ID: 1175929160

View in Genome Browser
Species Human (GRCh38)
Location 20:62485479-62485501
Sequence CTCCAGAGGAAGCCAAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175929160_1175929169 8 Left 1175929160 20:62485479-62485501 CCCTGGCTTGGCTTCCTCTGGAG No data
Right 1175929169 20:62485510-62485532 AGGGGCTCCTGACATCTTGTAGG No data
1175929160_1175929167 -10 Left 1175929160 20:62485479-62485501 CCCTGGCTTGGCTTCCTCTGGAG No data
Right 1175929167 20:62485492-62485514 TCCTCTGGAGGGGAGATAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175929160 Original CRISPR CTCCAGAGGAAGCCAAGCCA GGG (reversed) Intergenic
No off target data available for this crispr