ID: 1175926085

View in Genome Browser
Species Human (GRCh38)
Location 20:62472292-62472314
Sequence GGTCCCAGTGGAGCAGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1058
Summary {0: 1, 1: 0, 2: 5, 3: 76, 4: 976}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175926085_1175926094 12 Left 1175926085 20:62472292-62472314 CCACCACCTGCTCCACTGGGACC 0: 1
1: 0
2: 5
3: 76
4: 976
Right 1175926094 20:62472327-62472349 GTCCTGGTCCCCCACAGCCCAGG 0: 1
1: 0
2: 5
3: 32
4: 398
1175926085_1175926098 20 Left 1175926085 20:62472292-62472314 CCACCACCTGCTCCACTGGGACC 0: 1
1: 0
2: 5
3: 76
4: 976
Right 1175926098 20:62472335-62472357 CCCCCACAGCCCAGGGCCCCAGG 0: 1
1: 0
2: 10
3: 137
4: 890
1175926085_1175926090 -4 Left 1175926085 20:62472292-62472314 CCACCACCTGCTCCACTGGGACC 0: 1
1: 0
2: 5
3: 76
4: 976
Right 1175926090 20:62472311-62472333 GACCTCCCACGCTCAGGTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 144
1175926085_1175926089 -10 Left 1175926085 20:62472292-62472314 CCACCACCTGCTCCACTGGGACC 0: 1
1: 0
2: 5
3: 76
4: 976
Right 1175926089 20:62472305-62472327 CACTGGGACCTCCCACGCTCAGG 0: 1
1: 0
2: 0
3: 25
4: 444
1175926085_1175926095 13 Left 1175926085 20:62472292-62472314 CCACCACCTGCTCCACTGGGACC 0: 1
1: 0
2: 5
3: 76
4: 976
Right 1175926095 20:62472328-62472350 TCCTGGTCCCCCACAGCCCAGGG 0: 1
1: 0
2: 1
3: 43
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175926085 Original CRISPR GGTCCCAGTGGAGCAGGTGG TGG (reversed) Intronic
900090349 1:917602-917624 GGTCCCAGTGCTGCAGGTGTGGG + Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900603798 1:3515013-3515035 GGACCCAGAGGCCCAGGTGGGGG + Intronic
900636682 1:3669453-3669475 GGTCCAAGGGGTGGAGGTGGCGG - Intronic
901232109 1:7647090-7647112 GGTCCCTGGAGAGCAGGTGCTGG - Intronic
901751752 1:11414310-11414332 GGCCCAGCTGGAGCAGGTGGGGG + Intergenic
901761804 1:11476835-11476857 GGTGGCAGTGGAGCTGGTGCAGG - Intergenic
902853881 1:19185181-19185203 CTTTCCAGTGGAGGAGGTGGGGG + Exonic
903336076 1:22625706-22625728 GGTCCCAGTGGAGCTGTCCGGGG - Intergenic
903624649 1:24721809-24721831 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
904238845 1:29131177-29131199 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
904433733 1:30480666-30480688 GGTCCCTGTTTAGTAGGTGGAGG - Intergenic
904447543 1:30587237-30587259 GGGCCTAGTGGAGGAGGGGGAGG - Intergenic
905264660 1:36743381-36743403 GGGCCCAGCTCAGCAGGTGGGGG - Intergenic
905519425 1:38586754-38586776 GGGCACAGTGGAGCACGGGGTGG + Intergenic
905901075 1:41582285-41582307 CGTCCGTGTGGGGCAGGTGGGGG + Exonic
906032453 1:42732528-42732550 GGTGCCAGTGGAGCAGGGGTGGG - Intergenic
906117003 1:43363755-43363777 GGTCCCTGTAGAGCAGCTGTGGG + Exonic
906524252 1:46485372-46485394 GGTGGGAGTGGAGCAGGTAGCGG + Intergenic
906563464 1:46778551-46778573 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
906798751 1:48718278-48718300 GGGCCCAGGAGGGCAGGTGGAGG - Intronic
906943907 1:50279233-50279255 GGTCTCAGTGGAGAATGTGGTGG - Intergenic
907102188 1:51847411-51847433 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
907413254 1:54297128-54297150 GTTCCCACTGGAGGTGGTGGTGG - Intronic
907889545 1:58623758-58623780 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
908027702 1:59969698-59969720 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
908291392 1:62670217-62670239 GGGCGCTGTGGAGCAGGGGGTGG - Intronic
909001420 1:70221688-70221710 GGGCCCGGTGGCGGAGGTGGTGG + Exonic
909317979 1:74247933-74247955 GGGCACCGTGGAGCAGGGGGTGG + Intronic
909904514 1:81178640-81178662 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
910034718 1:82776815-82776837 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
910550345 1:88467398-88467420 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
910598465 1:89005246-89005268 TGTTCCAGTGGAGGTGGTGGAGG + Intergenic
912538705 1:110396362-110396384 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
914998405 1:152564752-152564774 GGGCTAAGTAGAGCAGGTGGAGG - Intronic
915104173 1:153522104-153522126 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
915230526 1:154442455-154442477 GGTCTGAGTGGGACAGGTGGAGG + Intronic
915578758 1:156800512-156800534 GGTCCCAGAGGTGAAGCTGGGGG - Exonic
915767112 1:158374188-158374210 GTGCGCAGTGGAGCAGGAGGTGG + Intergenic
916939075 1:169661500-169661522 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
916960333 1:169882437-169882459 GGGCTCCGTGGAGCAGGGGGCGG - Intronic
917732656 1:177891703-177891725 GATCTCAGGGGAGCAGGCGGGGG - Intergenic
918511969 1:185321748-185321770 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
918659713 1:187073849-187073871 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
918708991 1:187703947-187703969 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
918720883 1:187850529-187850551 GGGCGCCGTGGAGCAGGGGGAGG - Intergenic
919201301 1:194358303-194358325 GGGCGCCGTGGAGCAGGTGGCGG + Intergenic
919297740 1:195722998-195723020 GGAGCCCGTGGAGCAGGGGGAGG + Intergenic
919800952 1:201354336-201354358 GGTCCCAGGTGGGCAGCTGGAGG + Intergenic
919919583 1:202160208-202160230 GGTCACAGTGGGCGAGGTGGCGG + Intronic
920377960 1:205519406-205519428 GGTGACAGGGGAGCAGGCGGTGG - Intronic
920415036 1:205793439-205793461 GGTTCCAGTGCAGCACGTGGTGG - Intronic
920655006 1:207868517-207868539 GGTCCGTGTGGAGGAGGAGGCGG - Intergenic
920731320 1:208488471-208488493 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
921396330 1:214673180-214673202 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
921897144 1:220412759-220412781 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
921903782 1:220475702-220475724 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
921937898 1:220811694-220811716 CTTCCCAGTGGGGAAGGTGGGGG + Intronic
922056877 1:222050073-222050095 GGGCTCCGTGGAGCAGGGGGCGG - Intergenic
922166088 1:223116995-223117017 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
922414006 1:225403833-225403855 GGATCCAGGGGAGCTGGTGGAGG - Intronic
922673341 1:227532085-227532107 TGTTCCAGTGGAGGTGGTGGAGG + Intergenic
923167410 1:231379241-231379263 TGTGCCACTGCAGCAGGTGGTGG - Intronic
923193409 1:231641982-231642004 GGGCGCTGTGGAGCAGGGGGCGG + Intronic
923318517 1:232805539-232805561 TGCCGCAGTGGAGCAGGAGGAGG + Exonic
923771367 1:236940441-236940463 GCTAACATTGGAGCAGGTGGGGG + Intergenic
923772367 1:236948704-236948726 AGTCCCTGTGGAGCAGGTGCTGG - Intergenic
924117573 1:240762816-240762838 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
924219185 1:241855613-241855635 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
924359217 1:243218370-243218392 GGCCCCAGTGGAGGAGGCAGGGG + Intronic
1062888610 10:1038691-1038713 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888627 10:1038754-1038776 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888644 10:1038817-1038839 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888661 10:1038880-1038902 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888677 10:1038943-1038965 TGTCCCCATGGAGCAGGTGGAGG + Intergenic
1062888695 10:1039006-1039028 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888712 10:1039069-1039091 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888729 10:1039132-1039154 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888746 10:1039195-1039217 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1063109302 10:3020729-3020751 GTTCCCAGAGGAGCAGCTGCAGG - Intergenic
1063695520 10:8331492-8331514 GGTCCCAGGCAAGAAGGTGGAGG + Intergenic
1063769749 10:9183676-9183698 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1064004874 10:11691629-11691651 GCTCCCAGGGAGGCAGGTGGAGG - Intergenic
1064197841 10:13259933-13259955 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
1065538031 10:26733645-26733667 GGTTCCAGTGGATGAGGTGGAGG + Intronic
1065577376 10:27135718-27135740 ATTCCCAGTGTATCAGGTGGAGG + Intronic
1065752130 10:28896853-28896875 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1065895934 10:30163139-30163161 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1065995556 10:31056149-31056171 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
1066190320 10:33049553-33049575 GGGCGCCCTGGAGCAGGTGGTGG - Intergenic
1066234097 10:33468360-33468382 GGGCTCCGTGGAGCAGGGGGTGG - Intergenic
1066349071 10:34620030-34620052 GGTCTCTGAGGAGGAGGTGGTGG - Intronic
1066706662 10:38187279-38187301 AAACCCAGTGGAGCTGGTGGTGG - Intergenic
1067318696 10:45197995-45198017 GGGACGAGGGGAGCAGGTGGAGG - Intergenic
1067371964 10:45692668-45692690 AGCCCCTGTGGAGCTGGTGGTGG - Intergenic
1067387816 10:45833485-45833507 AGCCCCTGTGGAGCTGGTGGTGG + Intronic
1067409948 10:46055478-46055500 AGCCCCAGAGCAGCAGGTGGGGG + Intergenic
1067418307 10:46123779-46123801 AGCCCCTGTGGAGCTGGTGGTGG - Intergenic
1067419483 10:46133949-46133971 GGTCCCACAGGAGCAGGCGGGGG + Intergenic
1067426533 10:46215462-46215484 GGTGCCACAGGAGCAGGCGGGGG - Intergenic
1067446456 10:46351127-46351149 GGCCCCTGTGGAGCTGGTGGTGG - Intergenic
1067503665 10:46830363-46830385 AGCCCCTGTGGAGCTGGTGGTGG - Intergenic
1067504834 10:46840546-46840568 GGTCCCACAGGAGCTGGCGGGGG + Intergenic
1067590926 10:47509640-47509662 GGCCCCTGTGGAGCTGGTGGTGG + Intronic
1067638045 10:48017740-48017762 GGCCCCTGTGGAGCTGGTGGTGG + Intergenic
1067875448 10:50002605-50002627 AGCCCCTGTGGAGCTGGTGGTGG - Intronic
1068803943 10:61173586-61173608 GTTCCCAGAGCAGCCGGTGGAGG - Intergenic
1068863221 10:61867971-61867993 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1069186473 10:65429441-65429463 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1069707396 10:70467394-70467416 GGTCCCAGTGGTGGAGGTGGGGG + Intergenic
1069988731 10:72300930-72300952 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1069993025 10:72326281-72326303 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
1070134645 10:73682163-73682185 GGCCCCTGTGGAGCTGGTGGTGG + Intronic
1070370691 10:75779314-75779336 GGTCCCAGAGGAGAATGTGGTGG - Intronic
1070564045 10:77590314-77590336 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
1070590147 10:77795404-77795426 TGCCCCAGTGGAGCATCTGGGGG - Intronic
1070968359 10:80543541-80543563 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
1071037428 10:81264947-81264969 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1071607091 10:87002245-87002267 AGCCCCTGTGGAGCTGGTGGTGG - Intergenic
1072737535 10:97889187-97889209 ACTCCCAGTGGAGCTGGCGGAGG + Intronic
1072890049 10:99315941-99315963 GGTCCGAGAGCAGCAGGTGGCGG - Intergenic
1073051198 10:100668411-100668433 CGTCCCAGGGGGGCAGTTGGAGG - Intergenic
1073190423 10:101646910-101646932 AGTCCCAGTGGAGCCGGAGTTGG + Intronic
1073513467 10:104057121-104057143 GGTGGCAGTGGAGGAGGTGGCGG - Exonic
1073540947 10:104315832-104315854 GGAGGCACTGGAGCAGGTGGCGG - Exonic
1073789721 10:106928138-106928160 GGGCGCCGTGGAGCAGGCGGCGG + Intronic
1074098186 10:110331793-110331815 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1074317209 10:112370652-112370674 GGGCGCAGTGGAGCAGGGGCCGG - Intergenic
1075158837 10:120004902-120004924 TTTCCCACTGGAGCTGGTGGGGG + Intergenic
1075307668 10:121382446-121382468 GGGCACGGTGGAGCAGGGGGCGG - Intergenic
1075504953 10:123013535-123013557 GGGTGCAGTGGAGCAGGGGGTGG + Intronic
1075704929 10:124494837-124494859 AGTCCCTGTGGAGCAGGCTGGGG + Intronic
1076234150 10:128850836-128850858 ATTCCCAGTGGAGGAGATGGAGG - Intergenic
1076309383 10:129493297-129493319 GGCCCCAGTGGAGCGTCTGGAGG + Intronic
1076434029 10:130427345-130427367 GGTGCCTTTGGAGCAGGTGGAGG + Intergenic
1076585760 10:131546435-131546457 TGTGCCTGTGGAGAAGGTGGAGG - Intergenic
1076619579 10:131778639-131778661 GGGGCCAGTGCAGCTGGTGGTGG + Intergenic
1076892913 10:133293564-133293586 GGTCACAGCGGAGTAGCTGGCGG + Exonic
1077231386 11:1459532-1459554 GGTCCCACTGGTGCAGGCTGTGG + Intronic
1077556638 11:3229108-3229130 GGTCCCTGTAGGCCAGGTGGGGG + Intronic
1077603278 11:3589007-3589029 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1077815650 11:5683231-5683253 GGGCGCCGTGGAGCAGGGGGCGG - Intronic
1078084332 11:8224758-8224780 GGTCCCAGTGGGTAAGGGGGGGG + Intronic
1078150873 11:8758782-8758804 GAGCCGAGTGGACCAGGTGGAGG - Intronic
1078743642 11:14091360-14091382 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
1078933740 11:15934617-15934639 GAACCCAGTGAAGTAGGTGGTGG + Intergenic
1079555377 11:21753175-21753197 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1079731706 11:23942311-23942333 GGGCACTGTGGAGCAGGGGGTGG + Intergenic
1079767725 11:24416033-24416055 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1080107453 11:28525830-28525852 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1080346862 11:31335195-31335217 GGACCCACTGAAGCAGGTGCGGG + Intronic
1080557642 11:33431777-33431799 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1081120812 11:39263182-39263204 GGTCACACTGGAGCAAGAGGTGG + Intergenic
1081126887 11:39333102-39333124 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1081428436 11:42950213-42950235 GGGCGCAGTGGAGCAGGGGGCGG - Intergenic
1081657271 11:44865797-44865819 GGTCTCAGTGGAGCAGGAACAGG + Intronic
1081806674 11:45894637-45894659 AGTTCGAGAGGAGCAGGTGGAGG + Intronic
1083194812 11:61079518-61079540 GCTCAGAGTGGAGCAGGGGGAGG - Intergenic
1083455442 11:62775761-62775783 GGCCCCAGTGGAGCTGGGAGTGG - Exonic
1083469985 11:62877791-62877813 AGTGCCTGTGAAGCAGGTGGTGG + Intronic
1083903322 11:65654475-65654497 GCCCCCAGTGGAGCAGGAGCTGG + Exonic
1084240653 11:67817690-67817712 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1084259177 11:67963550-67963572 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1084562026 11:69910625-69910647 TGGCCCAGTGGAGCTTGTGGTGG + Intergenic
1084621397 11:70272212-70272234 GGCCCCCCTGGAGGAGGTGGAGG + Exonic
1084831774 11:71775022-71775044 GGGCGCAGTGGAGCAGGGGGCGG - Intergenic
1085403171 11:76246543-76246565 GCTCCCTGTGTGGCAGGTGGTGG + Intergenic
1085530552 11:77189750-77189772 GGTCAGAGTGGAGCAGGTCATGG + Intronic
1085671044 11:78465003-78465025 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
1085982742 11:81744539-81744561 GGGCACAGTGCAGCAGGGGGTGG + Intergenic
1086043083 11:82501485-82501507 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1086491262 11:87359879-87359901 GGTCCGAGGGGAGTCGGTGGGGG - Intergenic
1086724683 11:90167469-90167491 GGTCGCCGTGGAGCAGGAAGCGG - Intronic
1086908580 11:92445746-92445768 GGGTGCAGGGGAGCAGGTGGTGG + Intronic
1087486339 11:98763442-98763464 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1088481667 11:110300970-110300992 GGTGCCGGTGGAGCAGGGGGCGG + Intergenic
1088570928 11:111222304-111222326 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1088911829 11:114197959-114197981 GGTCCCAGAGGAGCTGGGAGGGG + Intronic
1088929911 11:114341047-114341069 GGCAGCAGTTGAGCAGGTGGTGG + Intergenic
1089666913 11:120026227-120026249 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1089775845 11:120835192-120835214 GCTCCCTGAGGAGCAGGTCGGGG - Intronic
1089800294 11:121021987-121022009 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1089956133 11:122573214-122573236 GGTCTGAGTGGATTAGGTGGGGG - Intergenic
1090133512 11:124170754-124170776 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1091066143 11:132514989-132515011 GGGCTAAGTGGAGCAGGAGGAGG + Intronic
1091138122 11:133211232-133211254 GGTCCCAGTGAGTGAGGTGGTGG + Intronic
1091201253 11:133782626-133782648 GGGCACAGTAGAGCAGGGGGCGG - Intergenic
1091206891 11:133827777-133827799 GGTCCCTCAGGAGCAGCTGGTGG + Intergenic
1091282906 11:134391968-134391990 GGTCCCCGTGGAGCACCTGCCGG - Exonic
1091407810 12:220150-220172 CGCCCCAGTGCAGCAGGTTGGGG - Intergenic
1092087019 12:5770924-5770946 GGTGACATTGGAGCAGATGGAGG - Intronic
1092135254 12:6142524-6142546 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1092137481 12:6159801-6159823 GGTGCCAGTGGAGCAGCGGGCGG - Intergenic
1092272975 12:7037748-7037770 GGGCGCCGTGGAGCAGGGGGCGG - Intronic
1092336731 12:7640166-7640188 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1092364106 12:7862513-7862535 GGGCGCCGTGGAGCAGGGGGCGG - Intronic
1092527067 12:9315809-9315831 GGTCCCAGGACAGCAGGTGCTGG - Intergenic
1092540202 12:9415963-9415985 GGTCCCAGGACAGCAGGTGCTGG + Intergenic
1092617100 12:10225661-10225683 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1092834174 12:12472467-12472489 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1093189453 12:16057702-16057724 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1093266327 12:17007951-17007973 GGGCGCTGTGGAGCAGGCGGTGG - Intergenic
1093450352 12:19306596-19306618 GGGCCCAGTAGCGGAGGTGGTGG + Intronic
1093524745 12:20093354-20093376 GGGCACCGTGGAGCAGGGGGCGG + Intergenic
1093652601 12:21661855-21661877 GGGCGCAGTGGAGCAGGGGGCGG - Intronic
1093653860 12:21674040-21674062 GGGCGCAGTGGAGCAGGGGGCGG + Intronic
1093970261 12:25369693-25369715 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1093973009 12:25391756-25391778 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1094512840 12:31106493-31106515 GGTCCCAGGACAGCAGGTGCCGG - Intergenic
1094661335 12:32472619-32472641 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
1094666536 12:32525999-32526021 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
1095487343 12:42698980-42699002 GATTCCAGTAGAGAAGGTGGAGG + Intergenic
1095534013 12:43224607-43224629 GGGCGCAGTGGAGCAGGGGATGG - Intergenic
1095959714 12:47826646-47826668 GGGCCCAGTGGAGCAAGTAATGG - Intronic
1096240315 12:49956300-49956322 GGGCCCAGCGCTGCAGGTGGGGG - Exonic
1096256123 12:50063388-50063410 GGTCTCAGCGGAGGAGGGGGTGG - Intronic
1096593723 12:52680218-52680240 CGCCGCAGTGGAGGAGGTGGTGG - Exonic
1097128886 12:56795872-56795894 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1097212980 12:57386596-57386618 GGGCGCGGTGGAGCAGGGGGCGG - Intronic
1097664149 12:62461307-62461329 GGGCGCAGTGGAGCAGGGGGCGG + Intergenic
1098322365 12:69258820-69258842 GGTCCCTGTTGTGGAGGTGGTGG - Exonic
1098588728 12:72185373-72185395 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
1098759289 12:74403274-74403296 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
1099192478 12:79574199-79574221 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
1099204408 12:79711266-79711288 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
1099559573 12:84155156-84155178 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1099716182 12:86296435-86296457 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
1100211833 12:92406551-92406573 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1100521506 12:95379912-95379934 GGGCACCGTGGAGCAGGGGGTGG - Intronic
1100734585 12:97512818-97512840 GGGCGCAGTGGAGCAGGGGGCGG + Intergenic
1101021676 12:100559709-100559731 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
1101429987 12:104618872-104618894 GACCCCAGTTGAGCTGGTGGAGG - Intronic
1101461913 12:104905545-104905567 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
1101970288 12:109308041-109308063 GGTCCCACTGGGCCAGGTTGTGG + Intronic
1102005958 12:109589346-109589368 GGTGCCACGGGAGCAGATGGCGG + Intronic
1102205029 12:111084311-111084333 GTTTCTAGGGGAGCAGGTGGAGG + Intronic
1103146095 12:118597209-118597231 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1103439173 12:120950359-120950381 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1103727047 12:123003201-123003223 GTTCTCAGAGGAGCAGGAGGAGG - Intronic
1103815957 12:123656651-123656673 GCTACCAGTGGAGCAGGAAGAGG - Intronic
1103851286 12:123935164-123935186 GGTCCCCGTGAAGCTGGCGGAGG + Intronic
1103915148 12:124372305-124372327 GCCCCCAGTGGAGGAGGGGGAGG - Exonic
1104154706 12:126120253-126120275 GGTGCCAGTCCAGCAGCTGGGGG - Intergenic
1104582687 12:130022382-130022404 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1104614465 12:130256687-130256709 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1104639341 12:130457489-130457511 AGTCCCAGGGGAGCAGGGAGCGG - Intronic
1104749293 12:131228139-131228161 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1104927310 12:132320641-132320663 GGACACGGTGGAGGAGGTGGAGG + Intronic
1105034423 12:132908493-132908515 GGTCCCAGAGGGGCGGGTCGGGG + Intronic
1105037804 12:132939081-132939103 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
1105223871 13:18409158-18409180 GGGACGAGGGGAGCAGGTGGAGG + Intergenic
1105722221 13:23127898-23127920 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1106221276 13:27748347-27748369 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
1106387214 13:29299455-29299477 TGTCCCTGTGGAGCTGATGGGGG + Intronic
1106600511 13:31183085-31183107 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1106617014 13:31339699-31339721 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
1106643384 13:31608862-31608884 GGGCACCGTGGAGCAGGGGGCGG + Intergenic
1106810999 13:33358308-33358330 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
1106978617 13:35251824-35251846 GGTAGCACTAGAGCAGGTGGAGG - Intronic
1107590413 13:41898612-41898634 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
1108608999 13:52065488-52065510 AGGCCCCGTGGGGCAGGTGGAGG + Exonic
1108643928 13:52408108-52408130 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1108685413 13:52815290-52815312 GGGCGCTGTGGAGCAGGTAGCGG + Intergenic
1108750167 13:53439975-53439997 GGTCGCAGCGGAGCAGGGGGTGG - Intergenic
1108751487 13:53452427-53452449 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
1108817149 13:54305657-54305679 TGTTCCAGTGGAGGTGGTGGGGG - Intergenic
1109159825 13:58958215-58958237 GGGCGCTGTGGAGCAGGCGGTGG + Intergenic
1109319287 13:60790111-60790133 GGTTGCAATGGAGCAGGTGCTGG + Intergenic
1109364684 13:61339496-61339518 CGGCGCAGTGGAGCAGGGGGCGG - Intergenic
1109506193 13:63306059-63306081 GGGCGCGGTGGAGCAGGGGGCGG - Intergenic
1110002960 13:70229198-70229220 GATCCCAATGTAGGAGGTGGAGG + Intergenic
1110024023 13:70511944-70511966 GGGTCCTGTGGAGCAGGGGGCGG + Intergenic
1110255690 13:73431343-73431365 GGTGACAGTGGTGAAGGTGGTGG + Intergenic
1110633765 13:77740860-77740882 GGTTACAGTGGAGGAGGAGGAGG - Intronic
1110792351 13:79600191-79600213 GGGCGCAGTGGAGCAGGGGATGG + Intergenic
1110940245 13:81340804-81340826 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1110999791 13:82164980-82165002 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1111441954 13:88292147-88292169 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1111556127 13:89883899-89883921 GGCCGCCGTGGAGCAGGGGGCGG + Intergenic
1111602773 13:90495107-90495129 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1111747722 13:92291173-92291195 GGGCACAGTGGAGCAGGGGGTGG - Intronic
1112533120 13:100224082-100224104 GGGCACCGTGGAGCAGGGGGCGG + Intronic
1112613149 13:100976023-100976045 GGGCTCCGTGGAGCAGGGGGTGG - Intergenic
1113371903 13:109732702-109732724 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1113538080 13:111083905-111083927 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1113619116 13:111701107-111701129 GGTTCCACTAGAGGAGGTGGAGG + Intergenic
1113624645 13:111786368-111786390 GGTTCCACTAGAGGAGGTGGAGG + Intergenic
1113806652 13:113113994-113114016 GGGCCCTGGGGAGCTGGTGGAGG + Intronic
1114008018 14:18333984-18334006 GGGACGAGGGGAGCAGGTGGAGG + Intergenic
1114560260 14:23584914-23584936 GGGCGCAGTGGAGCAGGGGGTGG + Intergenic
1114593587 14:23892085-23892107 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1116114452 14:40629674-40629696 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1116311058 14:43326930-43326952 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1116390574 14:44385070-44385092 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1116653815 14:47626840-47626862 GGGCGCTGTGGAGCAGGGGGCGG - Intronic
1117082636 14:52167070-52167092 GGGCACTGTGGAGCAGGGGGCGG - Intergenic
1117135136 14:52728339-52728361 GGTCCCTGTTGAGGATGTGGAGG + Exonic
1117449859 14:55839794-55839816 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1118558866 14:67056757-67056779 GGGCGCTGTGGAGCAGGGGGTGG + Intronic
1118841763 14:69518816-69518838 GGCTCAAGTGGAGCTGGTGGTGG + Intronic
1118923825 14:70173579-70173601 GTTCCCATTGGAGAAAGTGGAGG - Intronic
1119027820 14:71167820-71167842 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1119300272 14:73566366-73566388 GGGCTCCGTGGAGCAGGGGGCGG + Intergenic
1119486832 14:74994476-74994498 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1119805937 14:77482493-77482515 GGCCCCAGGGGAGAAGGGGGAGG - Exonic
1120034240 14:79678140-79678162 GGGGCCAGTGGAGTAGGGGGAGG - Intronic
1120331030 14:83092711-83092733 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1120704707 14:87734764-87734786 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1121175833 14:91890038-91890060 CTTCCCACTGGAGCAGGAGGGGG - Intronic
1121321643 14:92995055-92995077 GCTCCCAGTGGTGGTGGTGGTGG - Intronic
1121350610 14:93170150-93170172 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1121433412 14:93903203-93903225 GTTTGCTGTGGAGCAGGTGGAGG + Intergenic
1121619102 14:95333808-95333830 GGTCCCAGGGGAGAAGGCAGGGG + Intergenic
1121893069 14:97616032-97616054 GGTGCCAGTGGTGATGGTGGTGG + Intergenic
1122181211 14:99956130-99956152 GAGCCCCGTGGGGCAGGTGGAGG - Intergenic
1122289827 14:100674589-100674611 CGTCCCAGTGGAGAAGGAGTGGG + Intergenic
1122444343 14:101758352-101758374 TGTCCCAGAGGAGCAGGGGTTGG + Intergenic
1122493405 14:102135544-102135566 GGGCGCCGTGGAGCAGGAGGTGG + Intronic
1122718385 14:103708447-103708469 GGTCCCAGTGGTGCAGGGCAGGG - Intronic
1122976325 14:105172333-105172355 GCTCCAAGAGGAGCAGGTGGCGG - Intergenic
1123131894 14:105994062-105994084 GGTCACACTGGAGGAGGTGTTGG + Intergenic
1202854832 14_GL000225v1_random:43709-43731 TGTCCCAGGGGAGCCTGTGGTGG + Intergenic
1123681775 15:22768971-22768993 GGAGCAAGAGGAGCAGGTGGGGG - Intergenic
1123949080 15:25253226-25253248 GGGCACCGTGGAGCAGGGGGCGG + Intergenic
1124380771 15:29162913-29162935 TGTTCCAGTGGAGGTGGTGGGGG - Intronic
1124387811 15:29224826-29224848 GGGCACCGTGGAGCAGGGGGCGG + Intronic
1124952599 15:34337643-34337665 GGTCCCAGTAGAGGAGGAGACGG + Exonic
1125307354 15:38334306-38334328 GGTCCAAGTGGTAGAGGTGGGGG + Intronic
1125522320 15:40355070-40355092 GGGCCCTGTGGAGCAGGGCGGGG - Intronic
1125609747 15:40961945-40961967 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1125631636 15:41151966-41151988 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1126128131 15:45314420-45314442 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1127047559 15:55043187-55043209 GGTACCAGTGGTGGTGGTGGTGG + Intergenic
1127211647 15:56779974-56779996 GGGCGCCGTGGAGCAGGGGGCGG - Intronic
1127834845 15:62782647-62782669 GGTCGCAGTGGAGCAGCACGTGG + Intronic
1127984829 15:64061213-64061235 GGGCTCTGTGGAGCAGGGGGTGG - Intronic
1128308217 15:66613861-66613883 GGTCTGAGTGGAGGAGGAGGAGG + Intronic
1128385207 15:67142815-67142837 GGGCCCTGTGGGGCAGCTGGTGG + Exonic
1128669933 15:69567391-69567413 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1129129859 15:73483958-73483980 GGCCCCAGGGGAGTTGGTGGGGG - Intronic
1129153535 15:73703675-73703697 GGTCCCTGAGGACCCGGTGGTGG + Exonic
1129256122 15:74335110-74335132 GCTCCCAGGGGTTCAGGTGGTGG + Intronic
1129280347 15:74480378-74480400 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1129777453 15:78246170-78246192 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1129831923 15:78676268-78676290 GGTCCTTATGGAGGAGGTGGAGG + Intronic
1129859217 15:78847201-78847223 GGGCGCGGTGGAGCAGGGGGCGG - Intronic
1130132917 15:81158949-81158971 GGGCACCGTGGAGCAGGCGGCGG - Intergenic
1130643995 15:85707397-85707419 GTTCCCAGAGGTGCATGTGGGGG + Intronic
1131174370 15:90201068-90201090 GGTCCCAGAGGAGCCGGAAGGGG + Intronic
1131451154 15:92541356-92541378 GGTCCAACTGGAACAGCTGGTGG + Intergenic
1131892137 15:96984208-96984230 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1132013996 15:98300095-98300117 GGCCCAAGTGGAGAAGCTGGTGG - Intergenic
1132044253 15:98550040-98550062 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1132098827 15:99008309-99008331 GGGTCCTGTGGAGCAGGGGGCGG + Intergenic
1132155796 15:99494710-99494732 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1132837370 16:1960806-1960828 GGTCCCTGTGCAGCTGGGGGAGG + Intronic
1133310777 16:4845497-4845519 GGTCACATTGGAGCAGGGGTGGG - Intronic
1134056778 16:11175054-11175076 GGTACCTGTAGAGCAAGTGGAGG - Intronic
1135262075 16:20989675-20989697 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
1135280904 16:21152925-21152947 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
1135420866 16:22304754-22304776 GGTCCAGGAGGGGCAGGTGGAGG + Intronic
1135751013 16:25058943-25058965 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1136065486 16:27755484-27755506 GCTCCCTGTGGAGCAGGCTGAGG - Intronic
1136586610 16:31190334-31190356 TTTCCCAGTGGAGGTGGTGGCGG + Exonic
1137378564 16:47976411-47976433 GGACTCAGTGGAGCAGGTTGAGG - Intergenic
1137442558 16:48509015-48509037 GGGCACTGTGGAGCAGGGGGCGG - Intergenic
1138535169 16:57656110-57656132 GGTCCAAATGGGGCGGGTGGTGG + Intronic
1138678896 16:58671186-58671208 GGTGCCAGTGGAGGAGGACGTGG - Exonic
1139125492 16:64072361-64072383 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1139442355 16:66974556-66974578 GGGCGCTGTGGAGCAGGGGGCGG - Exonic
1139482217 16:67236838-67236860 AGGCCCAGTGGAGGAGGTGGGGG + Intronic
1139603105 16:67998543-67998565 GGGCGCTGTGGAGCAGGGGGCGG - Intronic
1139825621 16:69754886-69754908 GGCTCCAGTGGAGCACGTTGTGG - Exonic
1140722470 16:77784417-77784439 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1141624657 16:85254882-85254904 GGTCCCAGTGCTGGAGGTGGAGG + Intergenic
1141755459 16:85987804-85987826 GGTCCCAGAGGAGGATGGGGAGG - Intergenic
1141984779 16:87572685-87572707 GGTCCCACAGGTGCAGGTGCTGG + Intergenic
1142059655 16:88021128-88021150 GGGCCCAGGGGAGAGGGTGGTGG - Intronic
1142217808 16:88838416-88838438 GGTCCCAGGAGAGCGGTTGGTGG - Intronic
1142505717 17:361921-361943 GGGCGCTGTGGAGCAGGGGGTGG - Intronic
1142641964 17:1289448-1289470 GGTTTCAGAGGAGCCGGTGGGGG - Intronic
1142741420 17:1934026-1934048 GGCCACAGGGGAGCAGGTGCAGG + Intergenic
1143474830 17:7196628-7196650 GGTCCAGGTGGAGCAGGGAGTGG + Intronic
1143682845 17:8490504-8490526 GGCCCTAGAGCAGCAGGTGGAGG - Exonic
1143726507 17:8850577-8850599 GGTCACAGTGGAGCAGACAGAGG - Intronic
1144128132 17:12221191-12221213 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1144139625 17:12336271-12336293 TGTTCCAGTGGAGGTGGTGGGGG + Intergenic
1144467199 17:15506016-15506038 GGGCGCTGTGGAGCAGGGGGTGG - Intronic
1144533153 17:16059785-16059807 AGTACCAGAGGAGCAGGTGGTGG - Intronic
1144788159 17:17843219-17843241 GGTCCCAGATGGGCAGGAGGAGG - Intergenic
1145050249 17:19654345-19654367 GGGCGCTGTGGAGCAGGGGGCGG + Intronic
1145094884 17:20016752-20016774 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
1146584266 17:34068817-34068839 GCCCTCAGGGGAGCAGGTGGTGG + Intronic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1146911625 17:36651976-36651998 GGTCCCAGGGCAGGGGGTGGTGG - Intergenic
1147166804 17:38597880-38597902 GCTGCCAGTGGACCAGGAGGGGG + Intronic
1147373672 17:40011261-40011283 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1147535021 17:41315271-41315293 TGTCCCCCTGGAGCAGATGGAGG + Exonic
1147557704 17:41489823-41489845 AGACCCAGTGGAGAAGGTAGGGG + Exonic
1147558573 17:41495294-41495316 GGCCCCAGGGGAGAAGGTGGTGG - Intergenic
1147570452 17:41567478-41567500 GGTCATAGTGGAGGAAGTGGGGG - Exonic
1147786263 17:42980696-42980718 GGCCCCAGTGGGGGCGGTGGCGG + Exonic
1148857051 17:50584581-50584603 GGGCCCAGGGGAGCCGGGGGCGG + Intronic
1149099212 17:52884008-52884030 GGGCGCTGTGGAGCAGGGGGCGG + Intronic
1149410856 17:56405047-56405069 TGTTCCAGTGGAGGTGGTGGTGG + Intronic
1149500530 17:57149110-57149132 GGTCGCAGTGGGGCACGAGGGGG - Intergenic
1149582840 17:57763211-57763233 GCTCCTGGTGAAGCAGGTGGGGG - Intergenic
1149916441 17:60613944-60613966 GGGCACCGTGGAGCAGGGGGTGG - Intronic
1150148748 17:62792814-62792836 GGTGGCAGTGGAGGTGGTGGTGG - Intronic
1150148843 17:62793208-62793230 GGTGGCAGTGGAGGTGGTGGTGG - Intronic
1150148926 17:62793535-62793557 GGTGGCAGTGGAGGTGGTGGTGG - Intronic
1150569566 17:66374205-66374227 GGTGCTAGTTGAGGAGGTGGTGG - Intronic
1150614977 17:66763360-66763382 GGTCCCACAGTAGCAAGTGGAGG + Intronic
1150632165 17:66887411-66887433 GGTGCCAGTGGAGAGGGAGGGGG - Intergenic
1150786709 17:68169391-68169413 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1150804561 17:68308945-68308967 GGGCGCTGTGGAGCAGGGGGTGG + Intronic
1151308715 17:73280405-73280427 GGACCCGCTGGGGCAGGTGGCGG + Intergenic
1151398106 17:73838466-73838488 GGTCCCAGGGGAGCCAGTGAGGG - Intergenic
1151653354 17:75483789-75483811 GGTCCCTGTGAAGCAGCTGTAGG + Intronic
1151701232 17:75743641-75743663 GGTCACAGGAGAGCAGGAGGTGG + Intronic
1151787046 17:76280115-76280137 GGACCCAGTGAAGCAGTTGCTGG - Exonic
1151945777 17:77319244-77319266 GGGCTCAGCAGAGCAGGTGGGGG - Intronic
1152267881 17:79306784-79306806 GGTGCCCGTGGAGCTGGGGGTGG - Intronic
1152573417 17:81130227-81130249 GTTCCCAGAGGAGCTGGGGGTGG + Intronic
1152618995 17:81352066-81352088 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1153331504 18:3879633-3879655 GGACCGAGTGCACCAGGTGGCGG + Exonic
1153644006 18:7178699-7178721 GGGCACCGTGGAGCAGGGGGAGG + Intergenic
1154057191 18:11023680-11023702 GGGCACTGTGGAGCAGGGGGCGG + Intronic
1154231107 18:12557179-12557201 GGTCGCCGCGGAGCAGGGGGTGG + Intronic
1154255260 18:12776879-12776901 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1154475296 18:14748728-14748750 GGGACGAGGGGAGCAGGTGGAGG + Intronic
1154529434 18:15329956-15329978 GGGACGAGGGGAGCAGGTGGAGG - Intergenic
1155207997 18:23577662-23577684 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
1155772923 18:29723845-29723867 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1155936870 18:31763592-31763614 GGTCCCAGTGGTTTGGGTGGTGG - Intergenic
1156038720 18:32794902-32794924 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1156337370 18:36183632-36183654 GGTCCTGGAGGAGGAGGTGGGGG - Intergenic
1156629008 18:38944440-38944462 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1157086018 18:44581061-44581083 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1157727965 18:49979287-49979309 GGGCCCAGTGGAAAAGGAGGAGG - Intronic
1157979751 18:52366936-52366958 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
1158351971 18:56572618-56572640 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1158460691 18:57643692-57643714 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1158697211 18:59714125-59714147 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1158705704 18:59790484-59790506 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1159056935 18:63475576-63475598 GGCATCAGTGGAGCAAGTGGAGG - Intergenic
1159427679 18:68310633-68310655 GGTTTCAGTGGAGCAGATTGGGG - Intergenic
1159472894 18:68880028-68880050 GGGCGCTGTGGAGCAGGGGGCGG + Intronic
1159656055 18:71031370-71031392 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1160176568 18:76600163-76600185 GGGCCCCGTGGAGCAGGGGGTGG + Intergenic
1160198606 18:76777572-76777594 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
1160231804 18:77054443-77054465 GGCCCCTGGGGAACAGGTGGAGG + Intronic
1160690911 19:460457-460479 GGTCCCGGAGGAGAGGGTGGGGG + Intronic
1160861310 19:1238173-1238195 GGTCCCAGGGACGCAGCTGGGGG + Intergenic
1160881664 19:1323555-1323577 GGTCTCGGTGCAGGAGGTGGAGG + Intergenic
1161032051 19:2062067-2062089 GGTCACAGAGGAGCTGGGGGGGG + Intergenic
1161203273 19:3027994-3028016 GGACCCCGTGGAGCTGGGGGGGG - Intronic
1161203286 19:3028012-3028034 GGTCCCAGAGGAGGAAGCGGGGG + Intronic
1161346123 19:3769660-3769682 TGGCCCAGTGCAGCAGGAGGGGG - Exonic
1161591627 19:5131616-5131638 GGGCACAGGGGAGCTGGTGGCGG + Intronic
1161741159 19:6021946-6021968 AGTCGAAGTGGAGGAGGTGGGGG + Intronic
1162071532 19:8155213-8155235 GGTCCCAGTGGGCGATGTGGTGG - Intronic
1162179838 19:8860910-8860932 GGTACCAGTGGAATTGGTGGAGG - Intronic
1162814677 19:13186737-13186759 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG + Exonic
1163298721 19:16429758-16429780 GGTCCCCGTGGAGTCTGTGGAGG - Intronic
1163715587 19:18870449-18870471 GGTCCCAGGGGAGGTGGCGGCGG + Exonic
1164143985 19:22499021-22499043 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
1164310508 19:24041642-24041664 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
1164854480 19:31510531-31510553 GGACAGAGAGGAGCAGGTGGAGG + Intergenic
1164854484 19:31510557-31510579 GAGTCCAGAGGAGCAGGTGGGGG - Intergenic
1164862373 19:31572269-31572291 AGGACCAGTGGAGCAGGCGGAGG - Intergenic
1164897647 19:31891139-31891161 GAAGCCAGTGGAGCAGGAGGAGG - Intergenic
1166232480 19:41433264-41433286 GGTCTCACTGGAGGTGGTGGAGG + Exonic
1166308872 19:41951319-41951341 GGTCCCAGGGCCGGAGGTGGTGG - Intergenic
1166336973 19:42114167-42114189 GGTCCCTGGGGAGCTGGGGGAGG + Intronic
1166604205 19:44126427-44126449 TGTTCCAGTGGAGGTGGTGGGGG + Intronic
1166649684 19:44563274-44563296 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1167006966 19:46782528-46782550 GGTGCCCGTGGGGCAGGAGGTGG - Exonic
1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG + Intronic
1167455926 19:49596729-49596751 GGACCGAGGGGAGCAGCTGGGGG - Exonic
1167498884 19:49834705-49834727 GGTCCATGAGGAGCAGGTGGTGG + Intronic
1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG + Intronic
1167587272 19:50382291-50382313 GCTCCCAGTCGAGCAGGGTGGGG - Intronic
1168332984 19:55580491-55580513 GGTCCCGGTGGAGGAGGGGCTGG + Intronic
1168406814 19:56114785-56114807 GGTACCAGGGCAGCAGGTGCTGG - Intronic
925098926 2:1229631-1229653 GGGCGCTGTGGAGCAGGGGGCGG + Intronic
925134023 2:1514211-1514233 GGCCCCAGTAGAGCAGGAAGTGG - Intronic
925165073 2:1710878-1710900 GGTGCTGGTGGAGCAGGTGCTGG - Intronic
925173436 2:1766765-1766787 GCTCCCAGAGGAGCAGGTGCAGG + Intergenic
925338097 2:3113383-3113405 GGTCTGAGTGGAGGAGCTGGGGG - Intergenic
925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG + Intergenic
926125246 2:10267876-10267898 GTTCCCTGAGGAGCAGGTGGAGG - Intergenic
926314308 2:11697977-11697999 AGTCCTGGTGGAGCCGGTGGTGG + Intronic
927054394 2:19356061-19356083 GCACCCAGAGGAGCAGGGGGAGG - Intronic
927492869 2:23532109-23532131 GGCCCCAGTGGAGCGGGTTCTGG - Intronic
927497324 2:23559682-23559704 GGTACCTGTGGAACAGCTGGGGG + Intronic
927777842 2:25915789-25915811 GGGCGCCGTGGAGCAGGAGGCGG - Intergenic
927927483 2:27023964-27023986 GGGGCAAGTGGAGAAGGTGGAGG + Intronic
927942148 2:27111546-27111568 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
928167227 2:28980179-28980201 GGTCCCTCTGGGGCAGGTGCTGG - Intronic
928407264 2:31024185-31024207 GGTGACAGTGGTGCAGGTGCTGG - Intronic
928723072 2:34142567-34142589 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
928753244 2:34494621-34494643 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
928936948 2:36688588-36688610 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
929201905 2:39244603-39244625 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
929379736 2:41335918-41335940 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
929890819 2:45917703-45917725 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
930593440 2:53356758-53356780 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
931657589 2:64524363-64524385 GGTCTCCGCGGAGGAGGTGGAGG + Exonic
932178326 2:69622368-69622390 GGGCGCTGTGGAGCAGGGGGTGG - Intronic
932180526 2:69642884-69642906 GGTCACAGTGGACGAGGTGTTGG - Exonic
932239979 2:70148633-70148655 GGGCACTGTGGAGCAGGGGGTGG - Intergenic
932359473 2:71092520-71092542 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
932663761 2:73679840-73679862 GGTCCCAGTGACACAGATGGAGG + Intergenic
932902095 2:75711902-75711924 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
933712112 2:85334446-85334468 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
934604484 2:95683406-95683428 GGTCCCAGGGGATCAGGGTGTGG - Intergenic
934898543 2:98139330-98139352 GGGCACCGTGGAGCAGGGGGTGG - Intronic
935849647 2:107204742-107204764 GGACCTGGTGGAGCAGGTGGAGG - Intergenic
935872795 2:107469457-107469479 GGGCTCAGCGGAGCAGGAGGAGG + Intergenic
936172664 2:110190265-110190287 GGGCACTGTGGAGCAGGGGGTGG + Intronic
936263276 2:110980156-110980178 GGTCCCAGTTTTGCAGGTGAGGG - Intronic
936346937 2:111682178-111682200 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
936537886 2:113325637-113325659 GGTCCCAGGGGATCAGGGTGTGG - Intergenic
937209547 2:120259783-120259805 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
937746645 2:125422576-125422598 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
938528532 2:132161378-132161400 GGGACGAGGGGAGCAGGTGGAGG - Intronic
938931166 2:136088103-136088125 GGCACCCGTGGAGCAGGGGGCGG + Intergenic
939053167 2:137331640-137331662 GGGCGCTGTGGAGCAGGGGGCGG + Intronic
939281799 2:140074107-140074129 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
939777311 2:146403724-146403746 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
941240133 2:163026603-163026625 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
941250451 2:163154991-163155013 GGAGCCAGTGAAGCAGGTAGAGG + Intergenic
941309834 2:163913945-163913967 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
941476542 2:165957096-165957118 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
941541716 2:166794241-166794263 GGTACCAGTGGAGCATGTCCAGG + Intergenic
941705823 2:168657471-168657493 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
941712074 2:168724930-168724952 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
941757435 2:169202832-169202854 GCGCCCATTGGAGCAGGTGAAGG + Exonic
942211581 2:173676628-173676650 GGTTGCAGTGGAGCCCGTGGTGG + Intergenic
943024254 2:182608725-182608747 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
943106113 2:183546711-183546733 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
943494702 2:188606427-188606449 GGGCGCAGTGGAGCAGGGGGTGG + Intergenic
943667745 2:190628035-190628057 GCTGCCAGGGGAGCAGCTGGAGG - Intergenic
943955000 2:194176692-194176714 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
944728654 2:202497237-202497259 GGGCGCCGTGGAGCAGGGGGCGG - Intronic
944729687 2:202503698-202503720 GGGCGCCGTGGAGCAGGGGGCGG - Intronic
944857884 2:203785607-203785629 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
945668934 2:212778925-212778947 GGTCTCAGTGGAGCACGTCAAGG - Intergenic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
946358036 2:219201460-219201482 GGGCGCTGTGGAGCAGGGGGTGG + Intronic
946982116 2:225229481-225229503 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
947026681 2:225744461-225744483 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
947691560 2:232141626-232141648 GGTTCCATTGGAGCAGATGACGG + Intronic
947816570 2:233041411-233041433 TGTCCCTGTGGGGCAGCTGGCGG - Intergenic
948025663 2:234774147-234774169 GGTCCCAGCAGAGCAGCAGGTGG - Intergenic
948226282 2:236311584-236311606 GGTCCCAGTGAAGCAGTTATCGG + Intergenic
948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG + Intergenic
948902242 2:240962691-240962713 TGTCCCAGAGGAGGAGGCGGAGG - Intronic
1169090684 20:2859821-2859843 GGTCCCAGAGCAGGTGGTGGTGG - Intronic
1169194882 20:3677702-3677724 GGGTCCAGTGAAGCAGGTGTCGG - Intronic
1169340884 20:4795433-4795455 GGTCCCAGTGGGGAGGGTGCTGG + Intronic
1169814407 20:9641622-9641644 GGGCGCTGTGGAGCAGGGGGTGG + Intronic
1169849238 20:10032006-10032028 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
1170246518 20:14226834-14226856 GGGCGCCGTGGAGCAGGGGGCGG - Intronic
1170628852 20:18050921-18050943 GGTTACAGTGGAGCAGGGGGAGG + Intronic
1171485629 20:25483594-25483616 GGAGACACTGGAGCAGGTGGAGG + Intronic
1171814091 20:29768119-29768141 GGTGGCAGTGGGGCTGGTGGAGG + Intergenic
1172360748 20:34311389-34311411 GGCCCCAGTGGAGCTTCTGGCGG + Intronic
1172639465 20:36432134-36432156 GGACTGAGTGGACCAGGTGGCGG - Exonic
1172786046 20:37469563-37469585 GGTCCTAGGGGAGCAGGAGAAGG - Intergenic
1173195481 20:40910502-40910524 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
1173248781 20:41353710-41353732 GCTCCCAGAGGGGCAGGTGCAGG - Intronic
1174080945 20:47970438-47970460 GGTCAAAGTGGAGGAGGTGAGGG - Intergenic
1174107534 20:48173240-48173262 GATGCCAGTGGAGAAGGTGGTGG + Intergenic
1174373766 20:50112314-50112336 GGTCCGAGTGGGGCAGTTGGTGG - Intronic
1174388361 20:50200638-50200660 GGCCTCAGTGGAGCAGGTGGTGG - Intergenic
1175738797 20:61406211-61406233 GGTCCGGGTAGAGCAGATGGTGG - Intronic
1175738802 20:61406232-61406254 GGTCCGGGTAGAGCAGATGGTGG - Intronic
1175738807 20:61406253-61406275 GGTCCGGGTAGAGCAGATGGTGG - Intronic
1175738951 20:61406967-61406989 GGTCCAAGAAGAGCAGATGGTGG - Intronic
1175802071 20:61806589-61806611 AGTACCATCGGAGCAGGTGGAGG + Intronic
1175868875 20:62197899-62197921 GGTTTCAGTGGAGAAGATGGAGG + Exonic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1176020243 20:62959001-62959023 GGTCCCACTGCAGGAGCTGGAGG + Intronic
1176257095 20:64158390-64158412 GGGACCAGAGGGGCAGGTGGGGG - Intronic
1176257126 20:64158472-64158494 GGGGCAGGTGGAGCAGGTGGGGG - Intronic
1176257145 20:64158533-64158555 GGGGCCAGTGGAGCAGGTGGGGG - Intronic
1176257191 20:64158660-64158682 GGGACCAGTGGGGCAGGTGGGGG - Intronic
1176380994 21:6111874-6111896 GGTCCGGGTGGAGCGGGCGGCGG + Intronic
1176767964 21:13038512-13038534 GGGACGAGGGGAGCAGGTGGAGG + Intergenic
1176966567 21:15218608-15218630 GGGCGCAGTGGAGTAGGGGGTGG + Intergenic
1177182340 21:17757620-17757642 GGGCACTGTGGAGCAGGGGGTGG + Intergenic
1177318760 21:19493870-19493892 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1177496983 21:21902752-21902774 GGGCCCCGTGGAGCAGGGTGTGG - Intergenic
1177795940 21:25778644-25778666 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1178534747 21:33402834-33402856 GGGCCCAGTGAAGGAGGAGGTGG - Intergenic
1178585597 21:33868350-33868372 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
1178781169 21:35604454-35604476 TGGCCCAGTGGAGCCAGTGGTGG - Intronic
1179123328 21:38568991-38569013 TGAGCCAGTGGAGCAGGTGAAGG + Intronic
1179742478 21:43426366-43426388 GGTCCGGGTGGAGCGGGCGGCGG - Intronic
1180432525 22:15264794-15264816 GGGACGAGGGGAGCAGGTGGAGG + Intergenic
1180515096 22:16132774-16132796 GGGACGAGGGGAGCAGGTGGAGG + Intergenic
1180647042 22:17347835-17347857 GGTCCCAGTGGACGTGGTGCGGG - Intergenic
1180963520 22:19773652-19773674 GGACCCAGGAGAGCAGGTGGAGG - Intronic
1181001888 22:19991650-19991672 AGCCCCAGGGGAGCAGGCGGGGG + Intronic
1181030597 22:20147416-20147438 GGACCCCCTGCAGCAGGTGGGGG - Exonic
1181077629 22:20392443-20392465 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1181450499 22:23017085-23017107 GGGCGCGGTGGAGCAGGGGGCGG + Intergenic
1181512713 22:23395965-23395987 GGACCCCCTGCAGCAGGTGGGGG + Intergenic
1181672219 22:24430980-24431002 GGTACAAGTGGAGCTGGTGCTGG - Intronic
1182482335 22:30617180-30617202 GGTTTCAGCTGAGCAGGTGGCGG + Intronic
1183185398 22:36288891-36288913 GGCCCTAGAGCAGCAGGTGGAGG - Exonic
1183235210 22:36611646-36611668 GATCCCAGTGGAGGGGCTGGAGG - Intronic
1183333636 22:37234563-37234585 GGTCTCAGTGGACCAGGTCAGGG - Intronic
1183376738 22:37469739-37469761 GGACCAGGTGGACCAGGTGGTGG - Exonic
1184667788 22:45997715-45997737 GGTTCCAGTGGTGGAGGGGGTGG - Intergenic
1184761600 22:46547808-46547830 TGTCCCCCTGAAGCAGGTGGCGG - Intergenic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1184906200 22:47488339-47488361 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1185222506 22:49636103-49636125 GGTCCCAGTGCAGAAGCAGGTGG - Intronic
1185298762 22:50068196-50068218 GGTCCCTGTGAAGCAGGTGGTGG + Intronic
949259026 3:2083955-2083977 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
949355870 3:3179793-3179815 GGCCCCAGGGGAGCAGACGGCGG + Intergenic
949770046 3:7568920-7568942 GGCACCGGTGGAGCAGGGGGCGG - Intronic
950068911 3:10136468-10136490 GGGCGCAGTGGAGCAGGGGGTGG + Intergenic
950142058 3:10622236-10622258 AGTCCCCGTGGAGAAGATGGGGG - Intronic
950171566 3:10842380-10842402 GGACCCAGTGGGTCTGGTGGGGG + Intronic
950256914 3:11513278-11513300 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
950513318 3:13447229-13447251 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG + Intergenic
950742768 3:15063420-15063442 GGTCCCAGTGGGGCAGCTGAAGG + Intronic
951262172 3:20523331-20523353 GCCCCCACTGGAGCAGGTGCTGG - Intergenic
951951038 3:28200446-28200468 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
952360519 3:32625962-32625984 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
952393760 3:32903121-32903143 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
952713359 3:36453630-36453652 GGGCGCCGTGGAGCAGGGGGCGG - Intronic
952795297 3:37233346-37233368 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
953089879 3:39713643-39713665 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
953124463 3:40077960-40077982 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
953992668 3:47496236-47496258 GTTCCCAGTGGAGCAGGTCCTGG - Intronic
954041052 3:47887533-47887555 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
954136374 3:48583931-48583953 GGTCCCCCTGGACCAGGTGAAGG - Exonic
954610407 3:51941989-51942011 GGACCCAATGGAGCAGTAGGAGG - Intergenic
954689524 3:52388339-52388361 GGGCTGAGTGGAGCTGGTGGGGG + Intronic
954695617 3:52423454-52423476 AGTCTCAGTGGAGCATGAGGAGG + Exonic
954861593 3:53695168-53695190 GGTCCCCGTGGAGGAGGTGCTGG + Intronic
955045218 3:55353150-55353172 GTTCTCAGTGGAGCTGGGGGTGG + Intergenic
955183402 3:56692208-56692230 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
955186474 3:56719260-56719282 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
955208456 3:56918508-56918530 GGTAGCAGTGGAGCAGGGAGGGG + Intronic
955210336 3:56934793-56934815 GGGTGCAGTGGAGCAGGGGGTGG - Intronic
955449529 3:59051185-59051207 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
956481505 3:69677781-69677803 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
956952645 3:74299773-74299795 GGTGCCAATGGTGCAGGTGGTGG - Intronic
957419616 3:79951403-79951425 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
957630987 3:82715654-82715676 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
957804856 3:85133893-85133915 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
957829963 3:85504708-85504730 GGGCTCCGTGGAGCAGGGGGCGG + Intronic
960243584 3:115374506-115374528 AGTGCCAGTGGAGCTGGTGCAGG - Intergenic
961298266 3:125904220-125904242 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
961412329 3:126731380-126731402 GGCCCCAGTGGAGCACAGGGTGG + Intronic
961756345 3:129129278-129129300 GGAGCGAGTGGAGCAGGTGGAGG + Intronic
962065967 3:131981080-131981102 TGTTCCAGTGGAGGTGGTGGGGG + Intronic
962283701 3:134070293-134070315 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
962383716 3:134916388-134916410 GGACACCGTGGAGCAGGGGGCGG + Intronic
962600451 3:136987620-136987642 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
963008890 3:140751125-140751147 AGGCCCAGAGGAGCTGGTGGGGG + Intergenic
963583386 3:147154396-147154418 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
963589942 3:147245641-147245663 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
964014434 3:151928484-151928506 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
964032372 3:152152746-152152768 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
964139171 3:153378368-153378390 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
964198191 3:154088299-154088321 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
964378561 3:156073444-156073466 GGGCACCGTGGAGCAGGGGGCGG - Intronic
964802847 3:160574021-160574043 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
965092293 3:164179574-164179596 GGGCCCTGTGAAGCAGGGGGCGG - Intergenic
965395974 3:168160798-168160820 GGTCCCAAGGGAGCAGATGAGGG + Intergenic
966076113 3:175937700-175937722 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
966096737 3:176213448-176213470 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
966190966 3:177271761-177271783 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
966548926 3:181183063-181183085 GGGCGCAGTGGAGCAGGGAGCGG + Intergenic
966725054 3:183101225-183101247 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
966725381 3:183103779-183103801 GGGCGCTGTGGAGCAGGGGGCGG + Intronic
966863216 3:184241969-184241991 GGTCCCAGTGGCGCAGTAGCAGG - Exonic
967255292 3:187585510-187585532 GGACTCAGTGGAGCTGGTAGAGG - Intergenic
967448552 3:189596452-189596474 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
967499104 3:190177081-190177103 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
967859017 3:194137886-194137908 GGTCCCGGTGGGGGCGGTGGCGG - Exonic
968412763 4:404032-404054 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
968709752 4:2105181-2105203 AGTCCCAGTGGGGCAATTGGGGG - Intronic
969130055 4:4984398-4984420 GGCCCAGGTGGGGCAGGTGGGGG + Intergenic
969253963 4:5990189-5990211 GGACCCAGGGCGGCAGGTGGCGG + Intergenic
969362404 4:6673052-6673074 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
969430401 4:7150591-7150613 AGTTCCAGTGGAGCAGCTCGGGG + Intergenic
970491822 4:16582797-16582819 GGTCCCAGTGGAGCTGTGGCTGG - Intronic
970945813 4:21690373-21690395 GATCCCAGTGTTGGAGGTGGTGG + Intronic
971552989 4:27978367-27978389 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
972022740 4:34335673-34335695 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
972034753 4:34506653-34506675 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
972392604 4:38627231-38627253 GGGCGCTGTGGAGCAGGAGGCGG - Intergenic
974147469 4:57965753-57965775 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
974781696 4:66561524-66561546 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
974804434 4:66860497-66860519 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
974838188 4:67275282-67275304 GGGCACTGTGGAGCAGGGGGTGG + Intergenic
975595139 4:76043327-76043349 GGGCACCGTGGAGCAGGGGGTGG + Intronic
975596317 4:76050689-76050711 GGGCACCGTGGAGCAGGGGGTGG + Intronic
975680258 4:76868629-76868651 TGTTCCAGTGGAGGTGGTGGAGG - Intergenic
975735165 4:77373555-77373577 AGTCCCAGGGCAGCAGGAGGAGG + Intronic
975736901 4:77389707-77389729 GGTTCCAGGGCAGCAGGAGGAGG + Intronic
975830517 4:78363589-78363611 GGTCCCCGAGCAGCAGGTAGTGG - Exonic
976406429 4:84665019-84665041 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
976980245 4:91218002-91218024 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
977717301 4:100196552-100196574 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
978080300 4:104582309-104582331 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
978241838 4:106525377-106525399 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
979224240 4:118265882-118265904 GGGCGCGGTGGAGCAGGGGGCGG - Intergenic
979290767 4:118977082-118977104 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
979308373 4:119174114-119174136 GGGCGCAGTGGAGCAGGAGGTGG - Intronic
979424702 4:120550769-120550791 AGGCACAGTGGAGCAGGGGGTGG + Intergenic
979688641 4:123538245-123538267 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
980470179 4:133240439-133240461 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
980628643 4:135406947-135406969 GGGCCCTGTGGAGCAGGGGGTGG - Intergenic
980698795 4:136395645-136395667 GGGCGCAGTGGAGCAGGCGGCGG - Intergenic
980815607 4:137942399-137942421 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
980866604 4:138560706-138560728 GGCTCCAGTGGAGCAAGTTGTGG + Intergenic
981176540 4:141689890-141689912 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
981275864 4:142897825-142897847 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
982728237 4:158928030-158928052 GGGCACCGTGGAGCAGGGGGCGG - Intronic
982770208 4:159390283-159390305 GGCGCCATTGGAGCAGGGGGTGG - Intergenic
982814532 4:159869064-159869086 GGGCTCCGTGGAGCAGGGGGTGG + Intergenic
982863441 4:160482097-160482119 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
983026146 4:162739869-162739891 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
983790834 4:171795272-171795294 GGTACCAGTGAAGCAGGGGTGGG + Intergenic
984238769 4:177193228-177193250 GGGCGCAGTGGAGCAGGGGGTGG + Intergenic
984241793 4:177227597-177227619 GGGCACTGTGGAGCAGGGGGTGG + Intergenic
984265710 4:177495920-177495942 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
984676751 4:182557737-182557759 GGTGACAGTGCAGCAGCTGGAGG - Intronic
984901791 4:184592194-184592216 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
984948667 4:184990119-184990141 GGGCACCGTGGAGCAGGGGGCGG + Intergenic
985040983 4:185891586-185891608 GGTCCGAGTGGAGCCATTGGTGG - Intronic
985087149 4:186324912-186324934 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
985678524 5:1244387-1244409 GGTCCCAGAGGAGCACTCGGCGG - Intronic
985877798 5:2613385-2613407 GGTCCCTGTGGAGTAGGAAGGGG - Intergenic
986152053 5:5138114-5138136 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
986295090 5:6431084-6431106 GGTCTCAGTGGAGGATGTTGGGG - Intergenic
986539271 5:8827057-8827079 ACTCTCAGTGGAGCAGGTTGGGG + Intergenic
986626224 5:9725656-9725678 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
986912334 5:12573976-12573998 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
986993320 5:13578800-13578822 GGGCGCGGTGGAGCAGGGGGCGG - Intergenic
987315343 5:16718280-16718302 GGGCGCCGTGGAGCAGGGGGCGG - Intronic
987347395 5:16991013-16991035 GGGCACGGTGGAGCAGGGGGCGG + Intergenic
987352240 5:17032460-17032482 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
987355889 5:17062518-17062540 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
987383960 5:17311805-17311827 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
987876999 5:23691453-23691475 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
988086938 5:26485312-26485334 GGACGCCGTGGAGCAGGGGGCGG + Intergenic
988132208 5:27120228-27120250 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
988489098 5:31692045-31692067 GGGCGCAGTGGAGCACGGGGTGG + Intronic
988915848 5:35892899-35892921 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
989003249 5:36782909-36782931 GGGCACTGTGGAGCAGGGGGCGG - Intergenic
989965874 5:50465342-50465364 GGGCACTGTGGAGCAGGGGGCGG - Intergenic
990323125 5:54649050-54649072 GGCCGCTGTGGAGCAGGGGGCGG + Intergenic
990488449 5:56281136-56281158 GGGCCCACTGGAGCAGGAGCTGG - Intergenic
990717064 5:58649167-58649189 GCTCCCAGTGGACCAGCAGGTGG - Intronic
991427128 5:66503563-66503585 GGGCGCAGTGGAGCAGGGGGTGG - Intergenic
991567511 5:68020434-68020456 GGGCACCGTGGAGCAGGGGGCGG + Intergenic
992296786 5:75334014-75334036 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
993320886 5:86466713-86466735 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
993822087 5:92631660-92631682 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
994110488 5:95997734-95997756 GATCCTACTGGAGCAGGTTGGGG - Intergenic
994605552 5:101962477-101962499 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
994620395 5:102155269-102155291 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
994647717 5:102491423-102491445 GGGCACCGTGGAGCAGGGGGCGG + Intronic
994701651 5:103142066-103142088 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
994769738 5:103966357-103966379 GGGCGCCGTGGAGCGGGTGGGGG + Intergenic
994935328 5:106246539-106246561 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
995647569 5:114329908-114329930 GTGCCCAGTGGAGCAGCAGGAGG - Intergenic
995656556 5:114433009-114433031 GGGCACCGTGGAGCAGGGGGTGG - Intronic
996107093 5:119517433-119517455 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
996435742 5:123430878-123430900 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
996586031 5:125088983-125089005 GGGCACTGTGGAGCAGGGGGCGG - Intergenic
997197054 5:131987361-131987383 AGTGCTAGTGGGGCAGGTGGGGG + Intronic
997454324 5:134005879-134005901 GGGCCCTGTGGAGGAGGTGCCGG + Intergenic
997588747 5:135060248-135060270 GGCCCCTGTGGAAGAGGTGGGGG + Intronic
997676402 5:135716302-135716324 GTGCACAGTGGAGCGGGTGGTGG - Intergenic
998133526 5:139662967-139662989 AGGTCTAGTGGAGCAGGTGGAGG - Intronic
999246909 5:150159974-150159996 GCTCTCAGTGGGGCAGGGGGAGG + Intergenic
999684075 5:154086811-154086833 GGGCCCAGAGGAGCAGATGTTGG + Intronic
999855234 5:155586784-155586806 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1000041212 5:157486480-157486502 AGTCCCAGGGGTGCAGGTGCAGG + Intronic
1000066085 5:157694167-157694189 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1001406528 5:171481003-171481025 GGTCCCAGTGGAGCCCCAGGTGG - Intergenic
1001424819 5:171616180-171616202 GGGGCCAGGGGAGGAGGTGGCGG + Intergenic
1001636494 5:173213760-173213782 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1001754015 5:174152489-174152511 GGTACGAGTGGAGGAGGTGAGGG - Intronic
1001754670 5:174159318-174159340 GGTCCCAGAGCGGCAGCTGGTGG + Intronic
1002004585 5:176222057-176222079 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1002968628 6:1992009-1992031 GCTCCCTTTGAAGCAGGTGGGGG - Intronic
1003060774 6:2860469-2860491 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1003170799 6:3720796-3720818 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1003284805 6:4725362-4725384 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
1003508787 6:6762512-6762534 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1003589645 6:7426066-7426088 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
1003736946 6:8887494-8887516 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1003836167 6:10074741-10074763 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
1003845778 6:10172053-10172075 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
1003908181 6:10720918-10720940 GGGCCCTGTGGAGCAGGGGGTGG - Intergenic
1004200314 6:13541869-13541891 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1004224442 6:13772818-13772840 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1004235496 6:13871953-13871975 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1004336767 6:14771228-14771250 GGTTCCACTGCAGCATGTGGGGG - Intergenic
1004338175 6:14783635-14783657 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1004374509 6:15079946-15079968 GCTCTCTGTGGAGAAGGTGGAGG - Intergenic
1004499626 6:16198132-16198154 GGGCGCCGTGGAGCAGGAGGCGG + Intergenic
1004519350 6:16347168-16347190 GGGCGCTGTGGAGCAGGGGGCGG - Intronic
1004601017 6:17150053-17150075 TGTCCCTGTGGAGTTGGTGGAGG + Intergenic
1004647955 6:17580948-17580970 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1004665483 6:17745339-17745361 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1004905466 6:20233502-20233524 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1004906885 6:20244802-20244824 GGGCGCTGTGGAGCAGGAGGTGG + Intergenic
1005042224 6:21609931-21609953 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1005066473 6:21822894-21822916 GACCACAGTGGAGGAGGTGGTGG + Intergenic
1005332829 6:24765967-24765989 GGGCGCTGTGGAGCAGGAGGTGG + Intergenic
1005561480 6:27045561-27045583 GGTGCCCGTGGAGTAGGGGGCGG - Intergenic
1005596160 6:27381099-27381121 GGGCACCGTGGAGCAGGGGGCGG + Intronic
1005694168 6:28335933-28335955 AGCCCCCGTGGAGTAGGTGGAGG - Intronic
1005749031 6:28866515-28866537 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1005925760 6:30444226-30444248 GGGATCAGTGGAGCAGGAGGAGG - Intergenic
1006033685 6:31195790-31195812 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1006477882 6:34269355-34269377 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1006748850 6:36364263-36364285 GGGCGCTGTGGAGCAGGGGGTGG + Intronic
1007696081 6:43735036-43735058 ATTCCCAGTGAAGCAGGTCGGGG + Intergenic
1008005541 6:46405798-46405820 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
1008038839 6:46774927-46774949 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1008270445 6:49483453-49483475 GGGCACTGTGGAGCAGGGGGCGG + Intronic
1008284290 6:49629581-49629603 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
1009295514 6:61941528-61941550 GGCCCTAGTGGTGGAGGTGGTGG - Intronic
1009407061 6:63326482-63326504 GGGCACTGTGGAGCAGGGGGTGG + Intergenic
1009470316 6:64024063-64024085 GGGCGCTGTGGAGCAGGGGGTGG - Intronic
1009510762 6:64547757-64547779 GGGCGCTGTGGAGCAGGGGGCGG + Intronic
1009578250 6:65494923-65494945 AGTCCCAGTGGACAAGGTGATGG + Exonic
1010235595 6:73572567-73572589 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1010360536 6:74987682-74987704 GGGCACACTGGTGCAGGTGGTGG - Intergenic
1010617434 6:78030131-78030153 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1011143742 6:84189697-84189719 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
1011178161 6:84587715-84587737 GGGCTCCGTGGAGCAGGGGGTGG - Intergenic
1011338308 6:86284850-86284872 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1011620053 6:89234520-89234542 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1011839257 6:91475987-91476009 AGTGACAGTGGAACAGGTGGCGG - Intergenic
1011893252 6:92193796-92193818 TGTTCCAGTGGAGGTGGTGGGGG + Intergenic
1012145069 6:95670371-95670393 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
1012578182 6:100829263-100829285 GGGCACCGTGGAGCAGGGGGCGG + Intronic
1012760452 6:103294435-103294457 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
1012851034 6:104446616-104446638 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1012999457 6:106008080-106008102 GGTCCCAGTGGGGCTGGGCGCGG + Intergenic
1013081432 6:106816793-106816815 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1013955295 6:115834631-115834653 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
1014460221 6:121686486-121686508 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1014507810 6:122280909-122280931 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1014739050 6:125126183-125126205 GGGCGCTGTGGAGCAGGGGGTGG - Intronic
1014788522 6:125644781-125644803 GGCACCAGTGGAGCAGGGGGTGG - Intergenic
1014921022 6:127214621-127214643 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1015600398 6:134905059-134905081 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1016314500 6:142771318-142771340 GGACCCAGGGAAGCAGGTGGCGG - Exonic
1016482267 6:144495181-144495203 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
1017044938 6:150338181-150338203 GGTCCCATTGGGGCAGGATGAGG + Intergenic
1017103099 6:150865740-150865762 CGTGCCAGGGGAGCAGGCGGCGG - Exonic
1018064184 6:160114533-160114555 GGGCTCCGTGGAGCAGGGGGTGG + Intergenic
1018696145 6:166393383-166393405 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1018908796 6:168090123-168090145 GGTCCCAGTGGTGGACGTGGAGG - Intergenic
1019000212 6:168743815-168743837 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1019523850 7:1472069-1472091 GGGCCCAGGGGAGCTGGAGGTGG - Intronic
1019580703 7:1760658-1760680 GGTCCCATAGCTGCAGGTGGCGG - Intergenic
1019944217 7:4313969-4313991 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1019965706 7:4496962-4496984 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1020111665 7:5451265-5451287 GGACCCAGAGGAGCTGGAGGGGG - Intronic
1020270245 7:6590409-6590431 GGGCCCCGTGGAGCTGCTGGAGG + Exonic
1021520665 7:21536620-21536642 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1021686720 7:23193764-23193786 GGTGCCGGTGGAGCAGGGGGTGG + Intronic
1022174099 7:27857087-27857109 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
1023127985 7:36974067-36974089 GGGCGCAGTGGAACAGGGGGCGG - Intronic
1023435139 7:40134503-40134525 GGTCCGGGTGGAGGAGGTTGGGG - Exonic
1024295973 7:47842602-47842624 AGTCCCAGAGAAGCTGGTGGAGG - Intronic
1024335586 7:48202945-48202967 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
1024465953 7:49711582-49711604 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1024569714 7:50713672-50713694 GGTGACAATGGAGGAGGTGGAGG - Intronic
1024691335 7:51806163-51806185 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1026187042 7:68090445-68090467 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1026335942 7:69394155-69394177 GGACGCCGTGGAGCAGGGGGCGG - Intergenic
1026512392 7:71037923-71037945 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1026807233 7:73436002-73436024 GGTCCTAGTGGAGGATGTGGAGG + Exonic
1026984887 7:74548435-74548457 AGTCCCTTTGGAGAAGGTGGTGG + Intronic
1027237974 7:76309511-76309533 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1027246556 7:76371463-76371485 GGCCCCACTGGAGAAGTTGGAGG + Intergenic
1027563992 7:79767996-79768018 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1027674524 7:81142067-81142089 GGGCCCCGTGGAGCAGGGGGCGG - Intergenic
1027868148 7:83673640-83673662 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1027956086 7:84880856-84880878 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1028070149 7:86440896-86440918 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1028392724 7:90334742-90334764 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1028511168 7:91627425-91627447 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1028778372 7:94705822-94705844 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1028796666 7:94910262-94910284 GCTCCCAGCAGAGCAGGGGGAGG + Exonic
1029183886 7:98724766-98724788 GGTCCCAGTGGTGCTGACGGTGG + Intergenic
1029407149 7:100382061-100382083 GGGCGCCGTGGAGCAGGGGGCGG - Intronic
1029832326 7:103274956-103274978 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1029988217 7:104940482-104940504 GGGCACCGTGGAGCAGGTGGCGG - Intergenic
1030102087 7:105955841-105955863 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
1030780464 7:113593647-113593669 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1031396288 7:121278283-121278305 GGCCCCTGAGGAGCAGGTTGAGG + Intronic
1031409256 7:121422056-121422078 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1031528539 7:122850244-122850266 GCCCCCAGTGGAGCAGGAGCTGG - Intronic
1031568729 7:123331008-123331030 GGTCCCAGTGGTGGCAGTGGTGG - Intergenic
1031605488 7:123763247-123763269 GGACGCCGTGGAGCAGGGGGCGG + Intergenic
1032248120 7:130230351-130230373 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1032561558 7:132898638-132898660 GGGCGCTGTGGAGCAGGGGGTGG + Intronic
1032643093 7:133791704-133791726 GCTCCAAGTTGAGCAGGGGGCGG + Intronic
1033065124 7:138146450-138146472 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
1033312382 7:140271376-140271398 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1033394044 7:140956986-140957008 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1034091096 7:148364137-148364159 GGGCGCTGTGGAGCAGGGGGTGG - Intronic
1034167708 7:149038730-149038752 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1034632095 7:152538919-152538941 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1034670620 7:152854899-152854921 GGTCCCAGGAGAGAATGTGGGGG + Exonic
1034706731 7:153152436-153152458 GCTCCCAGTGGAGCTGGCTGAGG - Intergenic
1034883399 7:154779199-154779221 GGTGACAGTGGACCTGGTGGTGG - Intronic
1035063501 7:156088325-156088347 GCTGCCAGTGGAGCAGGGAGGGG + Intergenic
1035151137 7:156874037-156874059 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
1035685003 8:1517450-1517472 GCTCTCAGTGGAGCAGGGGGTGG - Intronic
1036123777 8:6045092-6045114 GGGCGCCCTGGAGCAGGTGGTGG + Intergenic
1036440979 8:8781423-8781445 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1036617554 8:10400267-10400289 GGTTACAGTGGAGAGGGTGGAGG + Intronic
1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG + Intronic
1036800290 8:11786048-11786070 GGTCCTGGTGGATCACGTGGTGG + Exonic
1036915026 8:12796592-12796614 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1037241601 8:16784235-16784257 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1038174115 8:25164824-25164846 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1038534427 8:28343811-28343833 GATCCGAGTGCAACAGGTGGGGG + Intergenic
1039587655 8:38720125-38720147 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1039822267 8:41144802-41144824 GGTCTCCGGGTAGCAGGTGGTGG + Intergenic
1039878829 8:41610614-41610636 GGTCCCAGGTGAGCAGGTCTTGG + Intronic
1040723169 8:50350246-50350268 GGCTCCGGTGGAGCAGGGGGCGG - Intronic
1040952929 8:52954138-52954160 AGGCGCCGTGGAGCAGGTGGCGG - Intergenic
1041034612 8:53775932-53775954 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
1041636619 8:60152999-60153021 GGACACCGTGGAGCAGGAGGCGG + Intergenic
1043346507 8:79303823-79303845 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1043552056 8:81386094-81386116 GGCCCCAGTGGTGGAGGTAGTGG + Intergenic
1043701171 8:83290679-83290701 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1043709934 8:83403275-83403297 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1044075871 8:87821163-87821185 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1044088529 8:87971444-87971466 GGGCACGGTGGAGCAGGGGGTGG - Intergenic
1044633426 8:94300365-94300387 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
1045632395 8:104140706-104140728 GGTCCCAAGGCAGCAAGTGGGGG - Intronic
1045779877 8:105850081-105850103 TGTTCCAGTGGAGGTGGTGGAGG - Intergenic
1046265345 8:111823324-111823346 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1046288957 8:112133020-112133042 GGGCGCCGTGGAGCAGGAGGTGG - Intergenic
1046431763 8:114135999-114136021 GGTGCCAGTGGCAGAGGTGGTGG + Intergenic
1046445386 8:114311679-114311701 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1047631658 8:126714669-126714691 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1047807271 8:128373522-128373544 GGTGCCAGTGGTGCTGGTGCTGG + Intergenic
1048655371 8:136530484-136530506 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1048878242 8:138853249-138853271 GGCCCCATTGGAGCAGGTTCAGG + Intronic
1049060431 8:140272341-140272363 GGTCACAGTGGAGAGAGTGGTGG + Intronic
1049087588 8:140490547-140490569 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1049164608 8:141118184-141118206 GGCCCCAGTGGTGTAGGTGCCGG - Intronic
1049298117 8:141854686-141854708 GCCCCCAGAGGAGCAGGTGTTGG - Intergenic
1049496775 8:142939274-142939296 GGCTCCAGAGGAGCGGGTGGCGG + Intergenic
1050416019 9:5418604-5418626 GGTTCCTGGGCAGCAGGTGGCGG + Intronic
1051314132 9:15810430-15810452 GGGCGCTGTGGAGCAGGGGGTGG + Intronic
1051383354 9:16480836-16480858 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
1051892743 9:21959579-21959601 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
1052075492 9:24135395-24135417 GGGCGCTGTGGAGCAGGGGGCGG - Intergenic
1052765377 9:32635089-32635111 GGTCCCGGGGGTGGAGGTGGAGG + Exonic
1052979598 9:34438273-34438295 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
1053135987 9:35650528-35650550 TGTCCCAGTGGACCAGGGGCCGG - Exonic
1053436133 9:38075652-38075674 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1053452841 9:38207636-38207658 GGTCCCAAGAAAGCAGGTGGCGG + Intergenic
1053547866 9:39042389-39042411 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1053707150 9:40767718-40767740 GGGACGAGGGGAGCAGGTGGAGG - Intergenic
1053811990 9:41862430-41862452 GGGCTCCGTGGAGCAGGGGGCGG + Intergenic
1054417063 9:64888486-64888508 GGGACGAGGGGAGCAGGTGGAGG - Intergenic
1054618605 9:67325009-67325031 GGGCTCCGTGGAGCAGGGGGCGG - Intergenic
1054904890 9:70406103-70406125 AGTCCCAGGAGAGCAAGTGGGGG + Intronic
1055049408 9:71963866-71963888 GGGCTCCGTGGAGCAGGGGGTGG - Intronic
1055102525 9:72480271-72480293 GGGCGCCGTGGAGCAGGGGGCGG + Intergenic
1055651420 9:78410323-78410345 GGGCGCCGTGGAGCAGGTGGTGG - Intergenic
1056080911 9:83093329-83093351 GGGCCCCGCGGAGCAGGGGGTGG + Intergenic
1056771346 9:89480450-89480472 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
1056780841 9:89549250-89549272 GTTCCCAGCTGAGCAGCTGGAGG - Intergenic
1056799578 9:89681580-89681602 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1057125237 9:92611351-92611373 GATCCCCATGGAGCAGGAGGAGG - Exonic
1057429309 9:94979765-94979787 GGTGGCAGGGGAGCAGGTTGAGG + Intronic
1057543813 9:96001751-96001773 GGGCGCCGTGGAGCAGGGGGTGG + Intronic
1057726954 9:97574502-97574524 GGGCGCCGTGGAGCAGGGGGCGG - Intronic
1057883302 9:98808947-98808969 GTTCCCATTGGAGCTGGTGGTGG + Intronic
1058139253 9:101340661-101340683 GGCTCCAGTAGTGCAGGTGGAGG + Intergenic
1058786544 9:108393842-108393864 GGGCGCCGTGGAGCAGGGGGCGG - Intergenic
1059430736 9:114248680-114248702 GGTCCCAGGGGTGCGGGTCGGGG + Intronic
1059891409 9:118809291-118809313 GGGCTCCGTGGAGCAGGGGGCGG + Intergenic
1060733613 9:126052682-126052704 GGGCCCAGCCAAGCAGGTGGTGG - Intergenic
1061019395 9:128004323-128004345 GTTCTCAGAGGAGCAGGTGTGGG - Intergenic
1061483876 9:130910450-130910472 GGGCGCTGTGGAGCAGGGGGTGG - Intronic
1062004393 9:134231976-134231998 GGCCTCAGTGGAGGTGGTGGAGG + Intergenic
1062004486 9:134232327-134232349 GGGCCCGGGGGAGCAGGAGGGGG - Intergenic
1062146166 9:134991065-134991087 GGGCACAGTGGAGCAGGGGGCGG + Intergenic
1062331747 9:136047948-136047970 GGTCACATTGGAGCAGCAGGGGG + Intronic
1062338537 9:136083201-136083223 GGGCTCAGGGGAGCTGGTGGGGG + Intronic
1062339235 9:136086551-136086573 GGTCACAGTGGAGCCCGGGGTGG - Intronic
1062342720 9:136100862-136100884 GCACCCAGTGCAGCCGGTGGTGG - Intergenic
1062414324 9:136439979-136440001 GGTCCCAGCGAGGCAGGTGCAGG + Intergenic
1062451829 9:136618972-136618994 GGTCCCAGGAGAGGAGGCGGAGG + Intergenic
1062463019 9:136669706-136669728 GGGGCCTGTGGAGCAGGTGAGGG + Exonic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic
1185595094 X:1301493-1301515 TTTCCCAGTGGAGCAGAGGGAGG - Intronic
1185737353 X:2503638-2503660 GGTCCCAGTGTTGCAGGAGAGGG - Intergenic
1186323207 X:8452523-8452545 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1187005800 X:15231763-15231785 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1187557528 X:20366882-20366904 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1187904060 X:24050020-24050042 GGGCGCTGTGGAGCAGGGGGTGG - Intergenic
1188189574 X:27157331-27157353 GGGCACCGTGGAGCAGGGGGCGG - Intergenic
1189156294 X:38760453-38760475 GGTCCCAATGCTGCAGCTGGAGG - Intergenic
1190328343 X:49220439-49220461 GGGCCAGGTGGAGCAGGTGTGGG - Intronic
1191053868 X:56222636-56222658 GGGCACGGTGGAGCAGGGGGCGG + Intergenic
1192014570 X:67315675-67315697 TGTTCCAGTGGAGGTGGTGGAGG + Intergenic
1192468442 X:71375226-71375248 GGTCCCGGGGGTGGAGGTGGAGG - Exonic
1192798724 X:74446127-74446149 GGTCCCAGGGGAAGAGGAGGGGG - Intronic
1192995084 X:76505154-76505176 TGTTCCAGTGGAGGTGGTGGTGG + Intergenic
1193538113 X:82738236-82738258 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1193803993 X:85972391-85972413 GGGCGCCGTGGAGCAGGGGGCGG + Intronic
1194166391 X:90521663-90521685 GGGCGCCGTGGAGCAGGGGGTGG - Intergenic
1194650777 X:96512284-96512306 GGGCACCGTGGAGCAGGGGGTGG + Intergenic
1194890445 X:99372104-99372126 GGGCGCAGTGGAGCAGGGGGCGG + Intergenic
1195914770 X:109925298-109925320 TGTGCCACTGCAGCAGGTGGTGG + Intergenic
1196108996 X:111926112-111926134 TGGCTCAGTGGAGCAGGGGGAGG + Intronic
1196269850 X:113697946-113697968 GGTGCCAGTGGGGTATGTGGGGG + Intergenic
1196662485 X:118282774-118282796 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1196705865 X:118716969-118716991 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1196728886 X:118922016-118922038 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1196741558 X:119029842-119029864 GGCGCCAGTGGAGCAGGGGGTGG - Intergenic
1196827224 X:119750854-119750876 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1197000243 X:121431561-121431583 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1197331131 X:125155501-125155523 GGGCTCCGTGGAGCAGGGGGTGG + Intergenic
1197344787 X:125319095-125319117 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1197865748 X:131014859-131014881 GGTCCCAGTGCAGCAATGGGGGG + Intergenic
1198267499 X:135022654-135022676 GCACCCAGCGGAGCAGGTGGTGG + Intergenic
1198300032 X:135325782-135325804 GGGCGCCGTGGAGCAGGGGGTGG - Intronic
1198664269 X:139004058-139004080 GGGCGCTGTGGAGCAGGGGGTGG + Intronic
1198972545 X:142298278-142298300 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1199009895 X:142745756-142745778 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1199242896 X:145568963-145568985 GGTGCCAGTGGTGGTGGTGGTGG - Intergenic
1199356201 X:146866915-146866937 GGGCGCTGTGGAGCAGGGGGCGG + Intergenic
1199831237 X:151551219-151551241 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic
1201423003 Y:13820238-13820260 GGGCGCTGTGGAGCAGGGGGTGG + Intergenic
1201479981 Y:14428418-14428440 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
1201573071 Y:15434171-15434193 GGGCACCGTGGAGCAGGGGGTGG - Intergenic
1201982577 Y:19923749-19923771 GGGCGCCGTGGAGCAGGGGGTGG + Intergenic