - Intergenic
920697788 1:208194853-208194875 CACCTTTTCTGGAGCAAAGCTGG + Intronic
920736984 1:208541743-208541765 AGGCTGTGCCTGAGCAAAGCTGG + Intergenic
920869795 1:209784521-209784543 CTGCGGGACTGGAGCAGAGCGGG - Exonic
922261905 1:223950904-223950926 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
922514556 1:226197271-226197293 CTGCAGAGCTGGGGCAAACCTGG + Intergenic
922735169 1:227974836-227974858 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
924343075 1:243053081-243053103 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
924934823 1:248758890-248758912 CTGCTGAGCTGAGGCAAACCTGG + Intergenic
1063175169 10:3544265-3544287 CTGCTGTGCAGGAACCATGCAGG - Intergenic
1063676589 10:8145989-8146011 CTGCTGTCCTGAAGAAAAGTGGG + Intergenic
1065088701 10:22207595-22207617 CTGCTGGCCTGGAGCTCAGCTGG + Intergenic
1065796485 10:29312792-29312814 CTGTTCTGCTGGGGCAGAGCTGG + Intronic
1066209610 10:33224025-33224047 CTGCACTCCTGGAGCAAAGTGGG + Intronic
1070312033 10:75280968-75280990 CTGCCTGGCTGGAGCAAGGCAGG + Intergenic
1071453876 10:85826755-85826777 CTGCTGTGCTGGAGGAACTGAGG - Intronic
1072727967 10:97826310-97826332 CTGCTGTGCTGGAGGCAATCAGG + Intergenic
1073458007 10:103649286-103649308 ATGCTGTGGATGAGCAAAGCCGG + Intronic
1074292824 10:112153361-112153383 CTGCTGTGTTGATGCAGAGCTGG + Exonic
1075710182 10:124526646-124526668 CTGCTGAGCTGGACATAAGCAGG + Intronic
1076472268 10:130727518-130727540 CTGCTGTGTTGGCCCAGAGCAGG + Intergenic
1076969805 11:126625-126647 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1077479836 11:2808375-2808397 TTACTGTGCAGGAGCAAAGCAGG + Intronic
1078576773 11:12509488-12509510 CAGCTGTGCTGGAGAAAAGATGG - Intronic
1078804145 11:14679917-14679939 CTACAGTGATGGAGCAAAGGAGG - Intronic
1079224742 11:18595499-18595521 CAGCTGGGCTGGAGCACATCTGG + Intergenic
1080644406 11:34177884-34177906 CTGCAGTTCAGGAGTAAAGCTGG - Intronic
1085374680 11:76048910-76048932 TGGCTGTGCTGCAGCCAAGCAGG + Intronic
1086418540 11:86614460-86614482 CTGCTCAGATGGAGCAAAGAGGG - Intronic
1086972484 11:93098551-93098573 TTGTTTTTCTGGAGCAAAGCAGG + Intergenic
1087812286 11:102621317-102621339 TGGCTGTGCTGCAGCCAAGCGGG - Intronic
1089489036 11:118870214-118870236 CTGCTGGGCAGCAGCACAGCCGG + Intergenic
1090259965 11:125312475-125312497 CTGCTCTCCTGGGGCACAGCAGG - Intronic
1091451557 12:575429-575451 CTGTAGTCCTGGAGCAGAGCAGG - Intronic
1091530657 12:1352034-1352056 ATGCTGTGCTGGGTTAAAGCTGG - Intronic
1092115189 12:5996067-5996089 CTGCAGCCCTGGAGCAAGGCAGG - Exonic
1093454234 12:19349165-19349187 CTGCTGTACTGGAGCAAACATGG + Intronic
1094753177 12:33438164-33438186 GTGCTGGGAGGGAGCAAAGCGGG - Intronic
1096452095 12:51751929-51751951 CTGATTTGCTGGAGCAATGCAGG - Intronic
1096608833 12:52787874-52787896 CAGCTGTGCTTTAGAAAAGCAGG - Intergenic
1096954907 12:55516362-55516384 CTACTGTGCTGTAGCTAAGCTGG - Intergenic
1097101894 12:56595736-56595758 CTGAGTTGCTGGAGCAAAGGGGG - Exonic
1099610037 12:84856941-84856963 CTACTCTTCTGCAGCAAAGCTGG + Intergenic
1100819651 12:98419591-98419613 TGGCTGTGCTGCAGCCAAGCAGG + Intergenic
1100820347 12:98423641-98423663 TGGCTGTGCTGTAGCCAAGCAGG + Intergenic
1101966990 12:109288205-109288227 CTGCTGGGCTGGAGGAATGGTGG + Intronic
1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG + Intergenic
1110162305 13:72393114-72393136 CAGCTGTGGTGGAGCAGAGATGG - Intergenic
1113809566 13:113130083-113130105 CTGCTGTGCAGGAGCAGTACTGG - Intronic
1116358543 14:43963108-43963130 CTGCTGTGAAGCAGCAAAGGAGG + Intergenic
1116373190 14:44162374-44162396 TGGCTGTGCTGCAGCCAAGCAGG + Intergenic
1118616422 14:67577325-67577347 ATGCTGTGCTACAGCAAAGACGG + Exonic
1118641413 14:67796143-67796165 CTGCTGTTCTGTAGCACTGCAGG + Intronic
1118890949 14:69908488-69908510 CTGCTGTGCTGGAGGGTAGTGGG + Intronic
1119315411 14:73690252-73690274 CTGCTATGTTGGATTAAAGCTGG + Intronic
1122154178 14:99740505-99740527 CTGCAGAGCAGGAGCACAGCAGG + Intronic
1122295436 14:100703184-100703206 CTGCTGTGCTAGCCCAATGCCGG + Intergenic
1122961305 14:105094686-105094708 CCACTGTGGTGGAGCACAGCGGG - Intergenic
1126416695 15:48425200-48425222 CTCCTGTGCTGGAGGGAAGGAGG - Intronic
1127805121 15:62512089-62512111 CTGCTGTCCTGGGTCACAGCTGG + Intronic
1129272176 15:74424825-74424847 CTGCTGGGCTGGAGAACAGCTGG - Intronic
1130652617 15:85770680-85770702 CTGCTTTGCTGAGGCAAATCTGG - Intronic
1130739967 15:86588639-86588661 CCTCTGTGATGGAGCACAGCAGG + Intronic
1131884091 15:96891029-96891051 CTGCTGTGATGGAAAAAAGGAGG + Intergenic
1132632787 16:927970-927992 CTGCTGTGCTCTTGCCAAGCGGG - Intronic
1134686002 16:16159248-16159270 CTTCTGAGCTTGAGGAAAGCAGG - Intronic
1135232412 16:20721530-20721552 CTGTAGTGCTGGAGCAGAGTAGG + Intronic
1138755959 16:59485596-59485618 CTGCCGTAATGCAGCAAAGCTGG - Intergenic
1140778483 16:78272571-78272593 CTGCTGTGGTGGAATAAAGATGG - Intronic
1141372993 16:83504520-83504542 CTGCTGTGAGGGTGGAAAGCAGG + Intronic
1142450874 16:90172507-90172529 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1142456692 17:61184-61206 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1142698052 17:1644304-1644326 CTGCTGGGCTGGAGGAGAGCTGG + Intronic
1143620275 17:8076468-8076490 CTGGTGTGCTGGCCCAGAGCAGG - Intronic
1144608784 17:16690406-16690428 CTCCTGGGGTGGAGAAAAGCGGG + Exonic
1144904032 17:18625420-18625442 CTCCTGGGGTGGAGAAAAGCGGG - Intergenic
1145128551 17:20321322-20321344 CTCCTGGGGTGGAGAAAAGCGGG + Intergenic
1145196072 17:20895993-20896015 CTCCTGGGGTGGAGAAAAGCGGG - Exonic
1149003815 17:51783898-51783920 CAGCTGTGTAGGAGCAAGGCTGG + Intronic
1150570484 17:66382119-66382141 CTGCTTTGGTGGAGAAAACCTGG + Intronic
1150763384 17:67983251-67983273 CTGCTGTCCTGGAGAAATCCAGG - Intronic
1151210226 17:72538928-72538950 CTGCTGCGCTGGAGAGAAACTGG + Intergenic
1151315433 17:73318990-73319012 CAGCTCTGCTGGAGAACAGCCGG + Intergenic
1151509241 17:74548113-74548135 CTGCTGTGCAGGAGCTGAGGGGG - Intergenic
1151817060 17:76476573-76476595 CTGCTGTCTGGGAGCAAGGCTGG + Intronic
1152224414 17:79086035-79086057 CAGCTGAGCTGGAGCAGAGCAGG - Exonic
1152313576 17:79566443-79566465 ATGCGGTGCTGGGCCAAAGCTGG - Intergenic
1152371641 17:79892042-79892064 CTGCTTTCCTGGAGCAAATGTGG + Intergenic
1152687423 17:81701488-81701510 CATCTGTGCAGGAGGAAAGCAGG - Exonic
1152739440 17:82012564-82012586 CTGCTGTGCTGGGGCCAAGGCGG + Intronic
1153338384 18:3948472-3948494 CTGCAGTGCTGGAGAGAGGCAGG - Intronic
1155367789 18:25066153-25066175 CTGTTGGGCTGGAGCAAAAAAGG - Intronic
1156189517 18:34702124-34702146 CTGGTGTGATGGAGGAATGCAGG - Intronic
1156819330 18:41353657-41353679 GAGCTGCGCTGGTGCAAAGCTGG + Intergenic
1157630813 18:49093387-49093409 CTTGTGTGCTGGATCAGAGCAGG + Intronic
1157676587 18:49573102-49573124 AGGCTGTGCTGGAGGAATGCAGG - Intronic
1158409902 18:57196558-57196580 CTACTTAGGTGGAGCAAAGCTGG + Intergenic
1158694364 18:59690464-59690486 CTGCTGAGCAGGAGAACAGCAGG + Intronic
1159388550 18:67758869-67758891 CTGCTATGTTGGAGCAGAGAAGG - Intergenic
1159460222 18:68714714-68714736 CCGCTGTGCCGGACCAATGCTGG - Intronic
1160201848 18:76802276-76802298 GGGCTGGGCTGGAGCAGAGCCGG + Intronic
1160646608 19:196543-196565 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1162402490 19:10454413-10454435 CTGCTGAGCTGGGGAAAAGGGGG - Intronic
1162522424 19:11189663-11189685 CTGCCTTGCTTGAGCCAAGCTGG - Intronic
1162573927 19:11487664-11487686 CTGCTGGGTTGGAGCACAGCGGG + Exonic
1163548617 19:17952914-17952936 CAGCTGGGCTGGGGCAGAGCAGG + Intronic
1164918760 19:32072886-32072908 CTGCTGTGCTGGTGGGAAGCAGG - Intergenic
1166743505 19:45128861-45128883 CTGCTGTCCTGGAGCAGTGAGGG - Intronic
1166762706 19:45234822-45234844 CAGCACTGCGGGAGCAAAGCGGG + Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
926095567 2:10079338-10079360 CAGCTCTGCTGGAGCGAAGACGG + Intronic
926701715 2:15808319-15808341 CAGCTATGCTGAAGCACAGCGGG + Intergenic
928695220 2:33842136-33842158 CTGCTGTGATGATGCAAAGTAGG - Intergenic
929085203 2:38161161-38161183 CTTCAGTTCTGGAGGAAAGCTGG + Intergenic
929759944 2:44798463-44798485 ATGCGGGGCTGGAGGAAAGCAGG - Intergenic
930097046 2:47572685-47572707 CTGCTGTGCTCCAGAAAAGAGGG - Intergenic
930243235 2:48957453-48957475 TTGTTTTTCTGGAGCAAAGCAGG + Intergenic
930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG + Intergenic
930947425 2:57092292-57092314 CTGTTGTACTGCAGCTAAGCTGG + Intergenic
931406849 2:61987850-61987872 CTGTTCTGCTGTAGCTAAGCTGG + Intronic
932735215 2:74249641-74249663 CTGCTGTGCTGGGGAAGGGCAGG + Intronic
937543496 2:122988487-122988509 CTGCTGTGATGGGGCCAGGCTGG + Intergenic
938068213 2:128293078-128293100 CTGGTGTGGCGGAGCAGAGCAGG - Intronic
938218890 2:129548746-129548768 ATGCTGGGCTGGAGGAAACCAGG - Intergenic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
947316616 2:228866159-228866181 CTCCTGTCATGGAGCAAAGTTGG + Intronic
948190718 2:236056312-236056334 CAGCTCTGCGGTAGCAAAGCCGG - Intronic
948336412 2:237210909-237210931 CTGCTGAGCTGGAGCGAGCCTGG + Intergenic
948385310 2:237577218-237577240 CTGCTGTGGAAGAGCAGAGCAGG + Intronic
948636509 2:239341263-239341285 TGGCTGTGCGGGAGCAAAGGCGG - Intronic
948829211 2:240589588-240589610 CTGCTGTGTTGGGGGAAGGCAGG + Intronic
1170831830 20:19849466-19849488 CTGCTGAGCAGGAGCAGAGTCGG - Intergenic
1171191369 20:23161833-23161855 CTGTTGGGCTGGTGCATAGCAGG + Intergenic
1171494445 20:25545684-25545706 ATGCTGTGCTAGAGTCAAGCTGG - Intronic
1172141791 20:32727684-32727706 GTGCTGTGGTGCAGCACAGCTGG - Intronic
1172662955 20:36579951-36579973 CTGCTTTCCTGGAGCAGAGGCGG + Intronic
1173028080 20:39327944-39327966 CTGGTGTGGTGGAGTAAAACTGG - Intergenic
1173645396 20:44629954-44629976 CTTGTGAGCTGGAGCAGAGCCGG - Intronic
1174087837 20:48021725-48021747 CTGCTGGGCAGGAGTAAGGCAGG + Intergenic
1174128205 20:48324115-48324137 CTGCTAGGCAGGAGTAAAGCAGG - Intergenic
1175259152 20:57663900-57663922 ATGCTGTGCGGGAGGAAGGCTGG + Intronic
1175288997 20:57860720-57860742 TTGCTGGGCTGCAGCACAGCTGG + Intergenic
1175496144 20:59415650-59415672 CTACTGTTCTAGACCAAAGCAGG + Intergenic
1175871291 20:62210663-62210685 CTGCTGAGCTGCAGCCAGGCAGG + Intergenic
1175924354 20:62464748-62464770 CTGCTGTGCTGGAGCAAAGCAGG + Exonic
1175971776 20:62690020-62690042 CTGCCGCGCAGGCGCAAAGCAGG - Intergenic
1176278898 20:64289679-64289701 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1178930801 21:36817025-36817047 CTGCTGTACTGTAGCCAGGCTGG - Intronic
1178970046 21:37166232-37166254 CTGGTGTACTGGGGCAAACCTGG - Exonic
1179999996 21:44991234-44991256 CAGCTGTGCTGGGGCAAGTCTGG + Intergenic
1180007454 21:45029423-45029445 CTGGGGTGCTGGAGGCAAGCGGG + Intergenic
1184243378 22:43223150-43223172 CAGCTGTCCTGCAGCAAGGCAGG - Exonic
1184778375 22:46634465-46634487 CAGCTGTGCAGGAGCAAGGGTGG + Intronic
1184891258 22:47380885-47380907 ATGCTGACCTGGAGCAAGGCAGG - Intergenic
1185388342 22:50546727-50546749 CTCCTGGGCAGGAGCGAAGCAGG + Intergenic
951837171 3:26996267-26996289 TGGCTGTGCTGCAGCGAAGCAGG - Intergenic
952277355 3:31890320-31890342 CTGCTGTGATTTAGGAAAGCTGG - Intronic
952539997 3:34357732-34357754 GTGCAGTGCTGGAACAAGGCAGG - Intergenic
953182391 3:40608213-40608235 CTGCTGTGCTCCAGCCAGGCTGG - Intergenic
953939712 3:47082448-47082470 CTCCTGTGCTGTCACAAAGCAGG + Intronic
955347167 3:58169772-58169794 CTGGTGGACTGCAGCAAAGCTGG + Exonic
955691325 3:61593162-61593184 GTGCAGTGCTGGAGCAAGTCAGG + Intronic
956223039 3:66924014-66924036 CTGTTGTACTGCAGCTAAGCTGG - Intergenic
956308627 3:67854206-67854228 CTGCTGTGGTGGTGCAACCCTGG + Intergenic
956678156 3:71754131-71754153 CTGCTGTGCGTGAGCCTAGCGGG + Exonic
959934546 3:112015402-112015424 GGGCTGTGCTGGAGCCCAGCTGG + Intergenic
960534742 3:118803332-118803354 TGGCTGTGCTGCAGCCAAGCAGG - Intergenic
960704495 3:120468988-120469010 CTGCTGAGCTGAAGCCAGGCTGG - Intergenic
960705595 3:120477823-120477845 CTGCTGAGCTGAAGCCAGGCTGG + Intergenic
961723413 3:128910415-128910437 CCGCTGTGCTGGAGGGAGGCGGG + Intronic
962290885 3:134135404-134135426 CTGCTCTGCTGGAGGCCAGCCGG - Intronic
966808479 3:183824606-183824628 CGGCTGTCCAGGAGCAGAGCTGG + Intronic
968371073 3:198222979-198223001 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
969149747 4:5159142-5159164 CTGCTTGGCTGGAGCACGGCTGG + Intronic
969304833 4:6319641-6319663 CTGCTGTGCTGGAGGTCACCCGG - Intergenic
969870950 4:10104448-10104470 GTGCTGTGCAGGAGCAGAGCAGG + Intronic
969965523 4:10990551-10990573 CAGCAGAGGTGGAGCAAAGCTGG + Intergenic
972225683 4:37008434-37008456 TGGCTGTGCTGCAGCCAAGCAGG - Intergenic
973763296 4:54140236-54140258 CTACTCTACTGCAGCAAAGCTGG - Intronic
975640394 4:76494484-76494506 CTGCTGAGCTTGAGCAATGGCGG + Intronic
976205025 4:82616442-82616464 CTGCTGTTCTGAATAAAAGCAGG - Intergenic
976677788 4:87722644-87722666 ATGTTGTGCTGTACCAAAGCAGG + Intergenic
977293340 4:95186882-95186904 CTGCTGTGCCTGAGCTCAGCAGG + Intronic
979259757 4:118635463-118635485 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
982361500 4:154524013-154524035 CTGCTCTGCTGGAGCCCAGATGG + Intergenic
982688469 4:158521280-158521302 TGGATGTCCTGGAGCAAAGCTGG - Intronic
983367589 4:166814468-166814490 CAGCTCTGCTAGAACAAAGCAGG + Intronic
985578072 5:682863-682885 CAGCAGTGCTGGGTCAAAGCTGG + Intronic
986269547 5:6218731-6218753 CTGCTGTGCTGGAGTGGAGGAGG + Intergenic
987466402 5:18277003-18277025 CAGCTGGGCTAGAACAAAGCTGG + Intergenic
988335264 5:29899593-29899615 CAGCTCTGCTAGTGCAAAGCAGG + Intergenic
989342184 5:40388410-40388432 CAGCTGGACTGGAGCAAAGTAGG - Intergenic
989815240 5:45728809-45728831 CTGCTGTGCTAGATCAAATCCGG + Intergenic
993192193 5:84696628-84696650 CTGCTGTACTGCAGCTGAGCTGG - Intergenic
993399559 5:87431880-87431902 CTTCAGTGCTGGATCAAAGGTGG + Intergenic
997717571 5:136053389-136053411 CTGCTGTGCATGGGCAAAGAGGG + Intronic
999063444 5:148659600-148659622 CTGCTGTGCTGAAGCTATGCTGG + Intronic
999069184 5:148725638-148725660 CTGCTCTGCTGTAGAAAACCGGG + Intergenic
999330788 5:150672179-150672201 CTCCTGTGCTGGAGCAACTGTGG + Intronic
1001189879 5:169620049-169620071 CTGGTGTGCTGGAGCCAAGATGG + Intergenic
1001807533 5:174600526-174600548 CAGCTGTGATGTGGCAAAGCTGG - Intergenic
1001965731 5:175908645-175908667 CTGCTGTGCTGGGGCAGGGCTGG + Intergenic
1002251214 5:177930551-177930573 CTGCTGTGCTGGGGCAGGGCTGG - Intergenic
1002451282 5:179320196-179320218 CTGCTGCCCAGGAGCACAGCAGG - Intronic
1002730310 5:181328535-181328557 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1002754220 6:145569-145591 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1003034897 6:2633866-2633888 CGGCTGTGCTGGAGCCAGGCAGG + Intronic
1003174951 6:3747359-3747381 CTGCTGTGCTGGGAAAGAGCAGG - Intronic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1004224246 6:13771689-13771711 CTGCTTTGCTGGAGAAGAGTAGG + Intergenic
1005696551 6:28357216-28357238 TGGCTGTGCTGCAGCGAAGCAGG - Intronic
1006569310 6:34987519-34987541 CTGCACTTCTGGAGCAAAGAAGG + Intronic
1006831096 6:36968784-36968806 CGGCTGGGCTGGAGCACATCTGG + Exonic
1006990250 6:38209199-38209221 GTGATGTGAGGGAGCAAAGCAGG - Intronic
1007433826 6:41793614-41793636 CTGAGGGGCTGGATCAAAGCTGG + Exonic
1007446666 6:41911730-41911752 CTGCTGTGCGTGAACACAGCAGG + Intronic
1008857998 6:56114029-56114051 CTGTTGTGTTGCAGCAGAGCTGG - Intronic
1009341010 6:62555067-62555089 CTGCTCGGCTGGAGCCAAGAAGG + Intergenic
1010453244 6:76026573-76026595 CTGCTGTGGTGATGCATAGCTGG - Intronic
1010771768 6:79840112-79840134 CTGCTGTGCTGCAGGAAATCAGG + Intergenic
1011442064 6:87397990-87398012 TGGCTGTGCTGTAGCCAAGCAGG + Exonic
1013013808 6:106143497-106143519 TGGCTGTGCTGGAGCACACCCGG + Intergenic
1013228845 6:108142863-108142885 CTGCTCTGCTGGATAAAAGATGG + Intronic
1013247289 6:108298904-108298926 CTGCTGTGGTGAAGGAGAGCAGG + Intronic
1014570154 6:122997589-122997611 CAGCTTTGCTGGGGGAAAGCAGG + Exonic
1014715006 6:124853834-124853856 CAGCTGTGCTAGAGGAAAGGCGG - Intergenic
1016068464 6:139708476-139708498 CTGCTGGACTGGAGCCAATCTGG - Intergenic
1016544142 6:145201723-145201745 ATGCTTTCCTGTAGCAAAGCTGG - Intergenic
1017255495 6:152328851-152328873 CTGCTGTGCTACAGGGAAGCAGG + Intronic
1017838882 6:158205242-158205264 GTGCTGTCCAGTAGCAAAGCCGG - Intergenic
1017989692 6:159475405-159475427 TTGCTGTGATGGAGCAGAACTGG - Intergenic
1018065635 6:160123449-160123471 CTGCTTGCCTGGAGCAGAGCAGG + Intronic
1018535893 6:164818585-164818607 CTGCTGTACTGCAGCTGAGCTGG - Intergenic
1023074904 7:36473000-36473022 TGGCTGTGCTGCAGCCAAGCAGG - Intergenic
1023101866 7:36726232-36726254 CTGGAGTGCTGTAGCACAGCTGG - Intergenic
1024455048 7:49596359-49596381 GTGCTGTGCTGGAGCACGCCAGG + Intergenic
1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG + Intergenic
1024757298 7:52549952-52549974 CTGCTGTCCAGGGTCAAAGCTGG - Intergenic
1025051991 7:55740078-55740100 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1025128948 7:56365746-56365768 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1025177332 7:56808634-56808656 CAGCTGTGCCGGGGGAAAGCTGG + Intergenic
1025694460 7:63767754-63767776 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1027954647 7:84862967-84862989 TTGCTCTGCTGGAGCAAGGCTGG - Intergenic
1028001428 7:85502427-85502449 CTACTGTACTGCAGCTAAGCTGG - Intergenic
1029241626 7:99167267-99167289 CTGCTGTGCTAAGGCAAGGCTGG - Intergenic
1029274186 7:99394355-99394377 CTGCTGTGCTGGGGCTGAGATGG + Intronic
1029529703 7:101117255-101117277 TGGCTGTGTTGGAGGAAAGCAGG + Intergenic
1029991209 7:104964124-104964146 TGGCTGTGCTGCAGCCAAGCAGG - Intergenic
1032051981 7:128655454-128655476 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1032794607 7:135267760-135267782 TGGCTGTGCTGGGGCAGAGCTGG + Intergenic
1034119368 7:148613060-148613082 CTGCTGTTCTGTAGCACAGTAGG - Intronic
1034452186 7:151142982-151143004 TGGCAGTGCTGGAACAAAGCGGG - Intronic
1035006099 7:155662330-155662352 CTGCTGTGCTGGAGAGAAATGGG - Intronic
1035018671 7:155787786-155787808 CTGCTGTGGGGGAGCGAAGTGGG - Intergenic
1035882246 8:3255582-3255604 CTGCAGGGCTGCAGCAAGGCTGG - Intronic
1037859196 8:22392746-22392768 CAGCTGGGCTGGAGCAAGCCTGG + Intronic
1037936683 8:22919748-22919770 CTTCTGGGCTGGAGAGAAGCTGG - Intronic
1038309640 8:26436427-26436449 CTGCTCTGATGGATTAAAGCAGG + Intronic
1038720092 8:30027612-30027634 CTGCTGTGCAGGACCAAGTCCGG - Intergenic
1039465676 8:37783694-37783716 CTGCTTTGATGGAGCAACCCAGG + Intergenic
1039790634 8:40872943-40872965 CTGCTGTGCTGGTCCACAGAGGG - Intronic
1042125208 8:65531287-65531309 CACCTGTGCAGAAGCAAAGCGGG - Intergenic
1043973802 8:86563134-86563156 CTGCTGTGTTGGAGTAAGACTGG + Intronic
1045485404 8:102627529-102627551 CAGCTGTCCTGGAGGAAAGCGGG + Intergenic
1047179755 8:122575849-122575871 CTGTTCTGCTGGAATAAAGCAGG + Intergenic
1048871719 8:138804429-138804451 CTGCTGTGCTTGAGCAGAGCAGG - Intronic
1049193184 8:141300216-141300238 CAGCTTTGTTGGAGGAAAGCAGG - Intronic
1049748977 8:144274693-144274715 CTGCTGTGCTGGGAGGAAGCCGG - Intronic
1049891243 9:73020-73042 CGGGAGTGCGGGAGCAAAGCCGG + Intergenic
1053840339 9:42184953-42184975 CGGCTGGGCTGGAGCAGAGAGGG + Intronic
1055335586 9:75229999-75230021 TAGCTGTGCTGCAGCCAAGCAGG + Intergenic
1056500221 9:87201540-87201562 CTGGTTTGCTGGCTCAAAGCAGG + Intergenic
1056509056 9:87285439-87285461 CTCCTGGGCTGGAGCAAACACGG - Intergenic
1058746169 9:107992832-107992854 CTGCTGGGCTGGAGGCATGCAGG - Intergenic
1059322388 9:113479806-113479828 CTGCTCTGCTGGGGCCAAGAAGG - Intronic
1060156173 9:121321250-121321272 CAGATCTGCAGGAGCAAAGCTGG - Exonic
1061761809 9:132856703-132856725 CTTCTGAGCTGGTGGAAAGCAGG - Intronic
1062311753 9:135941768-135941790 CTGCTGTCCGGGGGCAGAGCTGG - Intronic
1062630451 9:137460921-137460943 GTGATGTGCTGGGGCAAAGCTGG - Intronic
1062754722 9:138281049-138281071 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1203578629 Un_KI270745v1:25209-25231 CAGCTGTGCCGGGGGAAAGCTGG - Intergenic
1185965936 X:4602768-4602790 CTACTGTGCAGGAGAACAGCAGG + Intergenic
1185977585 X:4738830-4738852 CTGAATTGCTGGAGCAAAGGAGG + Intergenic
1187088228 X:16064858-16064880 CTGCTGTAATGGAGAAAGGCAGG - Intergenic
1189889135 X:45580860-45580882 GTGCAGTGCTGGAGCACACCTGG + Intergenic
1192312055 X:70025106-70025128 CTGCAGAACTGGAACAAAGCAGG + Intronic
1192924651 X:75742875-75742897 CTGGTGTACTGGGGCAAACCTGG + Intergenic
1193165692 X:78277550-78277572 CTGCTGTGCTGGAGGAACCAAGG - Intronic
1193392850 X:80949336-80949358 CTGCTGGACTTGAACAAAGCAGG - Intergenic
1196548067 X:116988455-116988477 CTGCTGTGCTGGAAACAGGCAGG + Intergenic
1198393079 X:136196059-136196081 CTGCCTTCATGGAGCAAAGCAGG + Intronic
1198788243 X:140314199-140314221 CTGCTGTACTGCAGCTGAGCTGG - Intergenic
1199541286 X:148960362-148960384 TGGCTGTGCTGCAGCCAAGCAGG - Intronic
1201730043 Y:17193010-17193032 CTGCTGCCCTGGAGTAAAGGCGG + Intergenic
1201743587 Y:17348156-17348178 CTGCTGGACAGGAGCAAAGAAGG + Intergenic