ID: 1175935828

View in Genome Browser
Species Human (GRCh38)
Location 20:62513620-62513642
Sequence AAGCAGGGCAGGGAGCTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175935828_1175935836 -7 Left 1175935828 20:62513620-62513642 CCGGGAAGCTCCCTGCCCTGCTT No data
Right 1175935836 20:62513636-62513658 CCTGCTTGGCATTGTGTGGTGGG No data
1175935828_1175935847 30 Left 1175935828 20:62513620-62513642 CCGGGAAGCTCCCTGCCCTGCTT No data
Right 1175935847 20:62513673-62513695 GGGAGAGGGCTCATGGAGGAAGG No data
1175935828_1175935845 23 Left 1175935828 20:62513620-62513642 CCGGGAAGCTCCCTGCCCTGCTT No data
Right 1175935845 20:62513666-62513688 CCGCAGAGGGAGAGGGCTCATGG No data
1175935828_1175935846 26 Left 1175935828 20:62513620-62513642 CCGGGAAGCTCCCTGCCCTGCTT No data
Right 1175935846 20:62513669-62513691 CAGAGGGAGAGGGCTCATGGAGG No data
1175935828_1175935839 10 Left 1175935828 20:62513620-62513642 CCGGGAAGCTCCCTGCCCTGCTT No data
Right 1175935839 20:62513653-62513675 GGTGGGCACGGCCCCGCAGAGGG No data
1175935828_1175935834 -8 Left 1175935828 20:62513620-62513642 CCGGGAAGCTCCCTGCCCTGCTT No data
Right 1175935834 20:62513635-62513657 CCCTGCTTGGCATTGTGTGGTGG No data
1175935828_1175935838 9 Left 1175935828 20:62513620-62513642 CCGGGAAGCTCCCTGCCCTGCTT No data
Right 1175935838 20:62513652-62513674 TGGTGGGCACGGCCCCGCAGAGG No data
1175935828_1175935841 16 Left 1175935828 20:62513620-62513642 CCGGGAAGCTCCCTGCCCTGCTT No data
Right 1175935841 20:62513659-62513681 CACGGCCCCGCAGAGGGAGAGGG No data
1175935828_1175935840 15 Left 1175935828 20:62513620-62513642 CCGGGAAGCTCCCTGCCCTGCTT No data
Right 1175935840 20:62513658-62513680 GCACGGCCCCGCAGAGGGAGAGG No data
1175935828_1175935837 -2 Left 1175935828 20:62513620-62513642 CCGGGAAGCTCCCTGCCCTGCTT No data
Right 1175935837 20:62513641-62513663 TTGGCATTGTGTGGTGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175935828 Original CRISPR AAGCAGGGCAGGGAGCTTCC CGG (reversed) Intergenic