ID: 1175943834

View in Genome Browser
Species Human (GRCh38)
Location 20:62549865-62549887
Sequence AGAGTCTCCGGAAACCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175943827_1175943834 17 Left 1175943827 20:62549825-62549847 CCAAGGCGACTGGCATTTGTCAT No data
Right 1175943834 20:62549865-62549887 AGAGTCTCCGGAAACCCAGGTGG No data
1175943824_1175943834 29 Left 1175943824 20:62549813-62549835 CCTTGCCTCTGTCCAAGGCGACT No data
Right 1175943834 20:62549865-62549887 AGAGTCTCCGGAAACCCAGGTGG No data
1175943826_1175943834 24 Left 1175943826 20:62549818-62549840 CCTCTGTCCAAGGCGACTGGCAT No data
Right 1175943834 20:62549865-62549887 AGAGTCTCCGGAAACCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175943834 Original CRISPR AGAGTCTCCGGAAACCCAGG TGG Intergenic
No off target data available for this crispr