ID: 1175925532

View in Genome Browser
Species Human (GRCh38)
Location 20:62469524-62469546
Sequence GTCTCAGACGTGGCTCCGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 34}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175925532_1175925539 3 Left 1175925532 20:62469524-62469546 CCCGACGGAGCCACGTCTGAGAC 0: 1
1: 0
2: 0
3: 6
4: 34
Right 1175925539 20:62469550-62469572 GGTTGTGGAAAGAAACAAGGTGG 0: 1
1: 0
2: 1
3: 28
4: 325
1175925532_1175925540 4 Left 1175925532 20:62469524-62469546 CCCGACGGAGCCACGTCTGAGAC 0: 1
1: 0
2: 0
3: 6
4: 34
Right 1175925540 20:62469551-62469573 GTTGTGGAAAGAAACAAGGTGGG 0: 1
1: 0
2: 0
3: 24
4: 335
1175925532_1175925538 0 Left 1175925532 20:62469524-62469546 CCCGACGGAGCCACGTCTGAGAC 0: 1
1: 0
2: 0
3: 6
4: 34
Right 1175925538 20:62469547-62469569 ACGGGTTGTGGAAAGAAACAAGG No data
1175925532_1175925545 28 Left 1175925532 20:62469524-62469546 CCCGACGGAGCCACGTCTGAGAC 0: 1
1: 0
2: 0
3: 6
4: 34
Right 1175925545 20:62469575-62469597 CGCGCAGGACGTGCGTGGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 45
1175925532_1175925541 5 Left 1175925532 20:62469524-62469546 CCCGACGGAGCCACGTCTGAGAC 0: 1
1: 0
2: 0
3: 6
4: 34
Right 1175925541 20:62469552-62469574 TTGTGGAAAGAAACAAGGTGGGG 0: 1
1: 0
2: 3
3: 36
4: 356
1175925532_1175925546 29 Left 1175925532 20:62469524-62469546 CCCGACGGAGCCACGTCTGAGAC 0: 1
1: 0
2: 0
3: 6
4: 34
Right 1175925546 20:62469576-62469598 GCGCAGGACGTGCGTGGGTTGGG 0: 1
1: 0
2: 0
3: 2
4: 68
1175925532_1175925544 24 Left 1175925532 20:62469524-62469546 CCCGACGGAGCCACGTCTGAGAC 0: 1
1: 0
2: 0
3: 6
4: 34
Right 1175925544 20:62469571-62469593 GGGGCGCGCAGGACGTGCGTGGG 0: 1
1: 0
2: 0
3: 8
4: 90
1175925532_1175925542 13 Left 1175925532 20:62469524-62469546 CCCGACGGAGCCACGTCTGAGAC 0: 1
1: 0
2: 0
3: 6
4: 34
Right 1175925542 20:62469560-62469582 AGAAACAAGGTGGGGCGCGCAGG 0: 1
1: 0
2: 0
3: 34
4: 367
1175925532_1175925543 23 Left 1175925532 20:62469524-62469546 CCCGACGGAGCCACGTCTGAGAC 0: 1
1: 0
2: 0
3: 6
4: 34
Right 1175925543 20:62469570-62469592 TGGGGCGCGCAGGACGTGCGTGG 0: 1
1: 0
2: 1
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175925532 Original CRISPR GTCTCAGACGTGGCTCCGTC GGG (reversed) Intronic
904674266 1:32188854-32188876 GTCCCAGACGTTGGTCAGTCAGG + Intronic
905486303 1:38299163-38299185 ACCTCAGACGTGGCTCTGTCAGG + Intergenic
905941860 1:41869459-41869481 ATCTCAGATGTAGCTGCGTCAGG - Intronic
909468508 1:76001076-76001098 GTCTCAGGAGTGGCTCCATTCGG + Intergenic
913257933 1:116972167-116972189 CTCTCAGCCCTGGCTCCCTCGGG - Intronic
919780630 1:201218583-201218605 GTCACAGCTGTGGCTCCCTCAGG + Exonic
1064614141 10:17135337-17135359 GTCTCAGACATGGCTCCACAGGG - Intergenic
1095939269 12:47715621-47715643 GTCTCAGGGGTGGCTCTGTCCGG - Intronic
1096885947 12:54719511-54719533 GTCTGACACCTGGCTCCATCTGG + Intergenic
1104773517 12:131379368-131379390 GTCTCAGACGTGGGGCCCCCGGG - Intergenic
1104928152 12:132324469-132324491 GTCTCGGACGCGGCCCCGGCAGG - Intronic
1123979100 15:25583044-25583066 GTCTCAGCCGAGGCTCCCTGTGG - Intergenic
1129869490 15:78931581-78931603 GCCTCAGATGTGGCTCAGCCAGG - Intronic
1138437998 16:57016965-57016987 TTCTCAGATGTGTCTCCGGCAGG + Intronic
1141779739 16:86151489-86151511 TTCTCAGAGGCGGCCCCGTCCGG + Intergenic
1142646319 17:1315974-1315996 GTCCCAGGCTTGGCTCCCTCTGG + Intergenic
1143976978 17:10837309-10837331 GACAAAGACGTGGCTCAGTCAGG - Intronic
1148440865 17:47711034-47711056 TTCTCAGACGGGGCTCTGTCTGG + Exonic
1163291252 19:16380957-16380979 GTCTCTGATGTGGCTCTGACTGG - Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
927481149 2:23455124-23455146 TTCTCAGGCCTGGCTCCTTCTGG + Intronic
927693161 2:25222593-25222615 TTCTCAGACGTGGCTCTGTTTGG - Intergenic
948106598 2:235419590-235419612 GGCCCAGACGCGGCTCAGTCAGG - Intergenic
1169196963 20:3688588-3688610 GTCTCACATGTGGCTGCATCAGG + Exonic
1171045943 20:21809472-21809494 GCCTCAGCCCTGGCTCTGTCAGG + Intergenic
1175925532 20:62469524-62469546 GTCTCAGACGTGGCTCCGTCGGG - Intronic
1182312143 22:29416833-29416855 TTCTCAGACCTGGCTCCTCCAGG - Intronic
954155947 3:48685139-48685161 GTCTCAGTGGTGGCTCCAACGGG + Intronic
954850282 3:53594259-53594281 GTCTCAAAGGTGGCTCCCTCAGG + Intronic
957527519 3:81396034-81396056 GTCACAGAAGAGTCTCCGTCTGG + Intergenic
968266788 3:197368969-197368991 GTCTCTGACTTGTCTCCTTCAGG - Intergenic
976388293 4:84483909-84483931 GTGGCAGACGTGGTGCCGTCTGG + Intergenic
997642270 5:135456928-135456950 GCCTCAGACCTGAGTCCGTCTGG - Intergenic
1003338307 6:5195742-5195764 GTCTCAGAAATGGCTCCTTCAGG + Intronic
1006460652 6:34155699-34155721 GTCTCAGGCGTGGCTGCACCTGG - Intergenic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1017993569 6:159510916-159510938 GTCTCAGACATGGGTCTGACTGG + Intergenic
1037754095 8:21700358-21700380 CTCTCAGAAGTGTCTCCTTCAGG - Intronic
1039890707 8:41683596-41683618 GTCTGTGACGTGGCTTCCTCAGG - Intronic
1040729274 8:50422697-50422719 GTCTAACACCTGGCTCCATCTGG - Intronic
1185446659 X:261405-261427 GTCACAGCCGTGGCTCGGACGGG - Intergenic