ID: 1175940891

View in Genome Browser
Species Human (GRCh38)
Location 20:62537054-62537076
Sequence CCTCCACACAGGCCTCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175940891_1175940900 19 Left 1175940891 20:62537054-62537076 CCAGGAGGAGGCCTGTGTGGAGG No data
Right 1175940900 20:62537096-62537118 AGAGGGAAATGTATGTGTTTTGG No data
1175940891_1175940899 2 Left 1175940891 20:62537054-62537076 CCAGGAGGAGGCCTGTGTGGAGG No data
Right 1175940899 20:62537079-62537101 GAGGGGCAGTGCTGCACAGAGGG No data
1175940891_1175940898 1 Left 1175940891 20:62537054-62537076 CCAGGAGGAGGCCTGTGTGGAGG No data
Right 1175940898 20:62537078-62537100 GGAGGGGCAGTGCTGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175940891 Original CRISPR CCTCCACACAGGCCTCCTCC TGG (reversed) Intergenic
No off target data available for this crispr