ID: 1175937940

View in Genome Browser
Species Human (GRCh38)
Location 20:62523532-62523554
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175937940_1175937957 26 Left 1175937940 20:62523532-62523554 CCCCCGGCCCTCCCCAGAGCCCT No data
Right 1175937957 20:62523581-62523603 GCGGAGACGCTGACACCCTCTGG No data
1175937940_1175937955 7 Left 1175937940 20:62523532-62523554 CCCCCGGCCCTCCCCAGAGCCCT No data
Right 1175937955 20:62523562-62523584 GTGTGAGTGCAGGCGTCCAGCGG No data
1175937940_1175937953 -3 Left 1175937940 20:62523532-62523554 CCCCCGGCCCTCCCCAGAGCCCT No data
Right 1175937953 20:62523552-62523574 CCTCCTGGGAGTGTGAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175937940 Original CRISPR AGGGCTCTGGGGAGGGCCGG GGG (reversed) Intergenic
No off target data available for this crispr