ID: 1175936930

View in Genome Browser
Species Human (GRCh38)
Location 20:62518251-62518273
Sequence CAGCTGTACTTGGGGAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175936919_1175936930 19 Left 1175936919 20:62518209-62518231 CCTGCTCAGGAAGGAGAGCTACC No data
Right 1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG No data
1175936924_1175936930 -7 Left 1175936924 20:62518235-62518257 CCCAGCTCGGATCCTGCAGCTGT No data
Right 1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG No data
1175936921_1175936930 -2 Left 1175936921 20:62518230-62518252 CCCCTCCCAGCTCGGATCCTGCA No data
Right 1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG No data
1175936922_1175936930 -3 Left 1175936922 20:62518231-62518253 CCCTCCCAGCTCGGATCCTGCAG No data
Right 1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG No data
1175936923_1175936930 -4 Left 1175936923 20:62518232-62518254 CCTCCCAGCTCGGATCCTGCAGC No data
Right 1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG No data
1175936917_1175936930 26 Left 1175936917 20:62518202-62518224 CCCAGCGCCTGCTCAGGAAGGAG No data
Right 1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG No data
1175936925_1175936930 -8 Left 1175936925 20:62518236-62518258 CCAGCTCGGATCCTGCAGCTGTA No data
Right 1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG No data
1175936918_1175936930 25 Left 1175936918 20:62518203-62518225 CCAGCGCCTGCTCAGGAAGGAGA No data
Right 1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG No data
1175936916_1175936930 27 Left 1175936916 20:62518201-62518223 CCCCAGCGCCTGCTCAGGAAGGA No data
Right 1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175936930 Original CRISPR CAGCTGTACTTGGGGAGCCA TGG Intergenic
No off target data available for this crispr