ID: 1175935840

View in Genome Browser
Species Human (GRCh38)
Location 20:62513658-62513680
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175935827_1175935840 18 Left 1175935827 20:62513617-62513639 CCACCGGGAAGCTCCCTGCCCTG No data
Right 1175935840 20:62513658-62513680 GCACGGCCCCGCAGAGGGAGAGG No data
1175935833_1175935840 0 Left 1175935833 20:62513635-62513657 CCCTGCTTGGCATTGTGTGGTGG No data
Right 1175935840 20:62513658-62513680 GCACGGCCCCGCAGAGGGAGAGG No data
1175935831_1175935840 4 Left 1175935831 20:62513631-62513653 CCTGCCCTGCTTGGCATTGTGTG No data
Right 1175935840 20:62513658-62513680 GCACGGCCCCGCAGAGGGAGAGG No data
1175935830_1175935840 5 Left 1175935830 20:62513630-62513652 CCCTGCCCTGCTTGGCATTGTGT No data
Right 1175935840 20:62513658-62513680 GCACGGCCCCGCAGAGGGAGAGG No data
1175935835_1175935840 -1 Left 1175935835 20:62513636-62513658 CCTGCTTGGCATTGTGTGGTGGG No data
Right 1175935840 20:62513658-62513680 GCACGGCCCCGCAGAGGGAGAGG No data
1175935828_1175935840 15 Left 1175935828 20:62513620-62513642 CCGGGAAGCTCCCTGCCCTGCTT No data
Right 1175935840 20:62513658-62513680 GCACGGCCCCGCAGAGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175935840 Original CRISPR GCACGGCCCCGCAGAGGGAG AGG Intergenic
No off target data available for this crispr