ID: 1175924938

View in Genome Browser
Species Human (GRCh38)
Location 20:62466976-62466998
Sequence CCTGGGAGGCGGGTGTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 336}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175924938_1175924951 -6 Left 1175924938 20:62466976-62466998 CCCCTGGACACCCGCCTCCCAGG 0: 1
1: 0
2: 3
3: 23
4: 336
Right 1175924951 20:62466993-62467015 CCCAGGCCGGGGGGCCCCACCGG 0: 1
1: 0
2: 4
3: 42
4: 334
1175924938_1175924954 1 Left 1175924938 20:62466976-62466998 CCCCTGGACACCCGCCTCCCAGG 0: 1
1: 0
2: 3
3: 23
4: 336
Right 1175924954 20:62467000-62467022 CGGGGGGCCCCACCGGACAGAGG 0: 1
1: 0
2: 3
3: 9
4: 93
1175924938_1175924962 15 Left 1175924938 20:62466976-62466998 CCCCTGGACACCCGCCTCCCAGG 0: 1
1: 0
2: 3
3: 23
4: 336
Right 1175924962 20:62467014-62467036 GGACAGAGGCTGAGGGCTCCGGG 0: 1
1: 0
2: 3
3: 54
4: 480
1175924938_1175924955 7 Left 1175924938 20:62466976-62466998 CCCCTGGACACCCGCCTCCCAGG 0: 1
1: 0
2: 3
3: 23
4: 336
Right 1175924955 20:62467006-62467028 GCCCCACCGGACAGAGGCTGAGG 0: 1
1: 0
2: 1
3: 17
4: 205
1175924938_1175924957 8 Left 1175924938 20:62466976-62466998 CCCCTGGACACCCGCCTCCCAGG 0: 1
1: 0
2: 3
3: 23
4: 336
Right 1175924957 20:62467007-62467029 CCCCACCGGACAGAGGCTGAGGG 0: 1
1: 0
2: 1
3: 13
4: 147
1175924938_1175924961 14 Left 1175924938 20:62466976-62466998 CCCCTGGACACCCGCCTCCCAGG 0: 1
1: 0
2: 3
3: 23
4: 336
Right 1175924961 20:62467013-62467035 CGGACAGAGGCTGAGGGCTCCGG 0: 1
1: 0
2: 0
3: 27
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175924938 Original CRISPR CCTGGGAGGCGGGTGTCCAG GGG (reversed) Intronic
900192748 1:1358420-1358442 CCTGGGAGGCGGGTGGGGGGTGG - Intronic
900622670 1:3594576-3594598 CCTGGGAGGGGTCAGTCCAGAGG - Intronic
901705159 1:11067906-11067928 GCTGGGGAGCGAGTGTCCAGGGG - Intronic
901816137 1:11794538-11794560 CCTGGCAGAGGGGTGCCCAGAGG + Exonic
902277790 1:15351836-15351858 CCTGGGAGTTGGATGTGCAGAGG + Intronic
903236111 1:21951754-21951776 CCTGGGAGGAGGATGGCAAGAGG - Intergenic
903550846 1:24156674-24156696 CCTGGGATGGGGGAGTTCAGTGG + Exonic
903813281 1:26046480-26046502 CCTCGGAAGAGGGTCTCCAGAGG + Intergenic
904011119 1:27391261-27391283 GCTGTGATGGGGGTGTCCAGTGG + Intergenic
904055261 1:27665801-27665823 CCTGCTAGGCAGGAGTCCAGAGG + Intergenic
904415854 1:30360650-30360672 TCTGGGAGGCGGCAGCCCAGGGG - Intergenic
904602116 1:31679484-31679506 CCTGGGAGGCAGGTAAACAGAGG + Intronic
904689668 1:32284443-32284465 CCTGGGAGGTGGAGGTGCAGAGG - Intronic
905631499 1:39521540-39521562 CCTGGGAGTCGGTTGGCCTGCGG - Exonic
905666255 1:39764631-39764653 CCTGGGAGTCGGTTGGCCTGCGG + Exonic
906776487 1:48534378-48534400 CCTGGGAGGCTACAGTCCAGTGG - Intronic
910739037 1:90494931-90494953 GCTGGGAGGCAGGTGGCCTGGGG - Intergenic
912553069 1:110496980-110497002 CATGGGAGGCCTGTCTCCAGAGG - Intergenic
913353844 1:117895954-117895976 CTTGGGAGGTAGGTCTCCAGAGG + Intronic
914889858 1:151612623-151612645 CCTGAGGGGCGGGGGTCCGGAGG - Intronic
915456501 1:156044100-156044122 CCTGGGAGGTGGGGGGCGAGGGG + Exonic
917919530 1:179739446-179739468 CCTGGGAGGCTTGTGGCCAGTGG - Intergenic
919735693 1:200948963-200948985 CCTGGCAGGAGGGTGTACAGAGG - Intergenic
922216265 1:223522608-223522630 CCTGTGAGGCCGGGGTGCAGGGG - Intergenic
922780253 1:228246756-228246778 CCTGTGAGGCTGGGGGCCAGCGG + Exonic
922786666 1:228286303-228286325 ACTTTGAGGCGGGTGACCAGCGG + Exonic
923018933 1:230148083-230148105 AGTGGGAGGCATGTGTCCAGTGG - Intronic
1063578270 10:7281375-7281397 AGTGGGAGGGGGGTGTGCAGGGG - Intronic
1063631255 10:7735497-7735519 CCCAGGAGGCGGGAGTGCAGTGG - Intronic
1064227939 10:13503971-13503993 CCTAGGAGGAGGGAGTCCTGGGG + Intronic
1064244432 10:13657582-13657604 CCGGGGAGGAGGGGGTCCTGAGG + Intronic
1065844659 10:29735350-29735372 GCGGGGAGGCGGGTGGCCCGGGG - Intronic
1066653323 10:37679616-37679638 TATGGGAGGCGTGTGGCCAGTGG + Intergenic
1067037679 10:42932156-42932178 TGTGGGAGGTGGGTGGCCAGTGG + Intergenic
1067080840 10:43211446-43211468 CCTGGCAGGCAGGTGGCAAGGGG - Intronic
1068877531 10:62012482-62012504 CTTGGGAGGCTGGAGTGCAGTGG - Intronic
1069592463 10:69650604-69650626 CCTGGGGGGTGGGGGTGCAGTGG + Intergenic
1070715592 10:78718788-78718810 CCAGGGAGGCAGGTGTGCACAGG + Intergenic
1070748505 10:78949850-78949872 CCAGGAAGGGGGTTGTCCAGGGG - Intergenic
1070803656 10:79257716-79257738 CTGGGGAGCCAGGTGTCCAGTGG + Intronic
1071444030 10:85729541-85729563 CCTTGGAGGCGGCTGCCCATGGG + Exonic
1071475118 10:86019229-86019251 CTGGGGATGCGGGTGTGCAGGGG - Intronic
1072609787 10:97010609-97010631 CATGGGACGTGGGTGGCCAGAGG + Intronic
1073179716 10:101576399-101576421 CCTGGGAGGCAGAGGTGCAGAGG - Intronic
1073252150 10:102127297-102127319 CCTGGGAGGCAGAGGTTCAGTGG + Intergenic
1075665206 10:124224783-124224805 CGTGGGAGGCTGGAGCCCAGGGG - Intergenic
1075682274 10:124341501-124341523 GCTGGGTGGGGGGTGTGCAGTGG - Intergenic
1076110454 10:127855716-127855738 CCTGGAAGGAGGGTGTCTACTGG + Intergenic
1076124333 10:127962463-127962485 CCGGGGAGGTCTGTGTCCAGCGG - Intronic
1076591714 10:131588107-131588129 CCTGGGAGGCAGGGCTGCAGTGG + Intergenic
1076702896 10:132283458-132283480 ACTGGGAGGAGGGTGTCATGGGG + Intronic
1076882760 10:133247636-133247658 ACTGGGAGGTGGCTGTCCTGGGG + Intergenic
1076911171 10:133390799-133390821 TCTGGGAGTCGGGTGGGCAGAGG - Intronic
1077008751 11:370780-370802 CCAGGGAGCCAGGTGTCCTGAGG + Intronic
1077024725 11:434009-434031 CCTGTGAGGTGGGTGTCCGGGGG - Exonic
1077066247 11:642201-642223 CCTGGGAGGCTGATGGTCAGAGG - Intergenic
1077295359 11:1823888-1823910 GCTGGGTGGAGGGTGCCCAGAGG + Intergenic
1077526363 11:3068021-3068043 CCTGGGAGGAGGGAGGCCACAGG - Intergenic
1077539546 11:3140056-3140078 CCTGGGAGGGGGGTGTGCAGTGG + Intronic
1077578864 11:3404394-3404416 CCTGGGAGCCTAGTGGCCAGAGG - Intergenic
1078110269 11:8386554-8386576 CCTGGGAGGTGGGCAGCCAGGGG + Intergenic
1078290752 11:10007774-10007796 CCTAAGAGGGTGGTGTCCAGAGG - Intronic
1081683966 11:45028421-45028443 CCTGGGAGGCATGTGGCCCGCGG + Intergenic
1081810331 11:45910692-45910714 GCTGGAAGGAGGGTGTCCACTGG - Intronic
1082903860 11:58285177-58285199 GCTGGGAGGTGGGTGGCCTGGGG + Intergenic
1083378928 11:62248471-62248493 CTTGGGGGGGGTGTGTCCAGAGG - Intergenic
1083618075 11:64036126-64036148 CCGGGGAGGCGGGTCTCCTCGGG - Intronic
1083879942 11:65543362-65543384 CCTGGGGGGTGGGGGTCCTGGGG + Intronic
1084056572 11:66637942-66637964 CCTGGGAGGCTGGTTCCCAGAGG + Intronic
1084119740 11:67062187-67062209 CCAGGGAAGCTGGTGGCCAGGGG - Intronic
1084477372 11:69396575-69396597 CCTTGGAGGCTGGTGAACAGGGG - Intergenic
1084867298 11:72069632-72069654 TGTGGGAGGGTGGTGTCCAGAGG - Intronic
1085026270 11:73238371-73238393 CCTGGGTGGCAGGTGTCCCAGGG + Intergenic
1085278361 11:75314268-75314290 CCTGGGAGGCTGGAGTCAAGAGG + Intronic
1085332704 11:75667320-75667342 CCTGGGAGGCGGCTGGGGAGAGG + Intronic
1088919696 11:114252023-114252045 GCTGGGAGGCTGGTCTCCAGGGG - Intergenic
1089366061 11:117921752-117921774 CCTGGGAGGCAGGTGGAAAGTGG + Intronic
1089910462 11:122094175-122094197 CCTGGAAGGAGGCTCTCCAGTGG + Intergenic
1089954272 11:122555972-122555994 GCTGGGAGGCAGGTGGCCTGGGG - Intergenic
1091385705 12:93324-93346 CCTGGGAGGCAGGGGACCATGGG - Intronic
1091671305 12:2454051-2454073 CCAGGGAGGTGGGGGTGCAGTGG - Intronic
1091775468 12:3182106-3182128 ACTGGGGGCCGGGGGTCCAGGGG - Intronic
1093488785 12:19681581-19681603 GCTGGGAGGCGGGTAGCCTGGGG - Intronic
1094406464 12:30121497-30121519 TCTTGGAGTCGGGTGTTCAGTGG - Intergenic
1095200581 12:39379558-39379580 CCTGGGAGACTGATGTCCATGGG + Intronic
1096195466 12:49646594-49646616 CCTGGGAGACGGGCATGCAGAGG + Intronic
1097007956 12:55932274-55932296 GCTGGGACGCGGGGGTGCAGCGG + Intronic
1097182650 12:57180025-57180047 CCTGGGGGGAGGGTGCCAAGAGG - Exonic
1097386026 12:58950671-58950693 GCTGGGAGGCGGGTAGCCTGGGG - Intergenic
1098264780 12:68707116-68707138 CCAGAGAGGCTGCTGTCCAGAGG + Intronic
1103847538 12:123911545-123911567 CCTGGGAGGGGTCTGTCCTGGGG + Intronic
1103895129 12:124268037-124268059 CCTGGGACCCTGGTGCCCAGAGG - Intronic
1103986694 12:124772215-124772237 CGTGGGAGCCGGGAGGCCAGTGG + Intergenic
1111554335 13:89860651-89860673 CGTGGGAGGCTGGTCTTCAGTGG - Intergenic
1112432779 13:99366784-99366806 CCTGGGAGACGGGGGAGCAGAGG - Intronic
1113311766 13:109140016-109140038 CCTCTGAGGAGGTTGTCCAGTGG - Intronic
1113566643 13:111323276-111323298 CCTGGATGGCGGGTGACCTGGGG + Intronic
1114466879 14:22929312-22929334 GGTGGGAGCCGCGTGTCCAGCGG - Exonic
1114628560 14:24145401-24145423 TCTGGGATGGGGATGTCCAGTGG + Exonic
1114656179 14:24316817-24316839 CGTGGGAGGCGGGAGTGGAGTGG + Exonic
1115265121 14:31492852-31492874 GCTGGGAGGCGGGTAGCCTGGGG + Intronic
1115339799 14:32281035-32281057 CCTGGGAGGTGGAGGTGCAGTGG + Intergenic
1118062285 14:62152575-62152597 TCTGGGAGTCGGGTGTGTAGTGG + Intergenic
1118079461 14:62341615-62341637 CCTGTGATGAGGGTGACCAGTGG - Intergenic
1118165553 14:63332368-63332390 GCTGGGAGGCGGGTAGCCTGGGG + Intergenic
1118444231 14:65837315-65837337 CCTGGGAGGCCAGTGACGAGAGG + Intergenic
1119461187 14:74805381-74805403 CCTGGGAGGCTGGAATACAGTGG + Intronic
1119679785 14:76583994-76584016 CCTGGAACGAGAGTGTCCAGGGG - Intergenic
1121573073 14:94962078-94962100 CCTGCCAGACGGATGTCCAGAGG + Intergenic
1121912364 14:97802978-97803000 CCTGGGGGGAGGGTGGGCAGGGG + Intergenic
1122302355 14:100738440-100738462 CCTGGGAGTCTCCTGTCCAGAGG + Intergenic
1122430036 14:101634777-101634799 CGGGGGAGGAGGGTGTCCAAGGG + Intergenic
1122578362 14:102755931-102755953 CCTGGGAGTCAGGAGGCCAGGGG - Intergenic
1122814726 14:104306830-104306852 CCTGGGAGCCGGCTGGTCAGAGG + Intergenic
1122924899 14:104895013-104895035 CCAGGCAGGCGGGTGTGCGGCGG - Exonic
1122953484 14:105059117-105059139 CCTGGGAGGGGAGTGTGCACTGG - Intronic
1122975349 14:105168598-105168620 CCTGGGCGGCGGGCGTGCAGGGG + Exonic
1124136507 15:27040144-27040166 CCAGGCAGGTGGGGGTCCAGAGG + Intronic
1129845760 15:78767082-78767104 CCTGGGAGGCAGGCTGCCAGGGG + Intronic
1130256101 15:82326778-82326800 CCTGGGAGGCAGGCTGCCAGGGG - Intergenic
1130598852 15:85263208-85263230 CCTGGGAGGCAGGCTGCCAGGGG + Intergenic
1132042734 15:98538578-98538600 ACTGTGAGGGGGTTGTCCAGCGG + Intergenic
1132997020 16:2828768-2828790 CCTGGGGGATGGGTGTGCAGTGG + Intergenic
1134251123 16:12574832-12574854 CCTGGGGGGAGGGGGGCCAGTGG + Intergenic
1134556895 16:15173271-15173293 GCTGGGAGGCTGGTGTGCATGGG - Intergenic
1134917474 16:18084989-18085011 GCTGGGAGGCTGGTGTGCATGGG - Intergenic
1136138082 16:28270135-28270157 CCTGGGAGGCGGAGGTTGAGTGG - Intergenic
1136611899 16:31371533-31371555 CCTGGGATGGGGGACTCCAGAGG - Intronic
1137626324 16:49910966-49910988 CCTGGGAGAAAGGTTTCCAGGGG + Intergenic
1138704279 16:58898397-58898419 TCTGGGAGGCCGGGGGCCAGGGG - Intergenic
1138880970 16:61014634-61014656 GCTGGGAGGCGGGTATCCTGGGG + Intergenic
1139653416 16:68373844-68373866 AGTGAGAGGCGGGCGTCCAGGGG - Intronic
1140442821 16:74999881-74999903 CCCGGGAGGCGGGGGTGTAGAGG - Exonic
1140960869 16:79911371-79911393 CCTGGGAGGCAGGTGTCATGAGG + Intergenic
1141688405 16:85583091-85583113 CCTGCGAGGGTGGTGTCCTGGGG + Intergenic
1141771224 16:86090723-86090745 CTTGGGTGGCGGGTGGCCCGAGG + Intergenic
1142494650 17:299885-299907 CCTAGGGGGCAGGTGTCCCGGGG + Intronic
1142957562 17:3531888-3531910 CCAGGGAGGCGGGTACCCTGAGG + Intronic
1143594845 17:7907842-7907864 CCTGGGAGGAGGGTGTCCTGAGG + Intronic
1143847377 17:9782831-9782853 CCTGGCAGCCTGGTGCCCAGTGG + Intronic
1143847967 17:9787408-9787430 CCTGGGAGGCTGGAGCCCAGTGG + Intronic
1144500846 17:15786233-15786255 CCGGGGCGGCGGGGGTCCGGCGG - Intergenic
1145163007 17:20588895-20588917 CCGGGGCGGCGGGGGTCCGGCGG - Intergenic
1146913619 17:36664172-36664194 CTTGGGAGGAGGGTGTGCACAGG - Intergenic
1147140910 17:38460201-38460223 CCTGGGTGCAGGGTGTCAAGGGG - Intronic
1149381815 17:56102061-56102083 CGTTGGAGGTGGGTTTCCAGGGG - Intergenic
1150945711 17:69743433-69743455 GCTGGGAGACGGGTATCCTGGGG - Intergenic
1152352698 17:79792333-79792355 CCTGGGGGGTGGGTGGGCAGGGG - Exonic
1155416790 18:25606989-25607011 ACTGGGTGGCGGGGGTGCAGTGG + Intergenic
1156397146 18:36708687-36708709 CCTGGTAGGCTGTTGACCAGTGG + Intronic
1156496165 18:37526535-37526557 CTTGGGAGGTGGGTGACCTGGGG + Intronic
1157404754 18:47413611-47413633 CCAGGGAGGGGAGTGTCCAGAGG - Intergenic
1158890508 18:61867512-61867534 CCTGGGAGGAGGGGGAGCAGGGG + Intronic
1159040897 18:63321656-63321678 TCTTGGAGGCTGGTGTGCAGTGG + Intergenic
1159787049 18:72726943-72726965 GCTGGGAGGCGGGTAGCCTGGGG + Intergenic
1160577976 18:79867787-79867809 CCAGGGAGGCCGGTGCCGAGGGG - Intronic
1160903730 19:1442147-1442169 CCTGCCTGGCTGGTGTCCAGAGG + Intergenic
1160991028 19:1860399-1860421 CCTGGGAGCAGGGAGGCCAGGGG - Intronic
1161078815 19:2300436-2300458 CCTGGGAGGGGGGTGGTCCGAGG - Intronic
1161288972 19:3482879-3482901 CGGGGGAGGCGGGGGTTCAGAGG + Intergenic
1161293199 19:3506608-3506630 CCTGGGAGGCGGCATTCGAGGGG - Intronic
1161407232 19:4097459-4097481 AATTGGAGGCGGGTGTGCAGAGG + Intronic
1161772161 19:6236735-6236757 CCCAGGAGGCTGGTTTCCAGGGG - Intronic
1161775851 19:6261695-6261717 TCTGGGTGGTGGGAGTCCAGGGG - Intronic
1162038505 19:7955442-7955464 CCCCAGAGGCGGGGGTCCAGAGG + Intergenic
1162873868 19:13606410-13606432 CCTGGGAGGCGAGGTTGCAGTGG + Intronic
1162932091 19:13962407-13962429 CCTGGGAGGGGGGCGGCCAAGGG + Exonic
1163672832 19:18638462-18638484 CCCAGGAGGTGTGTGTCCAGAGG + Intronic
1164602148 19:29569340-29569362 CCTGGGGGACAGGTGGCCAGAGG + Intergenic
1164941049 19:32252526-32252548 ACTGGGAGGTGGGTGTCCCTGGG - Intergenic
1165090811 19:33387593-33387615 CCTGGGAGACGGGTGGCCTCCGG + Intronic
1165944935 19:39436316-39436338 TCGGGGAGGAGGGAGTCCAGAGG - Intronic
1167110306 19:47456898-47456920 CCGGGGTGGGGGGTGTGCAGGGG - Intronic
1167410527 19:49341276-49341298 CCTGGGAGGAGGGTGTTCTGGGG + Exonic
1167462387 19:49632567-49632589 CTTGGGAGGTGGGTGGACAGTGG + Intergenic
1167517391 19:49930988-49931010 CCTGGAGGGCGGGCTTCCAGTGG + Exonic
1168110800 19:54190471-54190493 AGTGGACGGCGGGTGTCCAGGGG + Intronic
1168325864 19:55537980-55538002 GCTTGGAGAGGGGTGTCCAGGGG - Intergenic
925200179 2:1960866-1960888 CCAGGGAGGCGGGTGCACTGCGG - Intronic
925270977 2:2607171-2607193 CCTCAGAGGTGGGTGTCAAGGGG + Intergenic
927477310 2:23423646-23423668 CCTGGCGGGCGGGGGTCCTGTGG + Intronic
927516485 2:23674780-23674802 CCAGGGAGTGGGGTGTCCTGAGG - Intronic
927888892 2:26736088-26736110 GCTGGGAGGCTGGTGAACAGCGG - Intergenic
929215570 2:39408269-39408291 CCTGGGATCTGGGTGGCCAGGGG - Intronic
931095167 2:58931542-58931564 CCTGGGAGGGGCTTGTGCAGAGG + Intergenic
933121316 2:78541801-78541823 GCTGGGAGGCGGGTAACCTGGGG + Intergenic
934778983 2:96957171-96957193 CCATGGAGGCGGGTGACAAGGGG - Intronic
934844601 2:97654785-97654807 CCTGGGAGGCAGGGAGCCAGTGG + Intergenic
935736734 2:106112184-106112206 CCTGGGTTGAGGGTGGCCAGTGG + Intronic
937379731 2:121365671-121365693 CCTGGTAAGAGGCTGTCCAGTGG - Intronic
937521743 2:122720712-122720734 GCTGGGAGGTGGGTGGCCTGGGG + Intergenic
937896001 2:126977149-126977171 CCTGGGAGGCAGGTGACCCGGGG - Intergenic
938206958 2:129432099-129432121 CCTGGGAGGCTGGTGTGCACGGG - Intergenic
941876231 2:170436240-170436262 GCTGGGAGGAGGCTGTCTAGGGG + Intronic
945177150 2:207054195-207054217 CCTGGGAGGGGGATGTGAAGAGG + Intergenic
945825597 2:214716917-214716939 GCTGGGAGGCGGGTAGCCTGGGG + Intergenic
946027316 2:216679642-216679664 CCTAGGAGGAGGGGGTCCTGGGG + Intronic
948388661 2:237597221-237597243 CCTAGGGGGCGAGTGGCCAGGGG - Intronic
948445736 2:238031330-238031352 CCTGGGAGGAGAGGCTCCAGAGG - Intronic
948629234 2:239291418-239291440 CCTGGGTGGCGGGGGGCCTGAGG + Intronic
949071053 2:242024489-242024511 CCAGGGAGGAGGTTGTCCTGTGG + Intergenic
1172120653 20:32596869-32596891 CCTGGGATGCAGCTGTCCAGGGG - Intronic
1172173919 20:32961006-32961028 CCAAGAAGGCGTGTGTCCAGAGG - Intronic
1172814854 20:37678350-37678372 CCTGTGGGGCAGGAGTCCAGAGG - Intergenic
1173614780 20:44395518-44395540 GATGGGAGGCAGGGGTCCAGTGG + Intronic
1173737415 20:45372171-45372193 TGTGGGAGGCAGGTGGCCAGAGG + Intronic
1174298799 20:49567889-49567911 CCTCGGAGGTGGGAGTCCCGGGG - Intronic
1175036348 20:56004615-56004637 CAAGGGTGGCGGGTGCCCAGCGG + Exonic
1175113034 20:56662413-56662435 CCAGGGAAGCGGGTGGCCTGGGG - Intergenic
1175536401 20:59717618-59717640 GCTGGGGGGTGGGTTTCCAGTGG - Intronic
1175924938 20:62466976-62466998 CCTGGGAGGCGGGTGTCCAGGGG - Intronic
1176146139 20:63566363-63566385 CCTGCCAGGTGGGTGACCAGCGG - Exonic
1176386241 21:6139817-6139839 CCTGGGAGGGAGGTGACCACAGG + Intergenic
1176390338 21:6159946-6159968 CCTGGGACCCAGGTGTCCATAGG + Intergenic
1179178934 21:39028958-39028980 CCGTGGGGGCGGGTGCCCAGGGG - Intergenic
1179545268 21:42109117-42109139 CATGGGGGGTGGGGGTCCAGCGG - Intronic
1179605879 21:42514658-42514680 GCTGGAAGGCTGGTGGCCAGCGG - Exonic
1179733128 21:43378294-43378316 CCTGGGACCCAGGTGTCCATAGG - Intergenic
1179737232 21:43398435-43398457 CCTGGGAGGGAGGTGACCACAGG - Intergenic
1179843098 21:44090261-44090283 CCAGAAAGGCGGGCGTCCAGAGG - Intronic
1180099762 21:45579042-45579064 CCTGGGATGCGGGTGCCCCTGGG + Intergenic
1180099770 21:45579059-45579081 CCTGGGATGCGGGTGGCCCTGGG + Intergenic
1180099870 21:45579296-45579318 CCTGGGATGCGGGTGGCCCTGGG + Intergenic
1180099965 21:45579517-45579539 CCTGGGATGCGGGTGGCCCTGGG + Intergenic
1180100024 21:45579669-45579691 CCTGGGATGGGGGTGTCCCTGGG + Intergenic
1180100086 21:45579839-45579861 CCTGGGAGGCGGGTGCCCCTGGG + Intergenic
1180820881 22:18826842-18826864 TTTGGGTGGCTGGTGTCCAGTGG - Intergenic
1180988473 22:19919507-19919529 TATGGGAGCCGGGTGTCCTGGGG - Intronic
1181093424 22:20489801-20489823 TCTGGGAGGTGGGTGCCAAGGGG + Intronic
1181207101 22:21261307-21261329 TTTGGGTGGCTGGTGTCCAGTGG - Intergenic
1181476248 22:23169392-23169414 CTTGGGAGGCTGGAGGCCAGAGG - Intergenic
1183484591 22:38082303-38082325 CCTGGGAGGCGGGGCTGCGGAGG - Intronic
1183642464 22:39100888-39100910 CCTCCTAGGCGGGTGTCCAAAGG + Intronic
1184098891 22:42331213-42331235 CCAGGCGGGCGGGTGTCCTGGGG - Intronic
1184617616 22:45648672-45648694 CCGGGGTGGCTGGTGTCCACAGG - Intergenic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1185190346 22:49432529-49432551 CCTGAGAGGGGGGTGTTCTGGGG + Intronic
1185346126 22:50311584-50311606 CCAAGCAGGTGGGTGTCCAGAGG + Exonic
1185346639 22:50313431-50313453 CCTGGAAGGTGGGGGTCCTGTGG - Exonic
1185391447 22:50563491-50563513 GCTGGGAGGAGGCTGACCAGAGG + Intergenic
1203219819 22_KI270731v1_random:34109-34131 TTTGGGTGGCTGGTGTCCAGTGG + Intergenic
1203271008 22_KI270734v1_random:52718-52740 TTTGGGTGGCTGGTGTCCAGTGG - Intergenic
950417526 3:12876728-12876750 CATGGGAGGCGAGTGACCTGGGG - Intergenic
952901063 3:38112049-38112071 CCTGGGAGCCTGGAATCCAGAGG - Intronic
953216538 3:40923861-40923883 GCTGGGAGGTGGGAGGCCAGAGG + Intergenic
956399645 3:68863201-68863223 CCTAGGAGGCTGGAGTGCAGTGG - Intronic
957971674 3:87390501-87390523 ACTGGGAGGCGGGTAGCCTGGGG + Intergenic
959579679 3:107970650-107970672 CCCGGGAGCCGGTAGTCCAGGGG + Intergenic
960815829 3:121671390-121671412 ACTGGGAGTTGGGGGTCCAGGGG - Intronic
961331626 3:126145938-126145960 CCTGAGAGAATGGTGTCCAGAGG - Intronic
962474803 3:135746008-135746030 GCTAGGAAGCAGGTGTCCAGAGG - Intergenic
963732429 3:148986643-148986665 CCTGGGAGGTGGGGGGCGAGGGG + Intergenic
964860591 3:161196966-161196988 CCTGGGAGAGAGGTGCCCAGTGG + Intronic
965547107 3:169927174-169927196 TCTGCCAGGTGGGTGTCCAGGGG + Exonic
965874425 3:173299696-173299718 GCTGGGAGGCGGGTGGCCTGAGG - Intergenic
967172399 3:186831937-186831959 CATGGCAGGTGGGTGACCAGAGG + Intergenic
967257558 3:187609244-187609266 GCTGGGAGGCGGGTAGCCTGGGG - Intergenic
968087160 3:195878938-195878960 CGTGGGAGGAGGGAGTCCATTGG + Intronic
968133673 3:196207588-196207610 CCTGAGGGGCGGGCGTCCGGGGG - Intronic
968133720 3:196207685-196207707 CCTGAGGGGCGGGCGTCCGGGGG - Intronic
968843619 4:3026704-3026726 CCTGGGAGGCGGGAGAGCACAGG - Intronic
968904946 4:3446753-3446775 TCTGGGAGGCGGGCCTCGAGTGG + Intronic
969366759 4:6699785-6699807 CATGGGAGGCTGGTCTCCTGGGG - Intergenic
969468181 4:7370101-7370123 CCTGGGTGGGGTGTGTGCAGGGG + Intronic
969725275 4:8914818-8914840 CATGGGAGGCCGGTGTGCCGTGG + Intergenic
972323781 4:37996000-37996022 TCTGGGATGGGGATGTCCAGTGG + Intronic
976390112 4:84498020-84498042 CCTGGGTTGTGGGTGCCCAGAGG + Exonic
976556141 4:86453329-86453351 GCTGGGAGGCGGGTAGCCTGGGG + Intronic
980523490 4:133960647-133960669 GCTGGGAGGCAGGTATCCTGGGG + Intergenic
982680192 4:158419300-158419322 GCTGGGAGGTAGGTGGCCAGGGG - Intronic
983843641 4:172488372-172488394 CCTGGGAAGATGGTGTCTAGGGG + Intronic
984475025 4:180224950-180224972 GCTGGGAGGCGGGTAGCCTGGGG - Intergenic
985092838 4:186381700-186381722 GCTGGGAGGCGGGTAGCCTGGGG + Intergenic
985217817 4:187672147-187672169 GCTGGGAGGCGGGTAGCCTGGGG - Intergenic
985658344 5:1143438-1143460 CCAGGGATGCGTGTGTGCAGAGG - Intergenic
985685154 5:1277980-1278002 TCTGGGAGGAGTGTGTCCCGGGG + Intronic
986518139 5:8584501-8584523 CCTGGGAGGGTGGAGTTCAGTGG - Intergenic
987148745 5:15017737-15017759 CCTGGGAGGTGGGGGTCTGGTGG + Intergenic
990376135 5:55173100-55173122 CCTGGGGGACGGGACTCCAGGGG - Exonic
990900397 5:60743481-60743503 CGAGGGAGGCGGCTGTGCAGGGG - Intergenic
997690542 5:135824909-135824931 CCTGAGAGGGGCCTGTCCAGGGG - Intergenic
999816806 5:155184950-155184972 CCTGGGAGGAGGGCATCCACAGG - Intergenic
1001110899 5:168895324-168895346 CCTGGGCTGCGGCTGCCCAGAGG + Intronic
1002644459 5:180646335-180646357 GCAAGGAGGCTGGTGTCCAGGGG - Intronic
1003116561 6:3287460-3287482 CCTGTGAAGTGGGTGTGCAGTGG - Intronic
1003711962 6:8602607-8602629 GCTGGGAGGCGGGTAGCCTGGGG - Intergenic
1005760230 6:28961008-28961030 GCTGGGAGGCGGGTAGCCTGGGG + Intergenic
1005886617 6:30102203-30102225 CCTGGGAGGCGGAGCTCCAACGG - Intergenic
1006169552 6:32085298-32085320 CCTGGGAGCCTGGTTTGCAGTGG - Intronic
1007001803 6:38320301-38320323 CCTGGGGGGAGGATGACCAGTGG + Intronic
1007213830 6:40220337-40220359 CCTGGGTGGCAGGGGTCAAGTGG + Intergenic
1007444636 6:41895407-41895429 CCTGAGGGGCGGGGCTCCAGCGG - Intergenic
1007615340 6:43176465-43176487 CCTGGGACTGGGGTGTCCATGGG + Intronic
1012291188 6:97457875-97457897 CATGGCAGGCTGGTGTCCAGTGG - Intergenic
1014304860 6:119727731-119727753 GCTGGGAGGCGGGTAGCCTGGGG - Intergenic
1016900659 6:149097508-149097530 CCTGGGAAGCTGGTGTCATGTGG - Intergenic
1017252339 6:152294043-152294065 CCTGGGATGCGGATGTGCTGGGG + Exonic
1017321339 6:153097556-153097578 CCTGGGAGCAGGGCGTGCAGTGG + Intronic
1018718076 6:166550635-166550657 CCTGGGAGGTGGGTGTCTCTAGG + Intronic
1019161936 6:170074728-170074750 CCTGGGAGCCGGGTGGACATAGG + Intergenic
1019529037 7:1494547-1494569 ACTGGAAGGCGGGGGTCCGGGGG + Intronic
1020358612 7:7303702-7303724 GCTGGGAGGCAGGTATCCTGGGG - Intergenic
1020634863 7:10684770-10684792 GCTGGGAGGCGGGTAGCCTGGGG + Intergenic
1020860751 7:13489327-13489349 GCTGGGAGGCGGGTAGCCTGGGG + Intergenic
1022025579 7:26444772-26444794 TCTGGAAGGGGGTTGTCCAGAGG - Intergenic
1024064603 7:45722001-45722023 CCTGGGAGGTGGATGCCCACAGG - Exonic
1025807595 7:64849862-64849884 GCTGGGAGGCTGGTAGCCAGGGG - Intergenic
1026846263 7:73700602-73700624 CCTGGGAGGGGGCTGTCATGGGG + Intronic
1027176992 7:75910734-75910756 ACTGGGAGGAGGGAGACCAGGGG - Intronic
1028183007 7:87747893-87747915 CCTGGGAGGCGGGTAGCCTGTGG - Intronic
1029166602 7:98595855-98595877 CATGGGAGGTGGCTGTCCTGGGG + Intergenic
1029598664 7:101551027-101551049 GCGGGGAGGGGGGTGGCCAGAGG + Intronic
1029707715 7:102284601-102284623 CCTGGCAGGCGGGGGCCCATGGG - Intergenic
1029748175 7:102528355-102528377 CCTGGGAAGGGTGTGGCCAGTGG - Intergenic
1029766122 7:102627442-102627464 CCTGGGAAGGGTGTGGCCAGTGG - Intronic
1032080409 7:128855873-128855895 CCAGGGGGCCAGGTGTCCAGGGG + Intronic
1035222684 7:157415508-157415530 CCTGTGGGGAGGGTGTCCACAGG - Intronic
1035334835 7:158121185-158121207 CCAGGGAGGCTGGGGTGCAGGGG - Intronic
1035765049 8:2098996-2099018 GCTGGAACGCGGGTGTCCTGGGG - Intronic
1037768979 8:21788055-21788077 CCGGGGAGGCGGGGGGCGAGCGG - Intronic
1038266772 8:26044241-26044263 CCTGGGAGGCCGGCGGCCAGAGG - Intronic
1041364130 8:57083373-57083395 GCTGGGAGGCGGGTAGCCTGGGG + Intergenic
1045373574 8:101549493-101549515 GCCTGGAGGCTGGTGTCCAGGGG + Intronic
1045426065 8:102066943-102066965 GCTTGGAGGTAGGTGTCCAGAGG - Intronic
1045994148 8:108343076-108343098 GCTGGGAGGCGGGTAGCCTGTGG + Intronic
1046709984 8:117499702-117499724 CCAGGGAGGGTGGAGTCCAGCGG + Intergenic
1046777418 8:118179044-118179066 CATGGGAGGAGGGAGTCCTGTGG - Intergenic
1048255407 8:132901514-132901536 CCTGGGACGCGCGTGACCGGGGG + Exonic
1049229039 8:141472697-141472719 TCCTGGAGGCGGGTGTCCAGGGG + Intergenic
1049332197 8:142060528-142060550 CCTGGGAGGCCGGGCTCCTGAGG - Intergenic
1049509228 8:143019216-143019238 CCTGGGAGCCAGGTATCTAGGGG - Intronic
1049694691 8:143977448-143977470 CCTGGGAAGCAGGAGGCCAGAGG + Exonic
1049807289 8:144546794-144546816 CCTGGGAGGGTGGTGGCCACCGG - Intronic
1049867058 8:144946122-144946144 CCTGGGCTGCAGGGGTCCAGGGG + Exonic
1051042232 9:12825577-12825599 CATGGGAGGCTGGAGTACAGGGG - Intergenic
1052282474 9:26748757-26748779 CCTGGGAGTCTGATGTCCAAAGG - Intergenic
1052991861 9:34523201-34523223 CCTGGGAGGCCGGCGGCCTGCGG + Intergenic
1053149312 9:35732610-35732632 CCTGGGAGGCGGGTCCGGAGAGG + Exonic
1054810529 9:69430447-69430469 CCAGAGAGGTGGGTTTCCAGGGG + Exonic
1056108586 9:83372257-83372279 CCTGTGAGGAGGGTGTTCACTGG - Intronic
1057729776 9:97598251-97598273 CCTGGGAGGCGAGGTTGCAGTGG + Intronic
1058167793 9:101639819-101639841 CCTGTGAGGCTGGTTTCCTGGGG - Intronic
1059391520 9:114002326-114002348 CCTGGGAGGCGTGAGGCCAGTGG - Intronic
1060084797 9:120687890-120687912 GCTGGGAGGCAGGTATACAGGGG + Intronic
1060215921 9:121738113-121738135 CCTGGAAGGTGGGTGTCCAGCGG + Intronic
1060820517 9:126658995-126659017 GCTGAGAGGCGGGTGTTCTGGGG + Intronic
1060886785 9:127160279-127160301 CCTTGGGGCCGGGTGTCCTGTGG + Intronic
1061080654 9:128367887-128367909 CCCGGGAGGCTGGAGTGCAGTGG - Intergenic
1061238591 9:129356391-129356413 CCTGGGAGGCTGGGGTGCTGAGG + Intergenic
1061444032 9:130627493-130627515 CCTGGGAGGTGAGTGTCGGGGGG - Intronic
1062252091 9:135603358-135603380 CCCAGGGGGAGGGTGTCCAGAGG - Intergenic
1062268337 9:135697512-135697534 CCTGGGACGGGAGCGTCCAGCGG - Exonic
1062339008 9:136085600-136085622 CCTGGGAGGCGGCTGCCAGGGGG + Intronic
1062453155 9:136623919-136623941 CCGGGGAGGAGGGTGTGGAGTGG - Intergenic
1062481560 9:136754875-136754897 CCTGGGAGGCTGGGGTCACGGGG - Intronic
1062630634 9:137461649-137461671 ACTGGCAGGCGGGTGTCCACAGG - Intronic
1185494624 X:545004-545026 CCTGGGGAGCTGCTGTCCAGGGG + Intergenic
1187551462 X:20310155-20310177 CCTGAGATGCGGCTTTCCAGGGG + Intergenic
1188262019 X:28033815-28033837 GCTGGTAGGCTTGTGTCCAGAGG + Intergenic
1192820170 X:74636881-74636903 GCTGGTAGGCGGGTATCCTGGGG + Intergenic
1194666777 X:96684887-96684909 CCTGGGAGCCTGGAGTCCCGGGG + Exonic
1198843195 X:140880786-140880808 GCTGGGAGGCGGGTAGCCTGGGG + Intergenic
1199165900 X:144674922-144674944 CCTGGGAGGGGAGGGTACAGGGG - Intergenic