ID: 1175935831

View in Genome Browser
Species Human (GRCh38)
Location 20:62513631-62513653
Sequence CACACAATGCCAAGCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175935831_1175935846 15 Left 1175935831 20:62513631-62513653 CCTGCCCTGCTTGGCATTGTGTG No data
Right 1175935846 20:62513669-62513691 CAGAGGGAGAGGGCTCATGGAGG No data
1175935831_1175935839 -1 Left 1175935831 20:62513631-62513653 CCTGCCCTGCTTGGCATTGTGTG No data
Right 1175935839 20:62513653-62513675 GGTGGGCACGGCCCCGCAGAGGG No data
1175935831_1175935840 4 Left 1175935831 20:62513631-62513653 CCTGCCCTGCTTGGCATTGTGTG No data
Right 1175935840 20:62513658-62513680 GCACGGCCCCGCAGAGGGAGAGG No data
1175935831_1175935845 12 Left 1175935831 20:62513631-62513653 CCTGCCCTGCTTGGCATTGTGTG No data
Right 1175935845 20:62513666-62513688 CCGCAGAGGGAGAGGGCTCATGG No data
1175935831_1175935848 24 Left 1175935831 20:62513631-62513653 CCTGCCCTGCTTGGCATTGTGTG No data
Right 1175935848 20:62513678-62513700 AGGGCTCATGGAGGAAGGAGAGG No data
1175935831_1175935849 25 Left 1175935831 20:62513631-62513653 CCTGCCCTGCTTGGCATTGTGTG No data
Right 1175935849 20:62513679-62513701 GGGCTCATGGAGGAAGGAGAGGG No data
1175935831_1175935838 -2 Left 1175935831 20:62513631-62513653 CCTGCCCTGCTTGGCATTGTGTG No data
Right 1175935838 20:62513652-62513674 TGGTGGGCACGGCCCCGCAGAGG No data
1175935831_1175935847 19 Left 1175935831 20:62513631-62513653 CCTGCCCTGCTTGGCATTGTGTG No data
Right 1175935847 20:62513673-62513695 GGGAGAGGGCTCATGGAGGAAGG No data
1175935831_1175935841 5 Left 1175935831 20:62513631-62513653 CCTGCCCTGCTTGGCATTGTGTG No data
Right 1175935841 20:62513659-62513681 CACGGCCCCGCAGAGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175935831 Original CRISPR CACACAATGCCAAGCAGGGC AGG (reversed) Intergenic
No off target data available for this crispr