ID: 1175926099

View in Genome Browser
Species Human (GRCh38)
Location 20:62472336-62472358
Sequence TCCTGGGGCCCTGGGCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 752
Summary {0: 1, 1: 0, 2: 13, 3: 82, 4: 656}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175926099_1175926113 21 Left 1175926099 20:62472336-62472358 CCCCACAGCCCAGGGCCCCAGGA 0: 1
1: 0
2: 13
3: 82
4: 656
Right 1175926113 20:62472380-62472402 AGGGATGTTCAGAGCTGCACCGG 0: 1
1: 0
2: 0
3: 15
4: 192
1175926099_1175926108 2 Left 1175926099 20:62472336-62472358 CCCCACAGCCCAGGGCCCCAGGA 0: 1
1: 0
2: 13
3: 82
4: 656
Right 1175926108 20:62472361-62472383 TCCCCTCAGCCTGTAACTGAGGG 0: 1
1: 0
2: 1
3: 8
4: 154
1175926099_1175926107 1 Left 1175926099 20:62472336-62472358 CCCCACAGCCCAGGGCCCCAGGA 0: 1
1: 0
2: 13
3: 82
4: 656
Right 1175926107 20:62472360-62472382 TTCCCCTCAGCCTGTAACTGAGG 0: 1
1: 0
2: 2
3: 12
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175926099 Original CRISPR TCCTGGGGCCCTGGGCTGTG GGG (reversed) Intronic
900093964 1:932893-932915 TCCTGGGCCCCTGAGCTGGTGGG + Intronic
900095164 1:937259-937281 TCCCTGGGCCCTGGGCTGTGAGG + Intronic
900145996 1:1158870-1158892 TTCTGAGGCCCTGAGCTGGGGGG - Intergenic
900149497 1:1171901-1171923 TCCCTGGGGCCTGAGCTGTGGGG - Intergenic
900302461 1:1984902-1984924 TCCCGGGGCTGGGGGCTGTGTGG + Intronic
900333790 1:2150670-2150692 TCATGAGGCCCTGGGCTCTGAGG + Intronic
900335586 1:2161446-2161468 TCCCAGAGCCCTGGGCAGTGAGG + Intronic
900466105 1:2826249-2826271 ACCTGGGGCCCAGGGCTGCGGGG - Intergenic
900600740 1:3501719-3501741 TGGTGGGGCCCTGAACTGTGGGG - Intronic
900643866 1:3699963-3699985 TCCTGGGGCCCTGGGCTTGGCGG - Intronic
900699045 1:4032659-4032681 GCCAGGGGCCATGGGCTGGGTGG + Intergenic
900723895 1:4202037-4202059 TTCTGGGGCCAGGGTCTGTGGGG + Intergenic
900989534 1:6091980-6092002 TCCTGGGGCCGTTAGCTGTGGGG - Intronic
901005889 1:6171330-6171352 GGCAGAGGCCCTGGGCTGTGAGG - Intronic
901053804 1:6439482-6439504 TCAAGTGGCCCTGGGCAGTGTGG + Intronic
901196695 1:7444268-7444290 TCCTGGGGCCCAGGGCAAAGAGG - Intronic
901477928 1:9503674-9503696 TCCTGGGGTGCAGGGCTCTGAGG - Intergenic
901648576 1:10729455-10729477 TCCTGGCTCCCTGGACTGTCCGG - Intronic
901655340 1:10766087-10766109 TTCTGGGGCCCTGTTCTGGGTGG - Intronic
901883518 1:12207538-12207560 TCCTGGGGCTCTGTGCAGGGAGG + Exonic
901960499 1:12822795-12822817 TCCTGGGGCTCTGCTCTTTGGGG + Intergenic
901967093 1:12877405-12877427 TCCTGGGGCTCTGCTCTTTGGGG + Intronic
901982493 1:13047663-13047685 TCCTGGGGCTCTGCTCTTTGGGG + Intronic
901986527 1:13079671-13079693 TCCTGGGGCTCTGCTCTTTGGGG - Intergenic
901995285 1:13147096-13147118 TCCTGGGGCTCTGCTCTTTGGGG + Intergenic
901999594 1:13181256-13181278 TCCTGGGGCTCTGCTCTTTGGGG - Intergenic
902018072 1:13324381-13324403 TCCTGGGGCTCTGCTCTTTGGGG - Intergenic
902187505 1:14736213-14736235 TCCTGGGCCCCTGGCCTGTTGGG + Intronic
902409850 1:16206400-16206422 TCCTGGGGTCTGGGGATGTGAGG - Intronic
902600366 1:17536781-17536803 TCCTGGGGCCCTGCAGAGTGTGG + Intergenic
902883135 1:19386170-19386192 CACTGGGGCTCTGTGCTGTGGGG - Intronic
902988623 1:20170972-20170994 TCCTGGGGTCCTGGGCTGGGAGG + Intronic
902988859 1:20172095-20172117 TCCTGGGGTCCTGGGCTGGGAGG - Intronic
903125898 1:21247406-21247428 TCCTAGAGCCCTGGGCTGTGAGG - Intronic
903244447 1:22005567-22005589 GCCTGTGGCCCTGGGCAGCGGGG + Intronic
903647828 1:24905457-24905479 GCCTGTGGCCCAGTGCTGTGGGG + Intronic
903678958 1:25084184-25084206 CCCTGGGGCCCTGGGCCTTGAGG - Intergenic
903853436 1:26321619-26321641 GGGTGGGGCCCTAGGCTGTGCGG - Intergenic
904028744 1:27520914-27520936 TAGTGGGGCCCAGGGCTGGGAGG + Intergenic
904400570 1:30253967-30253989 TCAGGGGGCGCTGGGCTGTCAGG + Intergenic
904612520 1:31733253-31733275 TACTGAGGCCCTGGGGTTTGGGG - Intronic
905891769 1:41522494-41522516 TCCTGAAGGCCAGGGCTGTGAGG - Intronic
905936319 1:41827106-41827128 CCCTGGTCCCCTGGGCTCTGGGG - Intronic
906144506 1:43551902-43551924 TCCAGGGGCCAGGGGCTCTGGGG - Intronic
911041280 1:93592798-93592820 TCCTGGGCCTCTGGGCAGTGAGG + Intronic
912877021 1:113370547-113370569 TCCTGGGGCCCAGGGCAGAGTGG + Intergenic
913185933 1:116371248-116371270 TCCTTGGGCCCTGGTCTGAATGG - Intergenic
914383911 1:147148739-147148761 TTCTTGGGCTCTGGGGTGTGGGG - Intergenic
915363505 1:155300603-155300625 TCGGGGGGTCCTGGGTTGTGCGG - Intronic
915465584 1:156096007-156096029 TCAGGGAGCCCTGGGCAGTGTGG - Intronic
915530867 1:156501256-156501278 TCCTGGGGCCCGGGGCCGCGAGG - Intergenic
915563140 1:156699314-156699336 AGCTGGGGCACTGGGCTCTGAGG - Intergenic
915673006 1:157505820-157505842 CACTAGGTCCCTGGGCTGTGCGG - Intergenic
915979226 1:160409779-160409801 TCCTGGGATCCTGGGCTGGGAGG + Intronic
916075154 1:161196374-161196396 TCCCGGGGACCTGGGCACTGAGG + Intronic
917194957 1:172455343-172455365 TCCTGTTGCCCTGGGAAGTGTGG - Intronic
917977924 1:180251994-180252016 TCTTGGGGACCAGGGCTGTTTGG + Intronic
919739249 1:200972461-200972483 ACCCCGGGGCCTGGGCTGTGGGG + Intronic
919753715 1:201053749-201053771 TCCTTGGGCACAGGGCTCTGGGG + Intronic
922707243 1:227795886-227795908 ACCTGGGGCTCTGGTCTGAGGGG + Intergenic
922763907 1:228147958-228147980 TCATGGGACCCTGGGCGATGGGG - Intronic
922985869 1:229865562-229865584 CCCTGCGGCCCCGGGCTGTGAGG + Intergenic
923461808 1:234214883-234214905 TCCTGGGGCTCTTGTCTGTTCGG + Intronic
1065915804 10:30354163-30354185 CCCAGGGGCCCTGAGCTGAGTGG + Intronic
1065932240 10:30490274-30490296 TCCTGGGGGCTTGGGTTGAGGGG - Intergenic
1066022819 10:31319742-31319764 TCCCGGGGGCCTGGGCGCTGAGG - Intronic
1067239538 10:44478736-44478758 TGCTTGGACCCTGGACTGTGTGG + Intergenic
1067293574 10:44961470-44961492 CCCTGGGCCCCTGGGGTCTGGGG + Intronic
1067523773 10:47026569-47026591 CCCTGGGCCCTTGGGCTCTGGGG + Intergenic
1068083336 10:52346739-52346761 CCCCAGGGCCCTGGGCTCTGGGG - Intergenic
1069571730 10:69498345-69498367 CCCTGGACCCCTGGCCTGTGGGG + Exonic
1069729669 10:70602597-70602619 GCCTGGGGCCCTGGGTGGAGGGG - Intronic
1070836862 10:79452985-79453007 TTCTGTGCCCCTGGGCTGGGGGG - Intergenic
1070964927 10:80524162-80524184 TCCTGGGCCCCAGGCCTCTGTGG - Exonic
1070968294 10:80543304-80543326 TCCGGGGGGCGTGGGCTGGGCGG + Intronic
1070979676 10:80634152-80634174 TCCTGCCACCCTGGACTGTGTGG + Intronic
1072082509 10:92045832-92045854 CCCAGGGGCCCTGGCCTGGGCGG - Intergenic
1072656648 10:97334582-97334604 TCCTGGCACCCGGAGCTGTGCGG + Exonic
1072878868 10:99203927-99203949 TCCTGGAACCTTGGCCTGTGGGG - Intronic
1073305753 10:102502338-102502360 TCCTTGGGCCCTTGGCTCTAGGG - Intronic
1074405371 10:113176737-113176759 TCCTGGGTTCCGGGGCTGTGTGG + Intergenic
1074778178 10:116781532-116781554 ACCTTGGACCCAGGGCTGTGGGG - Intergenic
1074920937 10:118010557-118010579 TCCTGGTTCCTTGGGCTGAGAGG - Intronic
1075402732 10:122172722-122172744 TCCTGGGGCGCAGGGCTGCTGGG + Intronic
1075451125 10:122552683-122552705 CGCTGGGGCCCTGGGCTGAGTGG - Intergenic
1075505014 10:123013758-123013780 CCCTGCGGCCCCGGGCAGTGAGG - Intronic
1076209622 10:128629822-128629844 TCCTGGGGCCGTGGGCTGGCAGG + Intergenic
1076345643 10:129777277-129777299 TCCTGGGGGTCTGCGCTGTGTGG - Intergenic
1076358587 10:129870493-129870515 TCCTGGGGCCCCGAGCTGCCAGG + Intronic
1076579601 10:131498349-131498371 TCCTGGGGCTCTGGTGTCTGGGG - Intergenic
1076729837 10:132432688-132432710 CCCTGGGGTCATGGGGTGTGGGG - Intergenic
1077010411 11:376874-376896 GGCTGGGGGCCTCGGCTGTGTGG - Exonic
1077289730 11:1783523-1783545 GCTGGGGGCCCTGGGCTGGGAGG - Intergenic
1077414789 11:2420049-2420071 CCGTGGGGGCCTGGGCCGTGGGG - Intronic
1077457364 11:2689016-2689038 TCCTGGAGCCCTGGGCTGCAGGG + Intronic
1077466300 11:2735289-2735311 GCCTGGGGCCCTGGGGTGGGAGG + Intronic
1077606483 11:3616127-3616149 TGCTGGGGCCCTGGTCAGAGCGG + Intergenic
1078437949 11:11340896-11340918 TCCTGCGGACATGGGCGGTGAGG + Exonic
1078540069 11:12206237-12206259 TTGTGGGGCCCTGGGCTGGTTGG + Intronic
1078707805 11:13762000-13762022 TCCTGGGGCACAGAGCAGTGTGG - Intergenic
1079947231 11:26759421-26759443 TCTTGTGTCCCTGGTCTGTGAGG + Intergenic
1080453977 11:32401932-32401954 TCCAGGGGTCCTGGGCAGGGAGG + Intronic
1081577722 11:44329749-44329771 TCCAGGGGCCAAGGGCTGTGAGG + Intergenic
1081606587 11:44531028-44531050 TCCTTGTTCCCTGGGCTGTTTGG + Intergenic
1083328239 11:61884608-61884630 TGCTGGGAGCCTGGGCTGGGGGG + Intronic
1083381526 11:62273384-62273406 TCCTCAGGCTCTGGGATGTGAGG + Intergenic
1083631109 11:64095974-64095996 TCATGGGCCCCTGGGGGGTGGGG - Intronic
1083745839 11:64736026-64736048 ACCTTTGGCCCTGGGCTCTGTGG - Intronic
1083767928 11:64851069-64851091 CTCTTGGGTCCTGGGCTGTGAGG + Intergenic
1083778662 11:64906889-64906911 TCCTGGAGCCCTGGCCTAAGGGG + Intronic
1083841682 11:65308499-65308521 GCCTCGGGCCCAGGGCTATGGGG - Intergenic
1084019881 11:66411080-66411102 CCCTGGAGACCTGGCCTGTGTGG - Intergenic
1084153537 11:67302145-67302167 TCCTGGGCCCCTGGGCTCTGTGG - Exonic
1084457796 11:69278354-69278376 TCCCGGAGGCCGGGGCTGTGGGG + Intergenic
1084474221 11:69379650-69379672 TCCTGGGGCCCTACTGTGTGCGG - Intergenic
1084615713 11:70234477-70234499 GCCTGGGGACCTGGGATGTCAGG + Intergenic
1084901826 11:72315480-72315502 CCATGGGGGCCTGAGCTGTGAGG + Intronic
1085218404 11:74851943-74851965 TCCTTGGGCACTGGGTTGAGAGG + Intronic
1085392693 11:76190468-76190490 GCCTGCTGCCCTGGCCTGTGGGG + Intronic
1086103838 11:83128849-83128871 TCCTGGAGCCTGGGTCTGTGGGG - Intergenic
1087165537 11:94998879-94998901 TGCTGGAGCCCTGGGCTCAGTGG - Exonic
1088544527 11:110946211-110946233 TCCTGGGACCCTGGGTTGACAGG - Intergenic
1090226883 11:125077028-125077050 TGCAGGGCCCCTGGGCTATGTGG + Intronic
1090244592 11:125206938-125206960 GCCTGAGGGCCTGGGCTGAGGGG + Intronic
1090405076 11:126471610-126471632 TCCCTGGGCCCTGAGCTGTAGGG + Intronic
1090549939 11:127808678-127808700 TCCTGGCATCCTGGGCTGGGTGG + Intergenic
1090801902 11:130178452-130178474 TCCTGGTCCCTTGGGCTGCGTGG + Intronic
1091750393 12:3018480-3018502 ACCCGGGGCCCTGTGGTGTGGGG - Intronic
1091782146 12:3220663-3220685 TCCTGCTGCCCTGGCCTGTGGGG + Intronic
1091900607 12:4141165-4141187 ACCTGGGGACCCAGGCTGTGGGG - Intergenic
1092261176 12:6954009-6954031 TCCTGTGGGGCTGGGCTTTGTGG + Intronic
1092262158 12:6958586-6958608 TCCTGGCCCCCAGGGCTGTGTGG + Intronic
1092924145 12:13258512-13258534 TCCTGGGCTCTTGGGCTGTAAGG - Intergenic
1095349107 12:41188577-41188599 GCCTGTTGCCCTGGGCGGTGCGG + Exonic
1095699293 12:45174750-45174772 TCCTGGGGCCTTGGGCAATGAGG - Intergenic
1096809742 12:54161738-54161760 TCCTGAGGCCCAGGGATTTGGGG - Intergenic
1096977052 12:55705481-55705503 GGCTGGGGCCCTGGAGTGTGTGG - Intronic
1097362198 12:58670532-58670554 TCCTGTGGCCCTGTGTAGTGAGG - Intronic
1099970956 12:89500027-89500049 TCCTGGAGCTGTGGTCTGTGTGG + Intronic
1101039287 12:100737550-100737572 TCCTGGGTCACAAGGCTGTGTGG + Intronic
1101395197 12:104341132-104341154 TCCTGAAGCCCATGGCTGTGGGG + Intronic
1101835157 12:108289849-108289871 TCCCGAGGCCATGGGCTGTTTGG - Exonic
1101836631 12:108300214-108300236 TCCTGGAGCCCAGGGCTGCCAGG - Intronic
1101955006 12:109205378-109205400 GCCCTTGGCCCTGGGCTGTGGGG + Intronic
1102459818 12:113093443-113093465 TCCCGGGGCCCTCGGGTGGGTGG - Intronic
1102796699 12:115695211-115695233 TCCTGGGACCCTGTGGTGTGTGG - Intergenic
1103862236 12:124024612-124024634 TCCTCGGGCCCAGGGATGCGGGG - Intronic
1103961749 12:124613278-124613300 CCCTGGAGCCCTGAGCTGGGAGG - Intergenic
1104977194 12:132557465-132557487 AACTGGGGCGCAGGGCTGTGGGG + Intronic
1105280876 13:18961931-18961953 GCCTGAGGCTCTTGGCTGTGGGG - Intergenic
1105587986 13:21762243-21762265 TCTTGGGTTCCTGGGCTCTGAGG + Intergenic
1105874731 13:24541545-24541567 TCCTCTGGCCCCGGGCTGTGTGG + Intergenic
1106117647 13:26831002-26831024 TCCAGGGCCCCTGGCCTGAGGGG - Intergenic
1106319822 13:28626800-28626822 GCCTGGGGCCTCTGGCTGTGGGG + Intergenic
1107276624 13:38687044-38687066 TCCCCGGACCCTGGGCTTTGAGG - Intergenic
1108615558 13:52128885-52128907 GCCTAGCGTCCTGGGCTGTGTGG - Intronic
1108690660 13:52856640-52856662 TCCTGGGTCCCAGGGTTCTGAGG - Intergenic
1109082267 13:57919431-57919453 TACTGGTGCCCTGCTCTGTGGGG + Intergenic
1109465028 13:62719757-62719779 CCCTGGGGCTGTGGGCTGGGAGG + Intergenic
1111990600 13:95112877-95112899 CACTGGGGCCCTGGGTTTTGTGG - Intronic
1112509670 13:99997994-99998016 CACAGGGGCCCTGGGCTGGGTGG - Intergenic
1112760434 13:102688770-102688792 TCCTGGTGCCCTGCCCTGTGAGG + Intronic
1113335726 13:109374049-109374071 TCCAGGTGACCTGGGCTGAGAGG - Intergenic
1113406254 13:110043149-110043171 TCCGGGGAGGCTGGGCTGTGGGG - Intergenic
1113600759 13:111566686-111566708 TCCTGGGGCCCTGGGTCCTCCGG + Intergenic
1113750234 13:112771916-112771938 ACCGGGAGCCCTGGGCTGGGCGG + Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1114460056 14:22880671-22880693 TTCTGCAGCCTTGGGCTGTGTGG - Exonic
1117343088 14:54808180-54808202 TCCGAGGGGCCTGGGATGTGTGG + Intergenic
1118736104 14:68702964-68702986 TCCAGGGGTCCTGGGCTATGAGG - Intronic
1118892451 14:69921531-69921553 TCCTGGGGCTCTGGGTCCTGGGG + Intronic
1118905182 14:70018547-70018569 TCCTGGAGCCCTGGCCAGAGGGG - Intronic
1119265814 14:73262760-73262782 TCCAGGGCCCCTGGACTGGGTGG + Exonic
1119267551 14:73272501-73272523 GCCAGGGTCCCTGGGCTGGGCGG - Exonic
1119601577 14:75980435-75980457 TCCTGGGGCACCCTGCTGTGTGG + Intronic
1120095218 14:80380620-80380642 TCCTGGGGCCATTGCCTGTTTGG - Intronic
1120679691 14:87465645-87465667 TGCTGGAGCCCTTGGCTATGTGG - Intergenic
1121010614 14:90518041-90518063 TCCTGGGGCCATGCGCTGTCTGG + Intergenic
1121315586 14:92959275-92959297 TCCTGGGGCCCTGCGGGCTGAGG - Intronic
1122229313 14:100297627-100297649 GGCTGGGGCCGGGGGCTGTGTGG + Intronic
1122354765 14:101116189-101116211 TCCTGCAGCCCTGGGATGAGAGG - Intergenic
1122552273 14:102556469-102556491 TCCTGGGTCCATGGGCTCTGGGG - Intergenic
1122663308 14:103312155-103312177 TCCTGGGGCTGTGGGGGGTGAGG - Intergenic
1122824353 14:104362410-104362432 TTCCGGGGCCCTGGGCAGGGAGG + Intergenic
1122877709 14:104676603-104676625 CCCTGGGGCCCTGGGAAGAGGGG - Intergenic
1122946129 14:105010946-105010968 ACGAGGGGCCCAGGGCTGTGGGG + Exonic
1122949002 14:105030385-105030407 CCCTGGGGCTGTGGGCTGTTGGG + Intergenic
1123404562 15:20012092-20012114 GCATGGGGGGCTGGGCTGTGGGG + Intergenic
1123513895 15:21018739-21018761 GCATGGGGGGCTGGGCTGTGGGG + Intergenic
1124019161 15:25903807-25903829 TCCCTGGAACCTGGGCTGTGTGG - Intergenic
1124340789 15:28887926-28887948 TCCTGGGCTCCTGGGATGGGAGG + Intronic
1124720901 15:32110057-32110079 TCTTGGGGCCCTGACCTGTGTGG + Intronic
1125375216 15:39021456-39021478 TCCTGTGGCCCTGTCCTTTGAGG - Intergenic
1125535896 15:40441120-40441142 TCCTGGGGGCCGGGGCCGGGCGG - Intronic
1125733831 15:41909966-41909988 TCCTTGGGACCTGGTTTGTGTGG - Intronic
1125768959 15:42152781-42152803 GGCTGGGGCCGTGGGCTGTCTGG - Intronic
1127298351 15:57629552-57629574 GTCTGGGACCCTGTGCTGTGAGG - Intronic
1127645032 15:60949475-60949497 TGCTCGGGTCCAGGGCTGTGTGG - Intronic
1127983881 15:64053322-64053344 TGCTGTGCCCCTGGGCTGTCGGG - Intronic
1128173148 15:65530607-65530629 TCCCCGCGCCCTGGGCAGTGTGG + Exonic
1128247737 15:66144401-66144423 TGCTGGGTACCTGTGCTGTGGGG - Intronic
1128456767 15:67835573-67835595 ACCGGGAGCCCTGGGCTGAGGGG + Intergenic
1128516516 15:68345396-68345418 TTTTGGGGCCCTGGACTCTGTGG + Intronic
1128796560 15:70470631-70470653 TGCTGGGGCCTTAGGCTGTCAGG + Intergenic
1128940367 15:71783036-71783058 TGCTGGGGCCAAGGCCTGTGGGG + Exonic
1129150439 15:73684666-73684688 CCCTCCTGCCCTGGGCTGTGGGG + Intronic
1129278134 15:74461078-74461100 CGCTGGGGCCCTGGGCAGCGCGG - Exonic
1129514915 15:76151474-76151496 TTCTGGAGCCCTGGGGTCTGTGG + Intronic
1129694825 15:77734692-77734714 CGCTGGGGCCCTGGGGAGTGTGG - Intronic
1129711986 15:77825146-77825168 TCCTGCTTCCCTGGGCTGTAGGG - Intergenic
1129762989 15:78142373-78142395 GCCTGAGGCCCAGGGCTGTGTGG + Intronic
1130060146 15:80563744-80563766 TCCTCGGACCCTGGGCAGGGAGG - Intronic
1130137026 15:81190037-81190059 GCCAGGGGCCCTGGCCTGCGTGG - Intronic
1130952782 15:88605486-88605508 TCCTGCGGCTCTGGGCTCTCTGG - Intergenic
1131150838 15:90046423-90046445 CCCTGAGGCCCTGGGCTCTGCGG - Intronic
1132224316 15:100128669-100128691 TCCTGGGGCCATGGGACCTGGGG + Intronic
1132464677 16:72166-72188 TCCTGGGACCCTCAGCTGTTGGG + Intronic
1132481035 16:166187-166209 TCCCCGGGCTCTGGGCGGTGTGG + Intronic
1132579545 16:678743-678765 CACTGTGGACCTGGGCTGTGGGG - Intronic
1132758455 16:1497227-1497249 TCCTGGGCCCGTGGGATCTGGGG + Intronic
1132994720 16:2817133-2817155 TCCTGGGCCCAAGGGCTGTTTGG - Intergenic
1133025362 16:2986862-2986884 TTCTGAGGCGCTGGGCTGAGGGG + Intergenic
1133046679 16:3092075-3092097 TTCTGGGGCCCCGGGCTCAGCGG + Exonic
1133342680 16:5046933-5046955 TCTGGGAGCACTGGGCTGTGTGG + Intronic
1133599380 16:7324321-7324343 TCCTGGAGACCTGTGCTGTTAGG + Intronic
1133913661 16:10088540-10088562 TCCTGGGGCCGCGGGCTGTCTGG + Intronic
1134675844 16:16090116-16090138 TCCTGCGGCCCTGGAATCTGGGG + Intronic
1136297611 16:29312605-29312627 TCTTGGGGGACTGGGGTGTGCGG + Intergenic
1136501195 16:30670317-30670339 ACCTGGGGACCTGGGCTGGAGGG + Exonic
1136909873 16:34136279-34136301 TCCTGGTCCCCTGGTCTGTTCGG + Intergenic
1138194562 16:55042989-55043011 TCTTGGGGACTTGAGCTGTGTGG + Intergenic
1138457800 16:57131401-57131423 TCCTGGCTCCCTGTGGTGTGAGG + Intronic
1138528410 16:57621764-57621786 TCCCTTGGCCCTGGCCTGTGAGG - Intronic
1138635279 16:58333264-58333286 GCCAGGGGCCCTGAGCTGGGAGG - Intronic
1139249712 16:65483022-65483044 TCCTGGTGCCCTGGCTTCTGTGG - Intergenic
1139631116 16:68232463-68232485 TTCTGCGGCCCTGGGCGTTGAGG + Exonic
1139646811 16:68337648-68337670 TGCTGAGGGCTTGGGCTGTGTGG - Intronic
1139961738 16:70721916-70721938 TCCTGTGCTCCTGTGCTGTGGGG - Intronic
1141648887 16:85382101-85382123 TCTTGCGGCCCTGGGCTGGCCGG + Intergenic
1141755417 16:85987686-85987708 TCCTGGGACCCTTGGCCATGAGG + Intergenic
1142002266 16:87670658-87670680 CCCTGAGGACCGGGGCTGTGCGG - Intronic
1142066704 16:88067107-88067129 TCCTAGGGCCCAGGTGTGTGGGG + Intronic
1142151428 16:88514266-88514288 TCCTGGGGGCCTGGGGTGAATGG - Intronic
1142151810 16:88515858-88515880 TTCTGGGGTGCTGGGATGTGGGG + Intronic
1142169167 16:88611549-88611571 TCCTGAAGCCCAGGGGTGTGGGG + Intronic
1142178576 16:88656357-88656379 TCCTGGGGCGGTGAGCTGTCAGG - Intronic
1142223527 16:88866513-88866535 CCCTGAGGCCCAGGGCTGGGGGG - Exonic
1142240247 16:88941545-88941567 CCGTGGGGGCCGGGGCTGTGCGG + Intronic
1142691601 17:1609559-1609581 TCCTGTGGCCCAGGGCTGCCAGG + Intronic
1142905154 17:3036402-3036424 TCCTGGGGCCCTGGGTTTTGGGG + Exonic
1143018539 17:3904463-3904485 CCCTAGGGCCCTGGGGGGTGGGG - Intronic
1143032229 17:3974178-3974200 TTCTGGGGCCCAGGGAAGTGGGG + Intergenic
1143172035 17:4935932-4935954 TCCTGCTGACCTGGGCAGTGAGG - Intergenic
1143308896 17:5971967-5971989 TCCAGGGTCCCTGGGTTGTAGGG + Intronic
1143600958 17:7945743-7945765 TCCTGAGGCCCGGGGCTGGAGGG - Exonic
1143624680 17:8103007-8103029 GCCTGGTGCCCAGTGCTGTGTGG + Intronic
1143727621 17:8860281-8860303 TCCTGGGGCGGGGGGCGGTGTGG + Intronic
1144632551 17:16881545-16881567 TCCAGAGGCCCAGGTCTGTGGGG - Intergenic
1144698098 17:17319268-17319290 CCCTGGTTCCCCGGGCTGTGGGG + Intronic
1144782135 17:17813667-17813689 TGCTGGTGCCCTGGGCTGCTGGG + Exonic
1144832852 17:18141185-18141207 TCCTGGGGCCATGGGGAGTTGGG - Intronic
1144835143 17:18152918-18152940 TCCTGGAGAGCTGGTCTGTGAGG - Intronic
1144875444 17:18394842-18394864 TACTGGGGCCCTGGCATGGGGGG - Intergenic
1145156781 17:20549579-20549601 TACTGGGGCCCTGGCATGGGGGG + Intergenic
1145252738 17:21305185-21305207 GCCTGGGGCCCTGAGCTTTTGGG + Intronic
1145323836 17:21782724-21782746 GCCTGGGGCCCTGAGCTTTTGGG - Intergenic
1145784778 17:27586746-27586768 TTCTGGGGGCATGGGCAGTGAGG - Intronic
1145888552 17:28399004-28399026 TTCTGGTGCCTTGGGCTTTGGGG - Exonic
1145897304 17:28466657-28466679 TCATGTTGCCCTGGGTTGTGTGG - Intronic
1146519419 17:33514839-33514861 TTCTCGGCCCCTTGGCTGTGTGG + Intronic
1146936836 17:36817327-36817349 ACCTGGGGCCCAGGGAGGTGAGG + Intergenic
1147044376 17:37742673-37742695 TGCTGGGGCCTGGGGCTTTGGGG + Intronic
1147218603 17:38915115-38915137 ACCTGGGGCGCTGCGCTGTATGG - Exonic
1148107658 17:45127998-45128020 TCCAGGTGGCCGGGGCTGTGAGG + Intronic
1148127001 17:45242163-45242185 ACCTTGGGCCCGGGGCTGGGGGG + Intronic
1148442255 17:47717435-47717457 TCATGGGGCCCTTGGCCTTGTGG + Intergenic
1148829998 17:50425412-50425434 TCCTGAGGCCCAGGGGTGAGTGG - Intergenic
1148851940 17:50559813-50559835 TCCTGGGGATCCGGGCTCTGCGG + Intergenic
1149568097 17:57653481-57653503 CCCCGGGGCCCGGGGCTGGGGGG - Intronic
1149568974 17:57658907-57658929 TCCTTGCACCCTGGGCTGGGTGG + Intronic
1149862323 17:60128950-60128972 GCCTGGGACCCTGGGAGGTGGGG - Intergenic
1149955371 17:61043511-61043533 GCCTGGGGCCATTGCCTGTGTGG + Intronic
1150230457 17:63546874-63546896 TCCTGGAGCCTGGGGCTGTTAGG + Intronic
1150640776 17:66948095-66948117 TTGTGGGGCCCTGGGCTGAGAGG - Intergenic
1151217009 17:72583868-72583890 CCGTGGGGACCTGGGGTGTGTGG - Intergenic
1151320322 17:73348863-73348885 TCCAGGGGCCCGGGCCTGGGAGG + Intronic
1151523941 17:74650950-74650972 TCCTGTGGCTCTGTGCTGTCTGG - Intergenic
1151577872 17:74962048-74962070 GGCTGGGGCGCTGGGCTGGGTGG - Intronic
1151669495 17:75564252-75564274 TCCTGGGGACCTTGACTGAGTGG + Intronic
1151952926 17:77365122-77365144 TTCTGGGGGCCTGGAATGTGGGG - Intronic
1152178031 17:78800613-78800635 GGCCGGGTCCCTGGGCTGTGTGG - Intronic
1152190582 17:78885162-78885184 TCCTGGGTCCCTGTGGTTTGGGG + Intronic
1152228615 17:79103815-79103837 ACCTGGGGCCCAGGGCTCTGGGG + Intronic
1152249998 17:79207554-79207576 CCCTGGGCCTATGGGCTGTGGGG + Intronic
1152545291 17:80997388-80997410 TCCTGGGGGTCTGAGCTCTGGGG - Intronic
1152586144 17:81190341-81190363 TCCCGGGGCCCTGGGCTGGGTGG - Intronic
1152631911 17:81414265-81414287 GCCTGGCGCCCTGGCCTCTGGGG + Intronic
1152695328 17:81741177-81741199 GCCTCAGGCCCGGGGCTGTGAGG - Intergenic
1152729466 17:81962319-81962341 TCCCGAGGCTCTGGGCAGTGGGG + Intergenic
1152734109 17:81988556-81988578 GCCTGCGGCCCTGGTCTGTGTGG + Intronic
1152890865 17:82880980-82881002 CCCTGAGGCCCTGCCCTGTGTGG - Intronic
1153131883 18:1863305-1863327 CCCCAGGGCCCTGGGATGTGGGG - Intergenic
1153419802 18:4892683-4892705 TCCTGTTGACCTTGGCTGTGAGG + Intergenic
1153809659 18:8740836-8740858 TCCTGAGGGCAGGGGCTGTGTGG + Intronic
1153905771 18:9659883-9659905 GGCTGGGGCTCTGGGCTCTGAGG - Intergenic
1154169308 18:12038936-12038958 TCAGGGAGCCCTGGGCTGCGAGG + Intergenic
1154173801 18:12068513-12068535 GCCCGGGGCTCTGGGCTGTGAGG - Intergenic
1154305705 18:13229262-13229284 TCCTGGGCCCCTGTGCTGCCGGG + Intronic
1157195735 18:45618846-45618868 TCCTGCTGCCCTGGGATGTAAGG - Intronic
1158645369 18:59241156-59241178 TCCTGTGGTCCTGGGGCGTGTGG - Intergenic
1159075798 18:63680373-63680395 TCATGGGGCCATGTGCAGTGAGG - Intronic
1159724728 18:71942625-71942647 ACCTGGTTCCCTGGACTGTGGGG - Intergenic
1160043372 18:75365594-75365616 GCCTGGGGCCATGGCCTTTGAGG + Intergenic
1160337466 18:78055067-78055089 TGTTGGTGCCCTTGGCTGTGAGG - Intergenic
1160340787 18:78087129-78087151 CCCTGGGGGCCTGGGCAGTGTGG + Intergenic
1160345415 18:78128212-78128234 TCGTGCGGCCCTTGGATGTGTGG - Intergenic
1160419213 18:78732626-78732648 TTCTGGGGCCATGGGGCGTGTGG - Intergenic
1160425220 18:78774558-78774580 CCCTGGGGCCGAGGGCTCTGGGG - Intergenic
1160535697 18:79590215-79590237 GCCTGGGGACCCGGGCAGTGGGG + Intergenic
1160543688 18:79639057-79639079 TCCTGGGGGCCCAGGCCGTGAGG - Intergenic
1161032508 19:2064706-2064728 TGCTGGGGGCCTGGCCTGAGGGG + Intergenic
1161064543 19:2231200-2231222 GCATCTGGCCCTGGGCTGTGTGG + Exonic
1161065890 19:2237062-2237084 TCCTGAGGCCCCGCGCTGGGCGG + Intronic
1161134395 19:2611157-2611179 CCCTGGATCCCTGGGCTGAGCGG - Intronic
1161195483 19:2983982-2984004 TCCTGGGGCCCCCTGCAGTGGGG - Intronic
1161220408 19:3115727-3115749 TCATGGGGACCGAGGCTGTGAGG + Intronic
1161220474 19:3115920-3115942 TCATGGGGACCGAGGCTGTGAGG + Intronic
1161338980 19:3730403-3730425 TCCTGGCGCCCTGGGCTGGAGGG - Exonic
1161403604 19:4080020-4080042 TCCTGGGTTCCTGCCCTGTGTGG - Intergenic
1161516690 19:4700339-4700361 CACGGGGGGCCTGGGCTGTGGGG + Intronic
1161538006 19:4831647-4831669 TCCTGGGGTCCTGGGGGCTGGGG + Exonic
1161595261 19:5148026-5148048 TCTTGGGGCCTTGGCATGTGGGG - Intronic
1161707975 19:5831151-5831173 TACTGGGGACCTCGGCTGTTGGG - Exonic
1161977723 19:7615597-7615619 TGCTGCGGCCCCGGGCTGCGGGG + Exonic
1162001373 19:7746836-7746858 TCCTGGGTCCCTGGGTCCTGGGG - Intronic
1162994614 19:14326236-14326258 TCCTGTCTCCCTGGGGTGTGGGG - Intergenic
1163035757 19:14567926-14567948 GGCTGGGGTCCTGGGCTGTTGGG - Intronic
1163266367 19:16224834-16224856 TCCTGGAGCCCCGGCCAGTGAGG + Intronic
1163270840 19:16252545-16252567 TACTGGGGGCTGGGGCTGTGAGG + Intergenic
1163428421 19:17251883-17251905 TGCCTGGGTCCTGGGCTGTGCGG - Intronic
1163446796 19:17351707-17351729 TGCTGGGGCCCAGGGCTGTGCGG + Exonic
1163552598 19:17973997-17974019 ACCTGGAGGCCCGGGCTGTGCGG - Exonic
1163628355 19:18403694-18403716 TCCTGGGGTCCTGAGGTCTGGGG + Intergenic
1163631372 19:18419535-18419557 GCCTGGGGCTCGGGGCGGTGAGG + Exonic
1163653617 19:18532860-18532882 TACTGGGACCCTAGGCTGTTTGG + Intronic
1163811698 19:19436590-19436612 GTGTGGGGCCCTGGGCTTTGCGG - Intronic
1163863758 19:19755813-19755835 TACTGGGGTCCTGGGTAGTGGGG - Intergenic
1164070947 19:21767495-21767517 TCCTAGGGGCCTAGCCTGTGTGG - Exonic
1164548441 19:29188102-29188124 CCCTGGGGCGCTGGGATGGGAGG - Intergenic
1164770363 19:30803681-30803703 TCCTGGTGTCCTGGGTTGTCTGG + Intergenic
1165013371 19:32864321-32864343 TCCAGGTGCCCTGTGCTTTGCGG - Exonic
1165050773 19:33140059-33140081 TCTTGAGGCTCTGGGCTCTGTGG - Intronic
1165121677 19:33563013-33563035 GGCTGGAGCTCTGGGCTGTGAGG + Intergenic
1165124158 19:33582226-33582248 TTCTGGAGCCCTGGGGTGAGGGG - Intergenic
1165319421 19:35076233-35076255 GCCTGGGCTCCTGGGCTCTGTGG - Intergenic
1165425904 19:35745278-35745300 TACTGGGGTCCTGGGTGGTGGGG - Exonic
1165463385 19:35958076-35958098 CCCCCGGGCCCTGGGCTCTGAGG + Intergenic
1165992650 19:39825422-39825444 TCCTAGGGTCCTGGGGTGAGGGG + Exonic
1166101949 19:40576385-40576407 CGCTGGGGCCCGGGGGTGTGGGG + Exonic
1166138376 19:40791370-40791392 TCCTGGGGCCCTGAGATGCATGG - Intronic
1166328074 19:42063237-42063259 TCCAGGGGACCTGGGCTGTGGGG - Intronic
1166382497 19:42362293-42362315 TCCTGAGACCCTGGGGTGGGTGG - Intronic
1166698007 19:44865258-44865280 TCCTGGGCTCCTGGGCAGAGAGG - Exonic
1166752681 19:45172182-45172204 TCCTGGGCACCTGTGCTGTGGGG + Intronic
1166752948 19:45173374-45173396 TCCTGGGCACCTGTGCTGTGGGG + Intronic
1167120576 19:47514301-47514323 TGCGTGGGCCCTGGGCGGTGAGG - Intronic
1167240910 19:48342485-48342507 TCCTGCGGCCCTGCGCTGTGGGG - Intronic
1167378784 19:49126726-49126748 TCCTGGGTCCCTTGGCCCTGTGG + Intronic
1167461448 19:49626522-49626544 TCCCAGAGCCCTGGGCAGTGGGG + Intergenic
1167688016 19:50968690-50968712 CCCTGCAGCCCTGGGCTCTGCGG - Exonic
1167719404 19:51168219-51168241 TCCTGGGGCCCAGGGAGGTGGGG - Intergenic
1167725801 19:51211922-51211944 TCCTGGGGCCCAGGGAGATGGGG - Intergenic
1167727461 19:51225933-51225955 TCCTGGGGCCCAGGGAGGTGGGG - Exonic
1167772671 19:51530807-51530829 TCCTGGGGCCCAGGGAGGTGGGG + Exonic
1168105215 19:54162245-54162267 TCCTGGGGCGCTGGGTCGTCTGG - Exonic
1168152662 19:54457196-54457218 TCCCAGGCCCGTGGGCTGTGGGG + Intronic
1168153910 19:54462922-54462944 TCCTGGTGCCCTGTGCAGAGCGG + Exonic
925126564 2:1461409-1461431 TCCTGTGGCCCTAGGCACTGTGG + Intronic
925237353 2:2291639-2291661 TCCCGGCGCCGTGGCCTGTGTGG + Intronic
925322961 2:2991011-2991033 TCTTGAGCCCCTGGGCTGTGAGG - Intergenic
926043072 2:9690330-9690352 GCCTGGGGTCCTGGGGTGTCAGG - Intergenic
926228674 2:10986330-10986352 ACAAGGGGGCCTGGGCTGTGGGG + Intergenic
926411221 2:12604755-12604777 TCCTGGAGACCTGGGCAGAGAGG + Intergenic
927810190 2:26176158-26176180 AGCTGGGGCCTGGGGCTGTGGGG - Intronic
927872709 2:26633771-26633793 TCCTGCCTCTCTGGGCTGTGTGG - Intronic
929595568 2:43173571-43173593 TCCTGGGGCCCTTCTCTGAGGGG - Intergenic
929607235 2:43242902-43242924 TCTTGGGGCACTGGGCAGGGTGG - Intronic
930026889 2:47034475-47034497 TCCTGAAGCCATGGGCTCTGTGG + Intronic
930026991 2:47034927-47034949 TCCTGGGGCAGAAGGCTGTGTGG - Intronic
930122262 2:47769799-47769821 TCCTTAGGCCCTGGGGTGGGAGG - Intronic
931895831 2:66728633-66728655 CCCTGAGGCAGTGGGCTGTGGGG - Intergenic
932417346 2:71581471-71581493 GCCTGGGCTCCTGGCCTGTGTGG + Intronic
932555999 2:72825594-72825616 TCCTGAGTCACTGGGCTGTAGGG + Intronic
933948604 2:87309049-87309071 TCCTGGGGAGGTGGGCTCTGGGG + Intergenic
934561834 2:95317513-95317535 CCCCGGGGCTCTGGGCTGAGGGG + Intronic
934640508 2:96024735-96024757 TGGTGGGGACCTGGGCGGTGGGG - Intronic
934767637 2:96888942-96888964 TCCTGAGGCCTGGGGATGTGTGG - Intronic
935361439 2:102250020-102250042 TCCTTGGTCCCTGGGCAGCGTGG + Intergenic
935405828 2:102708003-102708025 TCCTGGGGCTCTGGGGAGAGGGG - Intronic
935446880 2:103166550-103166572 TTCAGTGTCCCTGGGCTGTGAGG + Intergenic
935618863 2:105111839-105111861 GCCTGGAGCCCTGTGCTGGGAGG + Intergenic
936331595 2:111552547-111552569 TCCTGGGGAGGTGGGCTCTGGGG - Intergenic
936462772 2:112724512-112724534 CCCTGGGTCTCTGTGCTGTGAGG + Intronic
936522066 2:113217741-113217763 GCCTGGGCCCCTGGGAGGTGAGG - Exonic
936657095 2:114500922-114500944 TTCTGTGGCCCTCGGCTCTGAGG - Intronic
937626729 2:124052459-124052481 TCCTGGGACCCTTGGTTGAGAGG - Intronic
938116171 2:128604199-128604221 CCCTGGGTGCCTGGGCTGTGAGG - Intergenic
938118718 2:128619472-128619494 TCTGTGGGCTCTGGGCTGTGTGG + Intergenic
938341122 2:130537399-130537421 GCCTGGGGCCCTCTGCTCTGGGG - Intergenic
938348708 2:130583310-130583332 GCCTGGGGCCCTCTGCTCTGGGG + Intronic
938949512 2:136243959-136243981 CCTTCAGGCCCTGGGCTGTGAGG + Intergenic
938980565 2:136522311-136522333 TGATGGTGCCCTGGGCTGTCTGG + Intergenic
939839103 2:147165311-147165333 TGATGGGGCCCTGGGATATGGGG + Intergenic
939886440 2:147686505-147686527 GCCGCGGGCCCTGGGCAGTGAGG - Intergenic
940009623 2:149039385-149039407 TCCAGGGGGCTTGGGTTGTGAGG + Intronic
941328144 2:164143404-164143426 TGGTGGGCCCATGGGCTGTGCGG + Intergenic
941670045 2:168283452-168283474 TGCAGGTGCCCTTGGCTGTGCGG - Intergenic
942224959 2:173806993-173807015 CCCTCTGGCCCTGGGCTGGGAGG - Intergenic
943090949 2:183374499-183374521 TAGTGGGGGCCTGGGGTGTGTGG + Intergenic
943126790 2:183804031-183804053 TCCTGGAGCCTTGGTCCGTGGGG + Intergenic
943685457 2:190813133-190813155 TCCTGGGGCCCAGAGCAGAGTGG - Intergenic
944579076 2:201116616-201116638 TCCCGGAGCGCAGGGCTGTGAGG - Intronic
944866722 2:203869929-203869951 ACCTGGTGCCCTCGGCTCTGTGG + Intronic
946053990 2:216885355-216885377 CCCGCGGGCCCTGGGCAGTGAGG + Intergenic
946064270 2:216973318-216973340 TCCTGGATCCCTGGGATATGAGG - Intergenic
946245122 2:218383022-218383044 TGCTGTGGCCCTGGGCTGGTCGG - Exonic
947188218 2:227472939-227472961 ACCCGGGGCGCCGGGCTGTGGGG + Intronic
947229577 2:227871568-227871590 TCCTGGGGCGCAGAGCTGGGAGG - Intronic
947525860 2:230876428-230876450 TCCTGGGACCCTGGGCCTTCAGG - Intronic
947527329 2:230886639-230886661 TCCTGGGGCCCTGTTCCCTGTGG + Intergenic
947736140 2:232456498-232456520 TCCCGGGTGCCGGGGCTGTGAGG - Intronic
947791810 2:232872995-232873017 TCCTGGGGCCCTGGCCGCTTGGG + Intronic
947813022 2:233016073-233016095 GCCTGGGGAGCTGGGTTGTGGGG - Intergenic
947823618 2:233089466-233089488 GCCTGGGGCGCTGGGCTGGAGGG + Intronic
947998657 2:234549161-234549183 TCCTGGGGCCCAGGGACATGTGG + Intergenic
948502808 2:238407260-238407282 TCCAGGGGACCTGGGGTGAGAGG + Intergenic
948600868 2:239106847-239106869 CACTTGGGCCCTGGGCTGTCGGG + Intronic
948660478 2:239503535-239503557 TCTGGGGTTCCTGGGCTGTGGGG - Intergenic
948832540 2:240605219-240605241 CCATGGGGTCCAGGGCTGTGGGG + Intronic
948855641 2:240729341-240729363 TCCTGGGGCCCAGGGGTGAGGGG - Intronic
948888639 2:240896436-240896458 TACCCGGCCCCTGGGCTGTGGGG - Intronic
948901785 2:240959989-240960011 TCCTGGAGCCTTTGGCTGCGTGG - Intronic
949046440 2:241874572-241874594 GCCTGGACCCCTGGGGTGTGCGG + Intergenic
949047070 2:241877085-241877107 TTCTGGGGCCCAGGGCAGGGAGG + Intergenic
1169553795 20:6728526-6728548 TCTTGGTGACCTGGACTGTGAGG + Intergenic
1170460280 20:16571395-16571417 TCCAGAGGCCATGGGCTTTGGGG - Intronic
1171232881 20:23501377-23501399 ACCTGATGCCCTGGACTGTGGGG - Intergenic
1171458805 20:25286987-25287009 TCCTGGAGCCTGGGGCTGGGTGG + Intronic
1171475834 20:25407930-25407952 GCGTTGGGCCCTGGGCTCTGGGG + Intronic
1172196694 20:33096778-33096800 TCCTGGAGACCTGGGCTGCACGG + Intronic
1173168764 20:40705585-40705607 TCCTGTGGCCCTGGGGTCTGTGG - Intergenic
1173400685 20:42723414-42723436 TCCCGGTGAGCTGGGCTGTGGGG + Intronic
1173916412 20:46711465-46711487 CTCTGGGGCACTGTGCTGTGGGG - Intronic
1174104709 20:48153932-48153954 TCCTGGGGTCCTTGGCCTTGTGG + Intergenic
1174194834 20:48765804-48765826 TCCCTGGGCCGTGGGCTGTTAGG + Intronic
1174252521 20:49230362-49230384 GCCTGGGGCCCAGGGCACTGTGG + Intronic
1174892882 20:54416834-54416856 ACCTGGTGCCCTGAGCTTTGGGG - Intergenic
1175443916 20:59007570-59007592 TCCTGGGGCCCTGAGCCCTGGGG + Intergenic
1175463274 20:59171135-59171157 TCCTGGGGCCTGTGGCTGGGAGG + Intergenic
1175921201 20:62451295-62451317 TGGTGGGGCCCAGGCCTGTGGGG + Intergenic
1175926099 20:62472336-62472358 TCCTGGGGCCCTGGGCTGTGGGG - Intronic
1175927903 20:62480041-62480063 TCCATGAGTCCTGGGCTGTGAGG + Intergenic
1176040654 20:63064221-63064243 CTCTGGGGCCGTGGGCTCTGAGG + Intergenic
1176052696 20:63128935-63128957 TCTTGGGGGCCTTGTCTGTGAGG + Intergenic
1176114292 20:63424362-63424384 TCCTGGGGCCGTGGGCTCTCTGG - Intronic
1176121830 20:63457571-63457593 TCCTGGGGCCATGGTCAGTGTGG - Intronic
1176162061 20:63653132-63653154 TGGTGGGGCGCTGGGCTGCGAGG - Intronic
1176374032 21:6078337-6078359 GTGTGTGGCCCTGGGCTGTGGGG - Intergenic
1177508689 21:22053457-22053479 GCATGGGGCACTGAGCTGTGGGG - Intergenic
1179390956 21:40990631-40990653 TCCTGAAGCCTGGGGCTGTGTGG + Intergenic
1179722981 21:43325810-43325832 TGCTGGGGCTCAGGGCTGGGCGG + Intergenic
1179749445 21:43459906-43459928 GTGTGTGGCCCTGGGCTGTGGGG + Intergenic
1179780212 21:43694747-43694769 TCCTGGGGCCCTCTGCTGGGAGG - Exonic
1179905948 21:44423457-44423479 CTCTGGGGCCCTGGGCAGTTTGG + Intronic
1179949805 21:44703291-44703313 TCCAGGAGGCCTGGGCTGTGGGG - Intronic
1179968121 21:44818364-44818386 TCCTGGGGCGCCGGGAAGTGAGG + Intronic
1179992044 21:44953250-44953272 TTCAGGGGCCCTGGGCACTGTGG + Intronic
1180000745 21:44994215-44994237 CCCCAGGGCCCTGGGCTGTGAGG + Intergenic
1180065657 21:45410955-45410977 TCCTGAGGCCATAGGGTGTGTGG - Intronic
1180082665 21:45493856-45493878 TCCCTGGGGCCTGGCCTGTGGGG + Intronic
1180087076 21:45512471-45512493 TCCTGGGGCCAGGGGCTGGCCGG - Exonic
1180967947 22:19800290-19800312 TCCTGGGGTCCTGGGCACAGAGG + Intronic
1181164440 22:20975879-20975901 TCCCAGGTGCCTGGGCTGTGGGG - Intronic
1181286031 22:21753371-21753393 TGCTGTGGCCCAGGGCTGTGTGG + Intergenic
1181450549 22:23017269-23017291 CCCCCGGGCCCTGGGCAGTGAGG - Intergenic
1181458181 22:23071037-23071059 TCCTCGGGCCCAGGCCTCTGGGG - Intronic
1181531084 22:23517874-23517896 TCCTAGGGCCCTGGGCACTTGGG + Intergenic
1181576994 22:23801502-23801524 TCCTGGGCCCCAGAACTGTGAGG - Intronic
1181705182 22:24645571-24645593 CCTTGGGACCTTGGGCTGTGAGG + Intergenic
1181878062 22:25955466-25955488 TCCTGGGCCTCAGGGGTGTGCGG + Intronic
1181920569 22:26317373-26317395 TCATGGGGCCTGGGGCTGGGTGG - Intronic
1181959118 22:26610371-26610393 TCCGGGGGCCTGGGTCTGTGTGG - Intronic
1182427838 22:30284274-30284296 TCCTGGGGACCAGGGGTCTGGGG - Intergenic
1182711370 22:32325346-32325368 TCTTGGGGCCCTGGCCGGGGTGG + Intergenic
1183055165 22:35300504-35300526 TCCTGAGACCCGGGTCTGTGAGG - Intronic
1183431651 22:37769412-37769434 TCTCGGGGCCCGGGGCTATGGGG + Intronic
1183728141 22:39600770-39600792 TCCTGGACCCCTGGGCTGGGAGG + Intronic
1183830306 22:40415332-40415354 CCCTGGGTCCCTGGGGTCTGAGG - Intronic
1183860617 22:40667355-40667377 TCTTGGGGCCCAGGGCAGGGTGG - Intergenic
1183960048 22:41406034-41406056 TCCTGGTGCCCTGGGATCCGCGG - Intergenic
1184000488 22:41669744-41669766 TCCCATGGCCCTGTGCTGTGTGG + Intergenic
1184108895 22:42383883-42383905 TCCGGGTGCCCCGGGCTGTTGGG - Exonic
1184188308 22:42878871-42878893 TCCTGGGCTCCTGAGCTCTGTGG - Intronic
1184188324 22:42878924-42878946 TCCTGGGCTCCTGAGCTCTGTGG - Intronic
1184405145 22:44296625-44296647 GCCTGGGGCCCGAGGCAGTGGGG + Intronic
1184769597 22:46589524-46589546 TGCTGGGGCCAGGGGATGTGGGG + Intronic
1184775510 22:46620965-46620987 TGCAGGGGCCCTGGGCTGCCAGG + Intronic
1184785065 22:46667696-46667718 TCCTGGGTCCCAGTGCTGGGCGG - Intronic
1184826047 22:46952037-46952059 TCCACGTGCCCTGTGCTGTGGGG - Intronic
1184894511 22:47399383-47399405 TTCTGGGGCCCTGGACGGAGTGG - Intergenic
1185326717 22:50229181-50229203 TGTGTGGGCCCTGGGCTGTGTGG - Intronic
950143014 3:10628158-10628180 CCCTGAGGCCCTGGGTTGTCGGG - Intronic
950305117 3:11911098-11911120 TCCTGGGTGCCAGGGCTGTGTGG - Intergenic
950519030 3:13485343-13485365 TCCTGGGGCCCAGGCATGCGTGG + Intronic
950576062 3:13832780-13832802 TCCAGGGGCCCTGTCCTATGGGG - Intronic
951044716 3:18025056-18025078 TCCTGGAGCCCAGGGCTGAAGGG - Intronic
951591018 3:24264864-24264886 TTCTGGGGCCCTCTGCTGTAAGG - Intronic
953124688 3:40079271-40079293 TCCTGGGCAACTGGGCTATGTGG + Intronic
953216312 3:40922223-40922245 ACCTGGGGCCAATGGCTGTGGGG + Intergenic
953455302 3:43036003-43036025 TCCTGGGGCCTTGATCTCTGAGG + Intronic
953850596 3:46463359-46463381 CCCTGGAGCCATGGGCTGGGAGG - Intronic
954141531 3:48609350-48609372 TCCTGAGGACCTGGGAGGTGGGG - Intronic
954369106 3:50160978-50161000 TCCTGGGGCCCGGGGAAGGGGGG - Intronic
954873769 3:53787268-53787290 CCCTGGAGCCCAGGGCTGTGGGG - Intronic
955397329 3:58566500-58566522 GCCTGGGGCCCAGGGCTGCCAGG + Exonic
955632081 3:60985461-60985483 TCCTGTGGCCATAGGCAGTGGGG - Intronic
955746840 3:62148849-62148871 TTCTGGATCCCTGGGCTCTGGGG - Intronic
956175731 3:66471510-66471532 GGCTGGGGCCCTAGGCTGTCAGG - Intronic
956743315 3:72291681-72291703 GCCTGGGGCCCTCAGCTGTCCGG + Intergenic
957132218 3:76237951-76237973 TGGTGGGGACCTGGGCTATGTGG + Intronic
958531031 3:95330329-95330351 TGCTGGGTACCTGGGCTTTGCGG - Intergenic
959498423 3:107077543-107077565 TTCTTGGACTCTGGGCTGTGGGG - Intergenic
960970308 3:123134802-123134824 TCCTGGGGGACAGGGCTGTGGGG - Intronic
961298223 3:125904040-125904062 TCCGCCGGCCCTGGGCAGTGAGG + Intergenic
961819020 3:129565798-129565820 TCCTGGGTCCTGGGGCTCTGGGG - Intronic
962199334 3:133388778-133388800 GCCCTGGGCTCTGGGCTGTGAGG + Intronic
964559717 3:157980804-157980826 ACCTGGAGCCCAGAGCTGTGTGG - Intergenic
965253109 3:166368407-166368429 TTTTGGCGCCCTGAGCTGTGTGG - Intergenic
966890710 3:184405654-184405676 TCCTTGGTCCTTGGGTTGTGGGG + Intronic
967507015 3:190263862-190263884 TCCTGGGGACTTGGGAGGTGGGG + Intergenic
968471495 4:784639-784661 ACCTGGGGCCCTGGGCCCGGTGG + Intergenic
968473437 4:792128-792150 GCCTGGGGCCCTGGGCCGAGGGG - Intronic
968512278 4:1001005-1001027 CCCTGGGGCCCTGGCCGGGGCGG + Intronic
968512329 4:1001157-1001179 CCCTGGGGCCCCAGGCTGGGGGG + Intronic
968512353 4:1001209-1001231 CCCTGGGCCCCTGGGGTGGGGGG + Intronic
968547108 4:1205076-1205098 TCCCGGGGCTCTTGGCTGTGAGG + Intronic
968552297 4:1229878-1229900 TGCTGTGGCCCTGGTCTGTGTGG - Intronic
968606229 4:1536988-1537010 GTCTGGGGTCCTGGGCTGTTTGG - Intergenic
968701672 4:2060561-2060583 TGCTGGGGCCCTGGGAAGAGGGG + Intronic
968864605 4:3199954-3199976 GGCTGGCGCCCTGGGCTGTGGGG - Intronic
968873905 4:3255155-3255177 TCCTGGGACCCTGGTCATTGGGG + Intronic
968879922 4:3293386-3293408 TCCTGGGGCCCCGCGCTGTGAGG + Intronic
968907581 4:3461813-3461835 CCTTGGGGGCCTGGGATGTGTGG + Intergenic
969021730 4:4143649-4143671 TGCTGGGGCCGCGGGATGTGGGG + Intergenic
969304453 4:6317818-6317840 GCCAGGGGGCCTGGGCTGTGGGG + Intergenic
969665191 4:8553388-8553410 GCCTGGGGCTCTGGCCTTTGGGG - Intergenic
969717640 4:8875754-8875776 TCCTGGGAACCCGTGCTGTGAGG - Intergenic
973048552 4:45567111-45567133 TTCTGGGGGCATGGGCTCTGCGG + Intergenic
974328187 4:60443534-60443556 ACCTGGAGCCTTGGACTGTGAGG + Intergenic
974839800 4:67286950-67286972 GCCGCGGGCCCTGGGCAGTGAGG - Intergenic
978339480 4:107707182-107707204 ACCTGAAGCCCAGGGCTGTGTGG + Intronic
979813078 4:125064472-125064494 TCTTGGGTCCCAGGGATGTGTGG - Intergenic
979857512 4:125651982-125652004 TCCGCTGGCCCTGGGCAGTGAGG - Intergenic
982117423 4:152109164-152109186 TCCTGCAGCCCCGGGCTGTCTGG - Intergenic
982454655 4:155594414-155594436 TCCTGGGAGCTTGGCCTGTGAGG - Intergenic
985517646 5:355143-355165 TCCTGGTGCCCAGGGCTGCTGGG + Intronic
985564331 5:607780-607802 TCCTGCCGCCCGGGGATGTGGGG + Intergenic
985663273 5:1168059-1168081 GCCGGGGGCCCTGTCCTGTGGGG - Intergenic
985889098 5:2701841-2701863 CCCTGAGGCCGTGGGCTGTGGGG - Intergenic
986153374 5:5148781-5148803 TCCTGGGGCCCAGGTCTGCTAGG - Intronic
986299347 5:6466072-6466094 TCCCAGGGCCCTGAGCAGTGCGG + Intronic
987249344 5:16082455-16082477 TGGAGGAGCCCTGGGCTGTGAGG - Intronic
992460851 5:76958518-76958540 TCAGGAGGCCCTGGGCTGTGAGG - Intronic
992991657 5:82289981-82290003 TCCTGGGACCCAGGTCTGTGAGG + Intronic
994620332 5:102155046-102155068 CCCTGCGGCCCCGGGCAGTGAGG + Intergenic
997676356 5:135715910-135715932 TCCTGTTTCTCTGGGCTGTGGGG + Intergenic
998369235 5:141650605-141650627 TGCTGGGGCCCGGGGCAGTAAGG - Intronic
999379574 5:151110714-151110736 TGCTGGGGCCCTGGGGTGCAGGG + Intronic
999392631 5:151205426-151205448 TCATGGGGCTCTGGTCTGGGTGG + Exonic
999722739 5:154411040-154411062 TCCTGGGTCTCTGAGCTGAGAGG + Intronic
1000391793 5:160730238-160730260 TCCTGATGCCCATGGCTGTGGGG - Intronic
1001146441 5:169188631-169188653 TGCTGGGGCTTTGGGCTCTGTGG - Intronic
1001555548 5:172634441-172634463 TCCTGTCGCTCTTGGCTGTGTGG + Intergenic
1002306275 5:178285869-178285891 TCCTGGGGCCCAGTCCTGAGTGG - Intronic
1002312662 5:178324096-178324118 TCTTGAGGTCCTGTGCTGTGAGG + Intronic
1002457677 5:179354930-179354952 TGCTGTGGTCCTGGGCTTTGGGG - Intergenic
1002559892 5:180073868-180073890 AGATGTGGCCCTGGGCTGTGGGG - Intergenic
1002863897 6:1104200-1104222 GTCTGGTGTCCTGGGCTGTGTGG + Intergenic
1003528816 6:6920656-6920678 TACTGGGTACCTGAGCTGTGTGG + Intergenic
1005059276 6:21761266-21761288 CCCTGGGGCCCCGGGCAATGAGG + Intergenic
1006268907 6:32949145-32949167 TCCTCAGGCCCTTGGGTGTGGGG - Intronic
1006359365 6:33578881-33578903 TCCCCAGGCCCTGGGCGGTGGGG - Intronic
1006414168 6:33893463-33893485 TCCTGCCTCCCTGGGCTGAGTGG - Intergenic
1006457143 6:34138377-34138399 TCCTGAGCACCTGGGCTGGGTGG - Intronic
1006677977 6:35777354-35777376 TCCTGGATCCCTGGGCTCTTTGG + Intronic
1007345523 6:41226850-41226872 TCCTGGGGCCAGCGGCTTTGGGG + Intergenic
1007418549 6:41706083-41706105 TTCTGGGGACCTGCGCTCTGGGG - Intronic
1007652763 6:43433400-43433422 ACCTGGGGACCTGGGCTGGGTGG - Intronic
1007726895 6:43922048-43922070 TACTGGGCCCCTGGGTTGGGTGG + Intergenic
1007756706 6:44104184-44104206 TCCTGGGGCACAGGGCAGGGTGG + Intergenic
1008138001 6:47799645-47799667 GGCTGGGGCCCTGGGAAGTGAGG + Intronic
1008462168 6:51788367-51788389 TCCTGGGGCACTGGGTAGGGTGG - Intronic
1010414822 6:75601632-75601654 CCATGGGGCCCTGGGCGGTGGGG + Intronic
1011624340 6:89271147-89271169 GGCTGGGGCCCTGGGGTGGGGGG + Intronic
1012124046 6:95404649-95404671 ACCTGGGTCCATGGGCTGTATGG + Intergenic
1012443897 6:99289197-99289219 GCCTGGGGGCCAGGGATGTGGGG - Intronic
1012857430 6:104518794-104518816 TCCAGGGGCCCAGGGCAGTCTGG + Intergenic
1013611903 6:111803623-111803645 TCCTGGGGCATGGGGGTGTGGGG + Intronic
1015943316 6:138474081-138474103 TACTGGGGCCACTGGCTGTGTGG + Intronic
1017382064 6:153842734-153842756 TCCTGGGGGCGGGGGCTGGGTGG + Intergenic
1018131714 6:160738217-160738239 TGTTGGAGTCCTGGGCTGTGGGG + Intronic
1018428547 6:163704701-163704723 TCCTGGAGCCCTGTGCTGCCAGG - Intergenic
1018670045 6:166169637-166169659 TCATCGGGTCCTGGGCTTTGGGG + Intergenic
1018719613 6:166562893-166562915 TGCAGGGGGCCTGGGATGTGTGG + Intronic
1019079193 6:169418023-169418045 CCCTGGGGCCCTGACCAGTGAGG - Intergenic
1019210668 6:170402009-170402031 TCCCTGCGCCCTGGGCTCTGTGG + Intronic
1019275542 7:173649-173671 CCATGGGGCCCGGGGCTCTGAGG + Intergenic
1019312811 7:370977-370999 TGCTGGGCCCCTCGGGTGTGTGG - Intergenic
1019445931 7:1071354-1071376 TGCTGTGGCCCCGGGCTCTGTGG + Intronic
1019542816 7:1559227-1559249 TCCAGGTGCCCAGAGCTGTGGGG + Intronic
1019559163 7:1647471-1647493 CCCTGGGGAACTAGGCTGTGCGG + Intergenic
1019774762 7:2905985-2906007 TCCTGGGACCCTGGGGTGTGTGG + Intergenic
1019899150 7:4006443-4006465 TCCTGTGGCCCTCTTCTGTGAGG + Intronic
1019997042 7:4731243-4731265 TCTTGGGGGCCTGGGCCCTGCGG + Intronic
1020154569 7:5712113-5712135 TCATGGTGCCCTGGGCTGGAGGG - Intronic
1020445361 7:8262093-8262115 TCCTGGGGGCCGGGGCTCCGAGG - Exonic
1021101111 7:16586621-16586643 GCCTGGGGCCTTCGGCTGCGGGG - Intergenic
1022400146 7:30028704-30028726 TCTTGGGGCCTGGGGCAGTGAGG + Exonic
1023279092 7:38551664-38551686 CCCTGGGTCCATGGGCCGTGGGG - Intronic
1023842894 7:44106848-44106870 TCCTCGGGGCCAGGGCTGGGGGG - Exonic
1024232153 7:47370875-47370897 ACCTGGAGCCCGGGGCTGTGAGG - Intronic
1024275612 7:47674418-47674440 TTCTGGGGGTCTGGGCTGGGAGG + Intergenic
1024477055 7:49823579-49823601 TCCTGGGGCCCCCGGCAGTTGGG + Intronic
1024748216 7:52431493-52431515 TCCGCAGGCCCTGGGCAGTGAGG - Intergenic
1024897325 7:54275154-54275176 TCCTGGGGCCCTAGCCAGGGAGG - Intergenic
1025099491 7:56123219-56123241 TCCTGGGGCCATGGCCAGGGGGG - Intergenic
1027048030 7:75004041-75004063 TCCCGGCGCCCTCGGCTCTGAGG - Intronic
1027238274 7:76310936-76310958 TCCTGGGGCGGTGGGCAGGGAGG - Intergenic
1027426129 7:78062894-78062916 GACTGTGGCCCTGGGCTGGGTGG - Intronic
1028206311 7:88021162-88021184 TCTTGGGGCACAGGGCAGTGTGG + Intronic
1029384967 7:100237574-100237596 TCCCGGCGCCCTCGGCTCTGAGG + Intronic
1030260999 7:107563977-107563999 GCCTGGAGCCATGGGCTGGGTGG - Exonic
1030873306 7:114783723-114783745 TCCTGGGGCAGTGGGAAGTGAGG + Intergenic
1031620870 7:123932152-123932174 TTCTGGGTTCCTCGGCTGTGGGG + Intronic
1032022310 7:128415232-128415254 GCCTGGGTGTCTGGGCTGTGTGG - Intergenic
1032121722 7:129161887-129161909 TCCAGGGGCACTGGCCTGGGGGG - Intronic
1032269065 7:130387445-130387467 CCCTGGGGCTCTGGTCTGTGAGG - Intronic
1032540669 7:132700368-132700390 TCCTGGGGCTCTAGGGTGAGTGG + Intronic
1034191388 7:149215966-149215988 TCTTGGGGACTTGTGCTGTGTGG + Intronic
1034210687 7:149359487-149359509 ACCAGGGTCCCTGAGCTGTGGGG - Intergenic
1034694675 7:153043106-153043128 TCTTGGGCACCTGTGCTGTGTGG + Intergenic
1034779042 7:153860315-153860337 TCCTGGGGCACTGAGCAGGGTGG - Intergenic
1034970830 7:155418180-155418202 CCAGGGAGCCCTGGGCTGTGGGG + Intergenic
1035083805 7:156239194-156239216 TCCTGGGGACGTGGGCAGAGGGG - Intergenic
1035272476 7:157728473-157728495 TCCCGGGGCCCTTGGCTCAGTGG + Intronic
1035275763 7:157747038-157747060 GCCTGCGTCCCTGAGCTGTGGGG + Intronic
1035275785 7:157747161-157747183 GCCTGCGTCCCTGAGCTGTGGGG + Intronic
1035275817 7:157747325-157747347 GCCTGCGTCCCTGAGCTGTGGGG + Intronic
1035275843 7:157747448-157747470 GCCTGCGTCCCTGAGCTGTGGGG + Intronic
1035275851 7:157747489-157747511 GCCTGCGTCCCTGAGCTGTGGGG + Intronic
1035275917 7:157747858-157747880 GCCTGCGTCCCTGAGCTGTGGGG + Intronic
1035275995 7:157748268-157748290 GCCTGCGTCCCTGAGCTGTGGGG + Intronic
1035276029 7:157748432-157748454 GCCTGTGTCCCTGAGCTGTGGGG + Intronic
1035276201 7:157749375-157749397 GCCTGTGTCCCTGAGCTGTGGGG + Intronic
1035276297 7:157749867-157749889 GCCTGTGTCCCTGCGCTGTGGGG + Intronic
1035282682 7:157787498-157787520 TCCTGGCCCCCTAGACTGTGGGG - Intronic
1035357968 7:158290290-158290312 TCCTGGAGCCCAGGTCAGTGAGG + Intronic
1035370828 7:158377867-158377889 GCCACGGGCCCTGTGCTGTGTGG - Intronic
1035587357 8:786224-786246 TCATGGGGCCCAGTGGTGTGTGG + Intergenic
1035637341 8:1156581-1156603 GGCTGGGGCGCTGGGCTGGGGGG - Intergenic
1036687594 8:10922312-10922334 CACTGTTGCCCTGGGCTGTGGGG + Intronic
1037459147 8:19091978-19092000 TCTTGGGAACCTGGGCTTTGAGG - Intergenic
1039799119 8:40938947-40938969 TGCTGGGCCACTGGGCTGTGTGG + Intergenic
1040079984 8:43275761-43275783 TCCTGTGGTGCTGGGCTCTGAGG + Intergenic
1043428377 8:80171242-80171264 TCCTGGGGCCCTGGAAGGAGCGG - Intronic
1044728862 8:95214380-95214402 GCCTGGAGCCTTGGCCTGTGTGG + Intergenic
1045327240 8:101126475-101126497 GCCTGGAGCCCGGGGCTGTGCGG + Intergenic
1046950049 8:120011288-120011310 CCCTGGGGTCCTGTGCTCTGGGG + Intronic
1047214360 8:122864640-122864662 CTCTGGGGCCCTGGGGAGTGGGG - Intronic
1047301077 8:123613856-123613878 TCTTTGGGCCCTGGGCTCTGGGG - Intergenic
1049134836 8:140887070-140887092 TCATGGGACCCTGAGCTGTTTGG + Intronic
1049215164 8:141404439-141404461 TCCTGGGGTCCTGGGGTCTCTGG + Intronic
1049255447 8:141611290-141611312 TCCAGGGGCCGTTGGCTCTGGGG + Intergenic
1049381470 8:142318515-142318537 TCCTGGGGTCTGGGGCTGGGAGG - Intronic
1049385433 8:142340773-142340795 TCATGTGGCCCTGGGGTCTGAGG - Intronic
1049409349 8:142465446-142465468 TCCTGGGGACTCGGGCTGCGTGG + Intronic
1049433054 8:142574178-142574200 TCCCTAGGCCCAGGGCTGTGCGG + Intergenic
1049536419 8:143184478-143184500 CCATGGGGGCCTGGGCTGTGGGG + Intergenic
1049745175 8:144260249-144260271 TCCAGGGCCACTGGGCTGTGAGG - Exonic
1050523859 9:6528546-6528568 GGCTAGGGCCCAGGGCTGTGAGG + Intergenic
1051929067 9:22363725-22363747 GCCTCGGGCCCTGTGCAGTGAGG - Intergenic
1053290808 9:36878656-36878678 AGCAGGGGCCCTGGGCTGTCAGG - Intronic
1053544635 9:39009874-39009896 GCCTGGTGCCTTGGCCTGTGGGG - Intergenic
1053809072 9:41833356-41833378 GCCTGGTGCCTTGGCCTGTGGGG - Intergenic
1054161078 9:61672358-61672380 ACCTGGGACCCTGGGGGGTGGGG + Intergenic
1054621520 9:67354072-67354094 GCCTGGTGCCTTGGCCTGTGGGG + Intergenic
1054797724 9:69318105-69318127 ACCTGAGGCCCTGGTCTCTGGGG + Intergenic
1054837944 9:69699491-69699513 GCCTGGGGCCTGGGGCTATGGGG + Intergenic
1054944505 9:70781672-70781694 GCCTGGGATCTTGGGCTGTGTGG + Intronic
1057271984 9:93656625-93656647 GCCTGGGGCTCTTGGCTGTGGGG + Intronic
1057276139 9:93676880-93676902 CCCAGGGGCCATGGGCTGGGAGG - Exonic
1057566920 9:96173009-96173031 GCCTGGGGCCCTTTGCTTTGTGG - Intergenic
1057605891 9:96497334-96497356 TCGGGGGTCCCTGGCCTGTGTGG - Intronic
1057629921 9:96711207-96711229 TCCTGTGATCCTGGGTTGTGGGG + Intergenic
1057851294 9:98568685-98568707 TCCTAGGACACAGGGCTGTGGGG - Intronic
1058535052 9:105950241-105950263 TGCTGGGGGCCTGGGCTGGGAGG + Intergenic
1058735104 9:107886886-107886908 TGCTGGCCCCCTGGGCTGGGTGG - Intergenic
1059384605 9:113954428-113954450 TGTTGGGGGACTGGGCTGTGTGG + Intronic
1060019354 9:120115875-120115897 TCCTGGGGGCCAGAGCAGTGGGG + Intergenic
1060822902 9:126671810-126671832 CGCTGGGGGCCTGGGCTGTGGGG - Intronic
1060825054 9:126683106-126683128 TCCTGCGGCCCGCAGCTGTGCGG - Intronic
1060930469 9:127486532-127486554 TCCAGGGCGCCTGGACTGTGCGG + Intronic
1061114635 9:128601787-128601809 TCCTGAGGACCTAGGCTGAGAGG + Intronic
1061538963 9:131267047-131267069 TCCCTGGGGCCGGGGCTGTGGGG + Intronic
1061843809 9:133375831-133375853 GCCTGGCGCCCTGCGCTGGGAGG + Intronic
1061892333 9:133629402-133629424 TCCGGGGGTCCTGGGCTGGGTGG + Intergenic
1061939265 9:133875325-133875347 GGCTGTGGCGCTGGGCTGTGTGG - Intronic
1061974077 9:134059622-134059644 TCCAGGGTCCCTGTGGTGTGGGG - Intronic
1062038333 9:134392601-134392623 TTCTGGGTCCCTGGGATGGGTGG + Intronic
1062178264 9:135176335-135176357 GCATGGTGCCCTGGGCTCTGCGG - Intergenic
1062192466 9:135255036-135255058 TCCTGGGCCCCTGCAGTGTGGGG - Intergenic
1062205644 9:135335371-135335393 ACCTGGGGCCCTGGGCAGCTGGG - Intergenic
1062264581 9:135681196-135681218 ACCTGGTGCCCTGGGATTTGGGG - Intergenic
1062293876 9:135813238-135813260 TCCCAAGGCCCTGGGCTGTGTGG + Intronic
1062319026 9:135981452-135981474 TCCTCGGGACCTGCGCTGAGAGG - Intergenic
1062354704 9:136156509-136156531 GTCTGGTGCCCTGTGCTGTGGGG + Intergenic
1062375488 9:136260050-136260072 TCAGTGGGCCCTGGGCAGTGTGG - Intergenic
1062442914 9:136579107-136579129 ACCAGGGGCCCTGTGATGTGGGG - Intergenic
1062481382 9:136754082-136754104 GCCTGGAGCCCTGGGCAGTGGGG + Intergenic
1062511922 9:136910982-136911004 GCCTGGGGCCCGTGTCTGTGAGG + Intronic
1062544332 9:137054826-137054848 GGCTGAGGCCCTGGGCTGGGAGG - Intergenic
1062599538 9:137313652-137313674 GGCTGGGGCCCTGGCCTGGGTGG + Intronic
1062729691 9:138102042-138102064 TGCTGGGGCTCAGGGCTGGGTGG - Intronic
1203449020 Un_GL000219v1:92821-92843 CCCTGGGGCCAAGGGCTGGGGGG + Intergenic
1185943963 X:4353664-4353686 ACCTTGTGCCCTGGGCTGGGCGG + Intergenic
1186448017 X:9648434-9648456 TCCTCATGCCCTGGGCTGAGGGG + Intronic
1189376118 X:40467359-40467381 TCCTGGGGCACAGGGCAGGGAGG + Intergenic
1189918712 X:45882477-45882499 TCCTGGTGCCCTGAGCCCTGGGG - Intergenic
1190221931 X:48517297-48517319 AGGTGGGGCCCTGGGCTGTGTGG + Intronic
1192196771 X:69033934-69033956 CTCTGGGGCCCTGGGCTGAGAGG + Intergenic
1192382873 X:70636162-70636184 GCCTGGGGCCTGGGTCTGTGGGG - Intronic
1193719972 X:84974986-84975008 TGGAGTGGCCCTGGGCTGTGAGG + Intergenic
1194076495 X:89400538-89400560 TCCTGGGGCATGGGGGTGTGGGG - Intergenic
1195618838 X:106933506-106933528 TCCGTGGGCCCAGGGCTGAGTGG - Intronic
1197547084 X:127838545-127838567 CCCAGGGTCCCTGTGCTGTGTGG - Intergenic
1198967774 X:142245103-142245125 TCCTGGTGCCTAGGGCTGTAGGG - Intergenic
1199591394 X:149471159-149471181 GCCCAGGGGCCTGGGCTGTGTGG + Intergenic
1200045893 X:153400938-153400960 CCCTGGGTCCCTGGGCGGAGAGG - Intergenic
1200215120 X:154364886-154364908 GCCTGGGGCCCTGGGCTGGAGGG - Exonic
1200215923 X:154368242-154368264 CCCTGGGACCCTGGGCAGAGAGG - Intronic
1200429135 Y:3056058-3056080 TCCTGGGGCATGGGGGTGTGGGG - Intergenic
1201518151 Y:14840768-14840790 TCCTCGGGCCCTGTTTTGTGAGG - Exonic