ID: 1175931360

View in Genome Browser
Species Human (GRCh38)
Location 20:62495382-62495404
Sequence CAGGGCAGACAGATGGATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175931352_1175931360 12 Left 1175931352 20:62495347-62495369 CCGGGAGGAGGCATGTGGGGTCC No data
Right 1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG No data
1175931356_1175931360 -9 Left 1175931356 20:62495368-62495390 CCCTGATGGACGTGCAGGGCAGA No data
Right 1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG No data
1175931357_1175931360 -10 Left 1175931357 20:62495369-62495391 CCTGATGGACGTGCAGGGCAGAC No data
Right 1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175931360 Original CRISPR CAGGGCAGACAGATGGATGC GGG Intergenic
No off target data available for this crispr