ID: 1175935827

View in Genome Browser
Species Human (GRCh38)
Location 20:62513617-62513639
Sequence CAGGGCAGGGAGCTTCCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175935827_1175935845 26 Left 1175935827 20:62513617-62513639 CCACCGGGAAGCTCCCTGCCCTG No data
Right 1175935845 20:62513666-62513688 CCGCAGAGGGAGAGGGCTCATGG No data
1175935827_1175935836 -4 Left 1175935827 20:62513617-62513639 CCACCGGGAAGCTCCCTGCCCTG No data
Right 1175935836 20:62513636-62513658 CCTGCTTGGCATTGTGTGGTGGG No data
1175935827_1175935839 13 Left 1175935827 20:62513617-62513639 CCACCGGGAAGCTCCCTGCCCTG No data
Right 1175935839 20:62513653-62513675 GGTGGGCACGGCCCCGCAGAGGG No data
1175935827_1175935841 19 Left 1175935827 20:62513617-62513639 CCACCGGGAAGCTCCCTGCCCTG No data
Right 1175935841 20:62513659-62513681 CACGGCCCCGCAGAGGGAGAGGG No data
1175935827_1175935837 1 Left 1175935827 20:62513617-62513639 CCACCGGGAAGCTCCCTGCCCTG No data
Right 1175935837 20:62513641-62513663 TTGGCATTGTGTGGTGGGCACGG No data
1175935827_1175935846 29 Left 1175935827 20:62513617-62513639 CCACCGGGAAGCTCCCTGCCCTG No data
Right 1175935846 20:62513669-62513691 CAGAGGGAGAGGGCTCATGGAGG No data
1175935827_1175935832 -8 Left 1175935827 20:62513617-62513639 CCACCGGGAAGCTCCCTGCCCTG No data
Right 1175935832 20:62513632-62513654 CTGCCCTGCTTGGCATTGTGTGG No data
1175935827_1175935840 18 Left 1175935827 20:62513617-62513639 CCACCGGGAAGCTCCCTGCCCTG No data
Right 1175935840 20:62513658-62513680 GCACGGCCCCGCAGAGGGAGAGG No data
1175935827_1175935838 12 Left 1175935827 20:62513617-62513639 CCACCGGGAAGCTCCCTGCCCTG No data
Right 1175935838 20:62513652-62513674 TGGTGGGCACGGCCCCGCAGAGG No data
1175935827_1175935834 -5 Left 1175935827 20:62513617-62513639 CCACCGGGAAGCTCCCTGCCCTG No data
Right 1175935834 20:62513635-62513657 CCCTGCTTGGCATTGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175935827 Original CRISPR CAGGGCAGGGAGCTTCCCGG TGG (reversed) Intergenic
No off target data available for this crispr