ID: 1175927258

View in Genome Browser
Species Human (GRCh38)
Location 20:62476783-62476805
Sequence CTGCCGCGGAGCAGCTCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175927251_1175927258 15 Left 1175927251 20:62476745-62476767 CCGCTCGCACTCCCGGTGAGGGC No data
Right 1175927258 20:62476783-62476805 CTGCCGCGGAGCAGCTCCGCAGG No data
1175927254_1175927258 4 Left 1175927254 20:62476756-62476778 CCCGGTGAGGGCTGCATGGAGGC No data
Right 1175927258 20:62476783-62476805 CTGCCGCGGAGCAGCTCCGCAGG No data
1175927246_1175927258 22 Left 1175927246 20:62476738-62476760 CCGTGTCCCGCTCGCACTCCCGG No data
Right 1175927258 20:62476783-62476805 CTGCCGCGGAGCAGCTCCGCAGG No data
1175927249_1175927258 16 Left 1175927249 20:62476744-62476766 CCCGCTCGCACTCCCGGTGAGGG No data
Right 1175927258 20:62476783-62476805 CTGCCGCGGAGCAGCTCCGCAGG No data
1175927255_1175927258 3 Left 1175927255 20:62476757-62476779 CCGGTGAGGGCTGCATGGAGGCG No data
Right 1175927258 20:62476783-62476805 CTGCCGCGGAGCAGCTCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175927258 Original CRISPR CTGCCGCGGAGCAGCTCCGC AGG Intergenic
No off target data available for this crispr