ID: 1175936248

View in Genome Browser
Species Human (GRCh38)
Location 20:62515462-62515484
Sequence CCCACCTGCGGGTTTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 131}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175936248_1175936260 3 Left 1175936248 20:62515462-62515484 CCACCTGGAAACCCGCAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1175936260 20:62515488-62515510 GGTTCACCCCAGGGGTGTAGGGG 0: 1
1: 0
2: 0
3: 8
4: 107
1175936248_1175936259 2 Left 1175936248 20:62515462-62515484 CCACCTGGAAACCCGCAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1175936259 20:62515487-62515509 TGGTTCACCCCAGGGGTGTAGGG 0: 1
1: 0
2: 0
3: 7
4: 166
1175936248_1175936265 11 Left 1175936248 20:62515462-62515484 CCACCTGGAAACCCGCAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1175936265 20:62515496-62515518 CCAGGGGTGTAGGGGTGCTAGGG 0: 1
1: 0
2: 1
3: 18
4: 154
1175936248_1175936254 -7 Left 1175936248 20:62515462-62515484 CCACCTGGAAACCCGCAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1175936254 20:62515478-62515500 AGGTGGGCCTGGTTCACCCCAGG 0: 1
1: 0
2: 0
3: 18
4: 223
1175936248_1175936258 1 Left 1175936248 20:62515462-62515484 CCACCTGGAAACCCGCAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1175936258 20:62515486-62515508 CTGGTTCACCCCAGGGGTGTAGG 0: 1
1: 0
2: 3
3: 7
4: 167
1175936248_1175936263 10 Left 1175936248 20:62515462-62515484 CCACCTGGAAACCCGCAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1175936263 20:62515495-62515517 CCCAGGGGTGTAGGGGTGCTAGG 0: 1
1: 0
2: 1
3: 26
4: 269
1175936248_1175936255 -6 Left 1175936248 20:62515462-62515484 CCACCTGGAAACCCGCAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1175936255 20:62515479-62515501 GGTGGGCCTGGTTCACCCCAGGG 0: 1
1: 0
2: 0
3: 49
4: 208
1175936248_1175936256 -5 Left 1175936248 20:62515462-62515484 CCACCTGGAAACCCGCAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1175936256 20:62515480-62515502 GTGGGCCTGGTTCACCCCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 160
1175936248_1175936266 15 Left 1175936248 20:62515462-62515484 CCACCTGGAAACCCGCAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1175936266 20:62515500-62515522 GGGTGTAGGGGTGCTAGGGAAGG 0: 1
1: 0
2: 5
3: 58
4: 569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175936248 Original CRISPR CCCACCTGCGGGTTTCCAGG TGG (reversed) Intergenic
900166995 1:1247824-1247846 CTCACCTGCGGGGGTCCAGCAGG - Intergenic
900367162 1:2315981-2316003 CCCACCTGCCGGCTTCCATCTGG - Intergenic
900578565 1:3396205-3396227 CCCAGCTGGGGGTGTCCTGGGGG - Intronic
900605273 1:3521082-3521104 CCCGCCTGGGGCTTTGCAGGGGG - Intronic
900701454 1:4051091-4051113 CCCAGCTGAGGGCTCCCAGGAGG - Intergenic
903261511 1:22134107-22134129 CGGCCCTGCGGGTGTCCAGGTGG + Intronic
904029108 1:27522993-27523015 CCCAGCTCGGGGTTTCCAGGAGG + Intergenic
907985777 1:59528682-59528704 CCCATCTGAGGGTTTCATGGTGG - Intronic
908805550 1:67927650-67927672 CCACCCTGCAGCTTTCCAGGAGG + Intergenic
913195901 1:116455538-116455560 CCCAACTGGGAGTTTCCAGAGGG + Intergenic
914430071 1:147612935-147612957 TCCAGCTGGGGGTTTCCAGATGG - Exonic
920926224 1:210344073-210344095 CCCACCTGTGGGGTTCAGGGAGG - Intronic
922768285 1:228167322-228167344 CCCACCCGTTGGATTCCAGGTGG + Intronic
923087698 1:230713899-230713921 CCCACCTGGGGTCTTACAGGAGG - Intronic
923265999 1:232314762-232314784 CCCACCTTCTGCCTTCCAGGGGG + Intergenic
1065307688 10:24384129-24384151 ATCAACAGCGGGTTTCCAGGGGG - Intronic
1067528712 10:47055113-47055135 CCCACCTGCAGGCATCCTGGAGG + Intergenic
1069346609 10:67477291-67477313 CCCACCTACAGGTTTCCTGATGG - Intronic
1071473903 10:86008267-86008289 TCCTTCTGAGGGTTTCCAGGAGG - Intronic
1072000423 10:91190133-91190155 CCCACTTCCTGGTTTCCAGGTGG + Intronic
1076316914 10:129548726-129548748 CCCACCTGCAGCTTTCGGGGGGG + Intronic
1076336974 10:129713489-129713511 CAGGCCCGCGGGTTTCCAGGTGG + Intronic
1076462389 10:130656027-130656049 CCCACCTGCATGTCCCCAGGCGG - Intergenic
1077083311 11:735291-735313 CCCACCTGAGGGTCTTCACGGGG + Intergenic
1077083450 11:735773-735795 CCCACCTGAGGGTCTTCACGGGG + Intergenic
1077173245 11:1177664-1177686 CCCACCTCCAGGTTTCCAGCCGG - Intronic
1083803060 11:65057870-65057892 CCCACCTGTGGGGTTCCAGAAGG + Exonic
1084939764 11:72606291-72606313 CCCAGCTGAGGGTATCCTGGAGG + Intronic
1086514537 11:87596559-87596581 CCCATCTGTGGGTGTCCAGATGG - Intergenic
1089561639 11:119346155-119346177 CCGACCTGCGGGTTGGCAGGTGG + Exonic
1092236896 12:6816045-6816067 CCCACCTCCAGCTTTCCAGAAGG + Exonic
1096053755 12:48633739-48633761 CCCAGCTGAGGGTTCCCAGTAGG + Intergenic
1104870827 12:131994293-131994315 CCCACCTGGGGGCCTGCAGGGGG - Intronic
1104981104 12:132573476-132573498 CCCACCTGCAGGTGTCGAGCAGG + Intronic
1105038880 12:132946558-132946580 CCCAGCTGCCGGTTTCCAAGGGG + Intronic
1109004367 13:56852531-56852553 CTCACCTGAGGGTTGCCATGTGG + Intergenic
1110029511 13:70589682-70589704 CCCATGTGCGGGTTTGCAGAAGG - Intergenic
1119379493 14:74219509-74219531 CCCAGGCGCGGGTTTCCAGGAGG + Intergenic
1120394481 14:83952283-83952305 TCCACCTGAGGGATGCCAGGTGG + Intergenic
1121314005 14:92950371-92950393 CCAGCCTGCGGGCGTCCAGGAGG + Intronic
1122158998 14:99769246-99769268 CCCACCAGCGGTTTTGCAGCAGG + Intronic
1122179779 14:99946674-99946696 CCCTCCTGGGGCGTTCCAGGGGG + Intergenic
1124159331 15:27254586-27254608 CCCACCTCCTGGTTTATAGGTGG + Intronic
1127834940 15:62783370-62783392 GCCTCCTGGGGGTTTCTAGGGGG + Intronic
1129424507 15:75454301-75454323 CCCACCTCCGGCTCTCCCGGAGG - Intronic
1131793458 15:95989544-95989566 GCCACCTGGTGATTTCCAGGAGG - Intergenic
1132621233 16:869142-869164 CCCTCCTGAGGCTTTCCTGGAGG + Intronic
1132855716 16:2043790-2043812 GCCACCTGTGGGTCTCCTGGGGG - Intronic
1133056316 16:3147248-3147270 CCCACCCCAGGCTTTCCAGGAGG + Exonic
1134164105 16:11916137-11916159 CCCCGCTGCGGTTTTCCCGGGGG + Intergenic
1138614747 16:58156568-58156590 CTCACCTGCTGGTGTCCAGGGGG + Intergenic
1139166137 16:64567011-64567033 TGCACCTGTGGGTTTGCAGGGGG - Intergenic
1141156560 16:81601300-81601322 CCTGCCTGCTGGTTTCCATGGGG - Intronic
1146399425 17:32491713-32491735 GCTCCATGCGGGTTTCCAGGAGG + Intergenic
1146985136 17:37208904-37208926 ACCACCTGCGGTGTTGCAGGGGG + Intronic
1147653126 17:42073048-42073070 ACCACCTGCTGGGTGCCAGGGGG + Intergenic
1148462642 17:47847262-47847284 CCTCCCTGCGGGTATCCCGGGGG - Exonic
1150639456 17:66939665-66939687 CCCTCCTGCGGTTTGCCTGGGGG - Intergenic
1151337741 17:73450076-73450098 CCCACCTGAGAGTTTCCTGCAGG + Intronic
1152581346 17:81166666-81166688 CTCACTTGCAGGTTTCGAGGCGG + Intergenic
1152809712 17:82375670-82375692 CCTCCCTGAGGGTCTCCAGGAGG + Intergenic
1156788132 18:40939867-40939889 CCCGGCTGCTGCTTTCCAGGAGG - Intergenic
1158261313 18:55609070-55609092 CCCACTTCCTGGTTTGCAGGTGG - Intronic
1161594143 19:5142618-5142640 CCCACCTGACAGTGTCCAGGTGG + Intronic
1162905848 19:13823445-13823467 CACACTGGCGGGTCTCCAGGTGG - Exonic
1166912082 19:46166026-46166048 TCCACCTGCTGATTTCCAGGTGG - Intergenic
925812193 2:7711643-7711665 CCCACTTCCTGGTTTGCAGGTGG - Intergenic
929579175 2:43070917-43070939 CCCACCTCTGGTTTTCCATGAGG - Intergenic
932368792 2:71170696-71170718 CCCACCTGCTGGTTCACAGAGGG + Intergenic
936785905 2:116094284-116094306 CCCATCTTCAGGTTCCCAGGAGG + Intergenic
941812626 2:169768875-169768897 CCCACCCGACGGTTTCCTGGAGG + Intronic
941905641 2:170715003-170715025 CCCAAGCGCGGGTCTCCAGGCGG + Intergenic
942226005 2:173816628-173816650 CTCACCTGGAGGATTCCAGGAGG + Intergenic
944906295 2:204265194-204265216 CCCAGCTGTGGGTTACCAGGAGG + Intergenic
1168765790 20:381100-381122 CCCACCTGCTGGTGCCCTGGAGG + Exonic
1168768365 20:397428-397450 CCCACCTGGGACTTTCCAGGTGG - Exonic
1168819114 20:761571-761593 CCCACCTGGGGCTTCCCGGGAGG + Intronic
1171532619 20:25862398-25862420 CCCACCCGCCGGGTCCCAGGTGG - Intronic
1172781382 20:37438685-37438707 CCCACCCGCCGGCTCCCAGGAGG - Intergenic
1173326453 20:42037907-42037929 CACAGCTGCTGCTTTCCAGGAGG + Intergenic
1173497965 20:43532778-43532800 CCCACCCCTGGGCTTCCAGGTGG + Exonic
1173564655 20:44030110-44030132 TCCAAGTGGGGGTTTCCAGGTGG - Intronic
1174424800 20:50424305-50424327 CCCAGCTGACGGTTGCCAGGTGG - Intergenic
1174610427 20:51793755-51793777 TCCACCCACGGGTTTCCAGGAGG + Intronic
1175904110 20:62371428-62371450 CACACCTGGGGGGTTTCAGGTGG + Intergenic
1175936248 20:62515462-62515484 CCCACCTGCGGGTTTCCAGGTGG - Intergenic
1176976261 21:15326202-15326224 CCCACCTTCGTGTGGCCAGGCGG + Intergenic
1177697254 21:24589495-24589517 CCCATCTGTGGTTTTCCAAGTGG - Intergenic
1179225065 21:39445775-39445797 CCCGCGCGCGGGTTTCCATGGGG - Intronic
1179257134 21:39726769-39726791 CCTACCTGAGGGCCTCCAGGAGG + Intergenic
1180940471 22:19657237-19657259 CCCACTTGCCAGTTTCCAAGTGG + Intergenic
1185246049 22:49773686-49773708 CACACCTGCGGGGTTTGAGGTGG + Exonic
1185310704 22:50152731-50152753 CCCGGCTGCTGGGTTCCAGGTGG + Intronic
950435518 3:12977084-12977106 CCCAGCTGAGGGATTACAGGTGG + Intronic
953498314 3:43407865-43407887 CCCACGTGGGGCTTTGCAGGGGG + Intronic
953882561 3:46698634-46698656 CCCACCTGAGGGTTCACAGCCGG + Intergenic
960902286 3:122564655-122564677 CCGGCCCCCGGGTTTCCAGGCGG + Intronic
961210186 3:125119548-125119570 CCCAGCTGGGAGGTTCCAGGAGG - Intronic
963327768 3:143881160-143881182 CCCAGCTGAGGGCTTCCAGAAGG + Intergenic
968972984 4:3805760-3805782 CCCTCCTGCAGGTTTCCCTGCGG + Intergenic
982904844 4:161054739-161054761 CCAACCTGCGAGTCTCCAGCCGG + Intergenic
985619893 5:948699-948721 CTCAACTTCGGGTTTTCAGGGGG + Intergenic
997001869 5:129771248-129771270 CAGACCTGCAGGTTTCCCGGAGG - Intergenic
998394250 5:141808148-141808170 CCCACCATGGGCTTTCCAGGTGG - Intergenic
998526522 5:142847824-142847846 CCCACCTCCAGGTGTCCAGATGG - Intronic
1002070633 5:176677162-176677184 CCCACTTCCAGTTTTCCAGGGGG + Intergenic
1002932532 6:1644312-1644334 CCCAGCAGAGGGCTTCCAGGTGG - Intronic
1005013602 6:21358109-21358131 TCCACCCGTGGGTTTCTAGGTGG + Intergenic
1005360516 6:25027328-25027350 GCCCTCTGCGGGTTCCCAGGGGG + Intronic
1006402586 6:33826424-33826446 CAGACCTGCGGCTTCCCAGGTGG - Intergenic
1007229550 6:40338734-40338756 GCCACCTGCAGGGTTCCAGTAGG - Intergenic
1007433059 6:41787459-41787481 CCCACCTCCGGCTCTCCAGCCGG - Intronic
1012491202 6:99784177-99784199 ACCACATGAGGGTTTGCAGGAGG - Intergenic
1015168834 6:130228742-130228764 CCCACATGCGGGCTTCCATCAGG - Intronic
1019198552 6:170296317-170296339 CGCACCTGAGGGCTTCCTGGAGG + Intronic
1019262532 7:89556-89578 CCCACCTGCTGGTCTCCAGCTGG + Intergenic
1019476571 7:1247386-1247408 GCCGCCTGCGGGTCTCCAGCAGG - Intergenic
1019687323 7:2388945-2388967 CCCATCTCAGGGGTTCCAGGAGG + Intergenic
1024318454 7:48042989-48043011 CACACCTCCAGGTTTCCAGATGG - Intronic
1025070730 7:55896066-55896088 TCTACCTGGGGGTGTCCAGGAGG + Intronic
1026196147 7:68175530-68175552 CCCACCTGTGGGTTATCAAGAGG - Intergenic
1026808314 7:73441951-73441973 CCCTTCTGAGAGTTTCCAGGAGG - Intronic
1029526599 7:101098481-101098503 CACACCTGCGTGTGCCCAGGTGG - Intergenic
1033922558 7:146412185-146412207 CCGACCTGCAGGGCTCCAGGGGG - Intronic
1035211239 7:157329826-157329848 TCCACCTCCGGGGTTCCAGCGGG - Intergenic
1035731689 8:1858109-1858131 CCCACAGGTGAGTTTCCAGGAGG + Exonic
1036186151 8:6624130-6624152 CCCGCCCGTGGGTTTTCAGGAGG + Intronic
1039900175 8:41746109-41746131 CCCATCAGCGGGTTTCCCTGTGG - Intronic
1040285248 8:46097488-46097510 CCCACCTGGGGGTACCCATGGGG - Intergenic
1040296732 8:46152730-46152752 CCCACCTGAGGGGCTCCCGGGGG + Intergenic
1040322706 8:46326676-46326698 CCCACCTGGGGGTTGCCTTGGGG + Intergenic
1045505368 8:102774430-102774452 CTCACCTTTGGGCTTCCAGGTGG + Intergenic
1045837275 8:106537067-106537089 CCCACATGCTGGTTTGCAGATGG + Intronic
1047201880 8:122774052-122774074 CCCCACTCCTGGTTTCCAGGAGG - Intergenic
1047818721 8:128494695-128494717 CCCACTTGCTGGTTTCCAGATGG + Intergenic
1048521961 8:135164447-135164469 CTCACCTGCAGGTTTAGAGGGGG - Intergenic
1048906459 8:139093854-139093876 GCCACCTGTGGGTGTGCAGGGGG + Intergenic
1049369570 8:142257434-142257456 CCTGCCTGGGGGTCTCCAGGAGG - Intronic
1050405401 9:5304016-5304038 GCCTCCTGCGGGTCTCCGGGCGG + Intronic
1050408703 9:5339182-5339204 GCCTCCTGCGGGTCTCCGGGCGG + Intronic
1053175044 9:35916437-35916459 CCCTCCTGCTGGTGTCGAGGTGG - Intergenic
1055942624 9:81664834-81664856 CCCACCTGCGGAGTTCCTGTTGG + Intronic
1062043544 9:134415036-134415058 CCCACCATCAGGTTTCCAGTAGG + Intronic
1062508977 9:136894477-136894499 CCCACCTCAGGGTTGCCAAGGGG + Intronic
1189694656 X:43652090-43652112 CCTACCTGCGGGTTTCCTGTGGG + Intergenic
1199927301 X:152480815-152480837 ACCACCAGCGGTTTTGCAGGTGG + Intergenic
1201489454 Y:14524809-14524831 TCTGCCTGCGGTTTTCCAGGAGG + Intronic