ID: 1175935836

View in Genome Browser
Species Human (GRCh38)
Location 20:62513636-62513658
Sequence CCTGCTTGGCATTGTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175935827_1175935836 -4 Left 1175935827 20:62513617-62513639 CCACCGGGAAGCTCCCTGCCCTG No data
Right 1175935836 20:62513636-62513658 CCTGCTTGGCATTGTGTGGTGGG No data
1175935828_1175935836 -7 Left 1175935828 20:62513620-62513642 CCGGGAAGCTCCCTGCCCTGCTT No data
Right 1175935836 20:62513636-62513658 CCTGCTTGGCATTGTGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175935836 Original CRISPR CCTGCTTGGCATTGTGTGGT GGG Intergenic
No off target data available for this crispr