ID: 1175930801

View in Genome Browser
Species Human (GRCh38)
Location 20:62492927-62492949
Sequence CAGGAGCCAGATGCTCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175930801_1175930808 -3 Left 1175930801 20:62492927-62492949 CCCAGTGGAGCATCTGGCTCCTG No data
Right 1175930808 20:62492947-62492969 CTGGGGAGAGGCTGCCTCGCAGG No data
1175930801_1175930809 -2 Left 1175930801 20:62492927-62492949 CCCAGTGGAGCATCTGGCTCCTG No data
Right 1175930809 20:62492948-62492970 TGGGGAGAGGCTGCCTCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175930801 Original CRISPR CAGGAGCCAGATGCTCCACT GGG (reversed) Intergenic
No off target data available for this crispr