ID: 1175935834

View in Genome Browser
Species Human (GRCh38)
Location 20:62513635-62513657
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175935827_1175935834 -5 Left 1175935827 20:62513617-62513639 CCACCGGGAAGCTCCCTGCCCTG No data
Right 1175935834 20:62513635-62513657 CCCTGCTTGGCATTGTGTGGTGG No data
1175935828_1175935834 -8 Left 1175935828 20:62513620-62513642 CCGGGAAGCTCCCTGCCCTGCTT No data
Right 1175935834 20:62513635-62513657 CCCTGCTTGGCATTGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175935834 Original CRISPR CCCTGCTTGGCATTGTGTGG TGG Intergenic
No off target data available for this crispr